Starting /dee2/code/volunteer_pipeline.sh SRR12161377 current disk space = 3087569620992 free memory = 1579324568 SRR12161377 SRAfilesize cb0a7f48f6d11a3a7860b517a79423b0 SRR12161377.sra SRR12161377.sra file validated SRR12161377 is paired end SRR12161377 is conventional basespace SRR12161377 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161377_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5195 37.0 37.0 37.0 37.0 37.0 2 36.423 37.0 37.0 37.0 37.0 37.0 3 36.435 37.0 37.0 37.0 37.0 37.0 4 36.55 37.0 37.0 37.0 37.0 37.0 5 36.502 37.0 37.0 37.0 37.0 37.0 6 36.6155 37.0 37.0 37.0 37.0 37.0 7 36.449 37.0 37.0 37.0 37.0 37.0 8 36.5425 37.0 37.0 37.0 37.0 37.0 9 36.4945 37.0 37.0 37.0 37.0 37.0 10-14 36.5573 37.0 37.0 37.0 37.0 37.0 15-19 36.52720000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.499700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4722 37.0 37.0 37.0 37.0 37.0 30-34 36.4416 37.0 37.0 37.0 37.0 37.0 35-39 36.424400000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4131 37.0 37.0 37.0 37.0 37.0 45-49 36.3902 37.0 37.0 37.0 37.0 37.0 50-54 36.3301 37.0 37.0 37.0 37.0 37.0 55-59 36.3997 37.0 37.0 37.0 37.0 37.0 60-64 36.3498 37.0 37.0 37.0 37.0 37.0 65-69 36.2961 37.0 37.0 37.0 37.0 37.0 70-74 36.2951 37.0 37.0 37.0 37.0 37.0 75-79 36.2505 37.0 37.0 37.0 37.0 37.0 80-84 36.26030000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2411 37.0 37.0 37.0 37.0 37.0 90-94 36.2674 37.0 37.0 37.0 37.0 37.0 95-99 36.1909 37.0 37.0 37.0 37.0 37.0 100-104 36.2195 37.0 37.0 37.0 37.0 37.0 105-109 36.150999999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1426 37.0 37.0 37.0 37.0 37.0 115-119 36.1409 37.0 37.0 37.0 37.0 37.0 120-124 36.111599999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.037600000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.9854 37.0 37.0 37.0 37.0 37.0 135-139 35.9745 37.0 37.0 37.0 37.0 37.0 140-144 35.9462 37.0 37.0 37.0 37.0 37.0 145-149 35.9327 37.0 37.0 37.0 37.0 37.0 150-151 35.76975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 1.0 25 3.0 26 6.0 27 1.0 28 15.0 29 20.0 30 26.0 31 42.0 32 45.0 33 73.0 34 116.0 35 279.0 36 2937.0 37 433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.995995995996 12.137137137137136 6.131131131131131 35.73573573573574 2 19.775000000000002 12.4 34.599999999999994 33.225 3 16.900000000000002 15.575 29.299999999999997 38.224999999999994 4 21.05 24.5 25.124999999999996 29.325000000000003 5 23.25 31.924999999999997 23.45 21.375 6 20.925 35.075 23.400000000000002 20.599999999999998 7 14.95 26.450000000000003 41.699999999999996 16.900000000000002 8 17.825 26.55 31.8 23.825 9 16.625 24.575 32.9 25.900000000000002 10-14 19.52 29.475 27.74 23.265 15-19 19.48 27.839999999999996 28.060000000000002 24.62 20-24 20.01 28.499999999999996 27.67 23.82 25-29 19.869999999999997 27.939999999999998 28.13 24.060000000000002 30-34 19.485 28.59 27.334999999999997 24.59 35-39 19.830000000000002 28.54 27.700000000000003 23.93 40-44 19.895 28.775000000000002 27.439999999999998 23.89 45-49 19.925 28.42 27.694999999999997 23.96 50-54 20.380000000000003 27.525 27.63 24.465 55-59 20.255000000000003 27.685 27.62 24.44 60-64 19.994999999999997 28.494999999999997 27.700000000000003 23.810000000000002 65-69 20.275000000000002 27.860000000000003 27.35 24.515 70-74 20.61 28.07 27.315 24.005000000000003 75-79 20.135 28.405 27.525 23.935000000000002 80-84 20.125 28.660000000000004 27.16 24.055 85-89 20.044999999999998 28.92 27.22 23.815 90-94 20.01 28.08 28.07 23.84 95-99 20.375 27.675 27.68 24.27 100-104 20.16 28.515 27.24 24.085 105-109 20.77 27.775 27.37 24.085 110-114 19.915 27.389999999999997 28.29 24.404999999999998 115-119 21.085 27.905 27.715 23.294999999999998 120-124 20.830000000000002 27.77 27.689999999999998 23.71 125-129 20.97 27.805000000000003 27.205000000000002 24.02 130-134 20.74 27.47 27.439999999999998 24.349999999999998 135-139 21.175 27.55 27.495000000000005 23.78 140-144 21.135 28.194999999999997 27.07 23.599999999999998 145-149 21.215 28.18 26.924999999999997 23.68 150-151 21.125 27.575 27.200000000000003 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 2.5 26 3.5 27 5.0 28 12.5 29 15.5 30 13.5 31 26.5 32 35.5 33 47.0 34 62.5 35 67.0 36 75.5 37 99.5 38 134.0 39 161.5 40 175.0 41 180.0 42 204.0 43 240.0 44 246.5 45 241.5 46 252.5 47 255.0 48 234.5 49 226.0 50 211.5 51 167.5 52 146.0 53 111.5 54 73.0 55 64.0 56 49.5 57 43.5 58 33.5 59 23.5 60 24.0 61 13.0 62 5.0 63 4.5 64 2.0 65 0.0 66 1.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.74795460543679 89.75 2 4.935339139614674 9.35 3 0.3167062549485352 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.425 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.6749999999999998 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.3375 0.0 0.0 0.0 0.0 138-139 2.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161377 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161377_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1145 37.0 37.0 37.0 37.0 37.0 2 35.679 37.0 37.0 37.0 37.0 37.0 3 35.8025 37.0 37.0 37.0 37.0 37.0 4 35.9295 37.0 37.0 37.0 37.0 37.0 5 36.0395 37.0 37.0 37.0 37.0 37.0 6 35.967 37.0 37.0 37.0 37.0 37.0 7 35.9675 37.0 37.0 37.0 37.0 37.0 8 35.9815 37.0 37.0 37.0 37.0 37.0 9 36.0555 37.0 37.0 37.0 37.0 37.0 10-14 36.0885 37.0 37.0 37.0 37.0 37.0 15-19 36.031000000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.02810000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.979 37.0 37.0 37.0 37.0 37.0 30-34 35.9512 37.0 37.0 37.0 37.0 37.0 35-39 35.9622 37.0 37.0 37.0 37.0 37.0 40-44 35.957 37.0 37.0 37.0 37.0 37.0 45-49 35.88770000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.8774 37.0 37.0 37.0 37.0 37.0 55-59 35.9028 37.0 37.0 37.0 37.0 37.0 60-64 35.7586 37.0 37.0 37.0 37.0 37.0 65-69 35.7598 37.0 37.0 37.0 37.0 37.0 70-74 35.7238 37.0 37.0 37.0 37.0 37.0 75-79 35.7064 37.0 37.0 37.0 37.0 37.0 80-84 35.768299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.712900000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.679199999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.642100000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.658699999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.628 37.0 37.0 37.0 37.0 37.0 110-114 35.5418 37.0 37.0 37.0 37.0 37.0 115-119 35.632000000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.5409 37.0 37.0 37.0 37.0 37.0 125-129 35.46510000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.321299999999994 37.0 37.0 37.0 29.8 37.0 135-139 35.403 37.0 37.0 37.0 37.0 37.0 140-144 35.268299999999996 37.0 37.0 37.0 29.8 37.0 145-149 35.4059 37.0 37.0 37.0 37.0 37.0 150-151 34.713499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 5.0 20 1.0 21 1.0 22 3.0 23 5.0 24 9.0 25 11.0 26 9.0 27 15.0 28 19.0 29 22.0 30 45.0 31 57.0 32 73.0 33 123.0 34 222.0 35 613.0 36 2585.0 37 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.675000000000004 25.95 8.125 23.25 2 27.55 26.825 28.1 17.525 3 21.05 28.425 31.45 19.075 4 24.474999999999998 34.5 22.75 18.275 5 23.200000000000003 39.5 20.424999999999997 16.875 6 20.175 41.0 20.7 18.125 7 20.925 23.75 36.625 18.7 8 20.724999999999998 26.775 27.400000000000002 25.1 9 21.55 24.775 29.575000000000003 24.099999999999998 10-14 23.71 28.99 26.115 21.185000000000002 15-19 23.330000000000002 28.849999999999998 26.939999999999998 20.880000000000003 20-24 22.73 28.58 27.339999999999996 21.349999999999998 25-29 23.525 28.555000000000003 26.985 20.935000000000002 30-34 22.625 28.165000000000003 27.950000000000003 21.26 35-39 23.465 27.689999999999998 27.650000000000002 21.195 40-44 23.505000000000003 28.82 26.650000000000002 21.025 45-49 23.25 27.860000000000003 27.43 21.46 50-54 23.22 27.439999999999998 28.144999999999996 21.195 55-59 23.06 27.57 27.575 21.795 60-64 23.380000000000003 27.755000000000003 27.644999999999996 21.22 65-69 23.04 27.96 26.995 22.005 70-74 23.775 27.810000000000002 27.02 21.395 75-79 23.775 27.35 27.54 21.335 80-84 23.044999999999998 28.050000000000004 27.6 21.305 85-89 23.599999999999998 27.97 27.12 21.310000000000002 90-94 23.474999999999998 28.065 26.905 21.555 95-99 23.415 27.950000000000003 26.784999999999997 21.85 100-104 24.01 27.615000000000002 26.974999999999998 21.4 105-109 23.11 28.610000000000003 26.939999999999998 21.34 110-114 23.785 27.92 27.485 20.810000000000002 115-119 24.54 27.99 26.669999999999998 20.8 120-124 23.835 27.98 27.07 21.115000000000002 125-129 24.05 28.04 26.825 21.085 130-134 24.815 27.435 27.389999999999997 20.36 135-139 24.18 26.72 28.03 21.07 140-144 24.48 27.48 27.065 20.974999999999998 145-149 25.21 27.97 26.83 19.99 150-151 23.7 28.549999999999997 26.950000000000003 20.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 1.0 19 2.0 20 2.0 21 0.5 22 1.0 23 3.0 24 3.5 25 3.0 26 4.5 27 6.0 28 7.5 29 9.5 30 12.0 31 18.0 32 27.0 33 38.5 34 46.0 35 50.0 36 63.5 37 93.5 38 121.0 39 139.0 40 172.0 41 207.5 42 241.5 43 281.5 44 288.0 45 286.0 46 274.0 47 250.5 48 219.0 49 190.5 50 184.5 51 152.0 52 116.5 53 99.5 54 83.5 55 64.5 56 56.5 57 50.5 58 33.5 59 22.0 60 18.5 61 14.0 62 8.5 63 5.5 64 3.5 65 2.0 66 1.0 67 0.5 68 1.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.99604951277324 90.17500000000001 2 4.74058467210956 9.0 3 0.21069265209375823 0.6 4 0.02633658151171978 0.1 5 0.02633658151171978 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.6125 0.0 0.0 0.0 0.0 128-129 1.7000000000000002 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.1625 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 20 0.00593511 29.0 140-144 GGAAGAG 35 0.0035366106 20.714287 1 >>END_MODULE Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972237 spots for SRR12161377.sra Written 972237 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra Read 972233 spots for SRR12161377.sra Written 972233 spots for SRR12161377.sra SRR ids: ['SRR12161377.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m7ibjw9l SRR12161377.sra spots: 19444664 blocks: [[1, 972233], [972234, 1944466], [1944467, 2916699], [2916700, 3888932], [3888933, 4861165], [4861166, 5833398], [5833399, 6805631], [6805632, 7777864], [7777865, 8750097], [8750098, 9722330], [9722331, 10694563], [10694564, 11666796], [11666797, 12639029], [12639030, 13611262], [13611263, 14583495], [14583496, 15555728], [15555729, 16527961], [16527962, 17500194], [17500195, 18472427], [18472428, 19444664]] SRR12161377 file size 6586447 SRR12161377 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161377 SRR12161377_1.fastq SRR12161377_2.fastq Input file: SRR12161377_1.fastq Paired file: SRR12161377_2.fastq trimmed: SRR12161377-trimmed-pair1.fastq, SRR12161377-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:58:59 2025 >> started Thu Feb 13 19:59:21 2025 >> done (21.751s) 19444664 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 2786 ( 0.01%) empty read pairs filtered out after trimming by size control 19441860 (99.99%) read pairs available; of these: 766961 ( 3.94%) trimmed read pairs available after processing 18674899 (96.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 5 0.00% 22 3 0.00% 23 7 0.00% 24 8 0.00% 25 10 0.00% 26 10 0.00% 27 13 0.00% 28 9 0.00% 29 11 0.00% 30 13 0.00% 31 17 0.00% 32 14 0.00% 33 7 0.00% 34 7 0.00% 35 12 0.00% 36 14 0.00% 37 17 0.00% 38 21 0.00% 39 11 0.00% 40 16 0.00% 41 19 0.00% 42 15 0.00% 43 12 0.00% 44 10 0.00% 45 16 0.00% 46 12 0.00% 47 17 0.00% 48 23 0.00% 49 14 0.00% 50 23 0.00% 51 19 0.00% 52 25 0.00% 53 26 0.00% 54 32 0.00% 55 31 0.00% 56 34 0.00% 57 38 0.00% 58 47 0.00% 59 51 0.00% 60 36 0.00% 61 47 0.00% 62 53 0.00% 63 65 0.00% 64 55 0.00% 65 58 0.00% 66 73 0.00% 67 102 0.00% 68 92 0.00% 69 106 0.00% 70 139 0.00% 71 133 0.00% 72 158 0.00% 73 177 0.00% 74 166 0.00% 75 211 0.00% 76 246 0.00% 77 262 0.00% 78 350 0.00% 79 377 0.00% 80 368 0.00% 81 435 0.00% 82 473 0.00% 83 567 0.00% 84 585 0.00% 85 636 0.00% 86 743 0.00% 87 874 0.00% 88 908 0.00% 89 1048 0.01% 90 1168 0.01% 91 1325 0.01% 92 1436 0.01% 93 1565 0.01% 94 1798 0.01% 95 1992 0.01% 96 2158 0.01% 97 2354 0.01% 98 2458 0.01% 99 2669 0.01% 100 2878 0.01% 101 3056 0.02% 102 3505 0.02% 103 3751 0.02% 104 4041 0.02% 105 4322 0.02% 106 4466 0.02% 107 4913 0.03% 108 5066 0.03% 109 5452 0.03% 110 5641 0.03% 111 6127 0.03% 112 6666 0.03% 113 6913 0.04% 114 7410 0.04% 115 7724 0.04% 116 8536 0.04% 117 8716 0.04% 118 8977 0.05% 119 9521 0.05% 120 10095 0.05% 121 10702 0.06% 122 10983 0.06% 123 11666 0.06% 124 12373 0.06% 125 12678 0.07% 126 13354 0.07% 127 14088 0.07% 128 14606 0.08% 129 15228 0.08% 130 15696 0.08% 131 16553 0.09% 132 17014 0.09% 133 18048 0.09% 134 18742 0.10% 135 19309 0.10% 136 20212 0.10% 137 20886 0.11% 138 21241 0.11% 139 22385 0.12% 140 23069 0.12% 141 23821 0.12% 142 24892 0.13% 143 25683 0.13% 144 26938 0.14% 145 28026 0.14% 146 28629 0.15% 147 29046 0.15% 148 30445 0.16% 149 31113 0.16% 150 32601 0.17% 151 18674899 96.06% 19441860 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.68 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=115.53 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=2.8 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=26 prefix-density=0.80 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=31.11 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR12161377 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:00:01 Started mapping on | Feb 13 20:00:01 Finished on | Feb 13 20:01:49 Mapping speed, Million of reads per hour | 648.06 Number of input reads | 19441860 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 18336361 Uniquely mapped reads % | 94.31% Average mapped length | 299.27 Number of splices: Total | 18752146 Number of splices: Annotated (sjdb) | 18342559 Number of splices: GT/AG | 18377537 Number of splices: GC/AG | 311693 Number of splices: AT/AC | 14359 Number of splices: Non-canonical | 48557 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 420553 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 104566 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 684946 684946 684946 N_multimapping 420553 420553 420553 N_noFeature 583591 18091311 652778 N_ambiguous 292441 1188 115904 UnstrandedReadsAssigned:17460329 PositiveStrandReadsAssigned:243862 NegativeStrandReadsAssigned:17567679 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161377 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161377-trimmed-pair1.fastq SRR12161377-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,441,860 reads, 17,617,666 reads pseudoaligned [quant] estimated average fragment length: 281.932 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR12161377.ke.tsv 34699 SRR12161377.se.tsv 87100 total ==> SRR12161377.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.07 442 11.7054 Potri.005G024800.1.v4.1 1035 754.068 244 14.8854 Potri.004G059700.1.v4.1 961 680.34 36 2.4342 Potri.007G009000.2.v4.1 1416 1135.07 0 0 Potri.003G141000.2.v4.1 2943 2662.07 650 11.2325 Potri.016G087400.1.v4.1 270 67.2635 867 592.953 Potri.015G069301.1.v4.1 564 298.827 0 0 Potri.010G195200.1.v4.1 1773 1492.07 15 0.462469 Potri.012G127500.1.v4.1 977 696.222 267 17.6418 ==> SRR12161377.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 225 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR12161377 completed mapping pipeline successfully