Starting /dee2/code/volunteer_pipeline.sh SRR12161378 current disk space = 3087381422080 free memory = 1457541900 SRR12161378 SRAfilesize d5e70c572d2f265fe835df5b7f068453 SRR12161378.sra SRR12161378.sra file validated SRR12161378 is paired end SRR12161378 is conventional basespace SRR12161378 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.53625 37.0 37.0 37.0 37.0 37.0 2 36.318 37.0 37.0 37.0 37.0 37.0 3 36.3815 37.0 37.0 37.0 37.0 37.0 4 36.4915 37.0 37.0 37.0 37.0 37.0 5 36.576 37.0 37.0 37.0 37.0 37.0 6 36.5155 37.0 37.0 37.0 37.0 37.0 7 36.445 37.0 37.0 37.0 37.0 37.0 8 36.493 37.0 37.0 37.0 37.0 37.0 9 36.5125 37.0 37.0 37.0 37.0 37.0 10-14 36.551500000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5293 37.0 37.0 37.0 37.0 37.0 20-24 36.4931 37.0 37.0 37.0 37.0 37.0 25-29 36.446000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.41759999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4259 37.0 37.0 37.0 37.0 37.0 40-44 36.3728 37.0 37.0 37.0 37.0 37.0 45-49 36.3678 37.0 37.0 37.0 37.0 37.0 50-54 36.3115 37.0 37.0 37.0 37.0 37.0 55-59 36.3181 37.0 37.0 37.0 37.0 37.0 60-64 36.289500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.233900000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.2512 37.0 37.0 37.0 37.0 37.0 75-79 36.2479 37.0 37.0 37.0 37.0 37.0 80-84 36.243100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.22280000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.191199999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1911 37.0 37.0 37.0 37.0 37.0 100-104 36.1443 37.0 37.0 37.0 37.0 37.0 105-109 36.080400000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1169 37.0 37.0 37.0 37.0 37.0 115-119 36.1011 37.0 37.0 37.0 37.0 37.0 120-124 36.0404 37.0 37.0 37.0 37.0 37.0 125-129 36.022000000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.9992 37.0 37.0 37.0 37.0 37.0 135-139 35.929899999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8783 37.0 37.0 37.0 37.0 37.0 145-149 35.79109999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.659000000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 2.0 25 2.0 26 4.0 27 11.0 28 14.0 29 21.0 30 23.0 31 45.0 32 53.0 33 82.0 34 130.0 35 284.0 36 2883.0 37 444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.78809106830122 12.0090067550663 5.32899674756067 31.873905429071804 2 20.65 11.875 34.325 33.15 3 16.75 16.45 30.425 36.375 4 20.925 25.525 25.224999999999998 28.325 5 22.3 31.175000000000004 23.575 22.95 6 20.575 34.8 23.549999999999997 21.075 7 16.05 26.700000000000003 40.275 16.975 8 16.825000000000003 25.974999999999998 33.275 23.925 9 17.7 23.075000000000003 34.625 24.6 10-14 19.89 29.044999999999998 27.925 23.14 15-19 19.314999999999998 28.585 28.065 24.035 20-24 19.935 28.105000000000004 28.38 23.580000000000002 25-29 20.369999999999997 28.74 27.35 23.54 30-34 19.855 27.994999999999997 28.125 24.025 35-39 20.505000000000003 28.505000000000003 27.425 23.565 40-44 19.985 28.935 27.115000000000002 23.965 45-49 20.215 28.439999999999998 27.400000000000002 23.945 50-54 20.39 28.050000000000004 27.894999999999996 23.665 55-59 20.25 28.050000000000004 27.825 23.875 60-64 20.695 28.050000000000004 27.255000000000003 24.0 65-69 20.145 27.985 28.035 23.835 70-74 21.055 27.865000000000002 27.189999999999998 23.89 75-79 20.89 27.975 27.250000000000004 23.885 80-84 20.455000000000002 28.285 27.715 23.544999999999998 85-89 20.43 28.294999999999998 27.169999999999998 24.104999999999997 90-94 21.055 27.21 27.975 23.76 95-99 20.565 27.27 27.584999999999997 24.58 100-104 20.955 28.015 27.250000000000004 23.78 105-109 20.45 27.72 28.125 23.705000000000002 110-114 20.830000000000002 28.03 27.83 23.31 115-119 20.84 27.634999999999998 27.125 24.4 120-124 20.87 27.71 27.48 23.94 125-129 20.68 27.48 27.750000000000004 24.09 130-134 21.295 27.685 27.139999999999997 23.880000000000003 135-139 21.27 28.349999999999998 26.945000000000004 23.435 140-144 21.255 28.205000000000002 26.66 23.880000000000003 145-149 21.44 27.805000000000003 27.07 23.685000000000002 150-151 20.7625 27.8875 26.8625 24.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 2.5 25 2.0 26 2.5 27 6.5 28 13.0 29 17.0 30 20.5 31 23.0 32 25.5 33 36.5 34 51.0 35 68.5 36 80.5 37 96.0 38 127.5 39 159.5 40 187.5 41 202.5 42 220.0 43 222.0 44 229.5 45 253.0 46 255.5 47 257.5 48 247.0 49 218.0 50 184.5 51 157.0 52 139.5 53 105.5 54 89.0 55 72.5 56 45.0 57 39.5 58 32.5 59 28.5 60 24.5 61 19.0 62 10.0 63 4.5 64 2.5 65 1.5 66 2.0 67 3.5 68 3.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.1020191285866 88.55 2 5.552603613177471 10.45 3 0.3188097768331562 0.8999999999999999 4 0.026567481402763018 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.425 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.9 0.0 0.0 0.0 0.0 134-135 3.2249999999999996 0.0 0.0 0.0 0.0 136-137 3.5374999999999996 0.0 0.0 0.0 0.0 138-139 3.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGATC 10 0.006830828 145.0 2 ATGATCT 10 0.006830828 145.0 3 TGATCTT 10 0.006830828 145.0 4 GCATGAT 10 0.006830828 145.0 1 >>END_MODULE SRR12161378 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161378_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.199 37.0 37.0 37.0 37.0 37.0 2 35.8945 37.0 37.0 37.0 37.0 37.0 3 35.97 37.0 37.0 37.0 37.0 37.0 4 36.053 37.0 37.0 37.0 37.0 37.0 5 36.167 37.0 37.0 37.0 37.0 37.0 6 36.1855 37.0 37.0 37.0 37.0 37.0 7 36.089 37.0 37.0 37.0 37.0 37.0 8 36.032 37.0 37.0 37.0 37.0 37.0 9 36.024 37.0 37.0 37.0 37.0 37.0 10-14 36.0997 37.0 37.0 37.0 37.0 37.0 15-19 36.052299999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.0028 37.0 37.0 37.0 37.0 37.0 25-29 35.989700000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.945800000000006 37.0 37.0 37.0 37.0 37.0 35-39 35.9283 37.0 37.0 37.0 37.0 37.0 40-44 35.8464 37.0 37.0 37.0 37.0 37.0 45-49 35.87579999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.856399999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.8037 37.0 37.0 37.0 37.0 37.0 60-64 35.7278 37.0 37.0 37.0 37.0 37.0 65-69 35.717 37.0 37.0 37.0 37.0 37.0 70-74 35.611399999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.6049 37.0 37.0 37.0 37.0 37.0 80-84 35.7041 37.0 37.0 37.0 37.0 37.0 85-89 35.637299999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.6327 37.0 37.0 37.0 37.0 37.0 95-99 35.680899999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.6271 37.0 37.0 37.0 37.0 37.0 105-109 35.5298 37.0 37.0 37.0 37.0 37.0 110-114 35.5467 37.0 37.0 37.0 37.0 37.0 115-119 35.512800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.4757 37.0 37.0 37.0 37.0 37.0 125-129 35.436 37.0 37.0 37.0 37.0 37.0 130-134 35.311 37.0 37.0 37.0 34.6 37.0 135-139 35.3799 37.0 37.0 37.0 37.0 37.0 140-144 35.2473 37.0 37.0 37.0 32.2 37.0 145-149 35.2251 37.0 37.0 37.0 32.2 37.0 150-151 34.74675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 8.0 14 4.0 15 4.0 16 0.0 17 3.0 18 2.0 19 1.0 20 2.0 21 1.0 22 7.0 23 6.0 24 7.0 25 14.0 26 9.0 27 16.0 28 24.0 29 22.0 30 45.0 31 49.0 32 81.0 33 116.0 34 208.0 35 523.0 36 2638.0 37 210.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.925 25.6 8.0 21.475 2 28.125 26.875 28.199999999999996 16.8 3 21.6 27.075 33.0 18.325 4 24.224999999999998 34.275 23.599999999999998 17.9 5 24.875 37.15 21.2 16.775000000000002 6 21.0 39.925 20.5 18.575 7 20.95 23.175 36.75 19.125 8 21.875 26.625 27.35 24.15 9 22.85 24.275 29.45 23.425 10-14 23.155 28.975 26.44 21.43 15-19 23.48 28.095 27.18 21.245 20-24 23.22 28.76 27.145000000000003 20.875 25-29 23.215 27.92 27.62 21.245 30-34 23.005 28.294999999999998 27.58 21.12 35-39 23.35 28.095 27.515 21.04 40-44 23.474999999999998 27.87 27.66 20.995 45-49 23.09 27.985 27.435 21.490000000000002 50-54 23.62 27.975 27.439999999999998 20.965 55-59 23.73 27.325 27.495000000000005 21.45 60-64 23.724999999999998 27.474999999999998 27.315 21.485000000000003 65-69 23.21 27.544999999999998 27.68 21.565 70-74 23.705000000000002 28.275 26.615 21.404999999999998 75-79 23.3 28.32 26.96 21.42 80-84 23.18 27.544999999999998 27.325 21.95 85-89 23.330000000000002 27.91 27.07 21.69 90-94 23.76 27.615000000000002 27.279999999999998 21.345 95-99 23.265 28.23 26.87 21.634999999999998 100-104 24.01 27.775 26.76 21.455 105-109 23.815 27.305 27.284999999999997 21.595 110-114 23.415 27.965 27.295 21.325 115-119 23.62 28.22 27.1 21.060000000000002 120-124 23.595 27.615000000000002 27.71 21.08 125-129 24.305 27.57 26.775 21.349999999999998 130-134 24.525 28.29 27.04 20.145 135-139 24.135 27.935 27.400000000000002 20.53 140-144 24.775 27.295 27.465 20.465 145-149 24.895 27.76 27.155 20.19 150-151 25.174999999999997 28.462500000000002 27.700000000000003 18.6625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 1.0 10 1.5 11 1.5 12 1.0 13 2.0 14 2.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 2.5 23 1.0 24 1.5 25 5.5 26 7.5 27 7.5 28 6.0 29 7.5 30 13.0 31 19.0 32 21.5 33 29.5 34 45.0 35 51.5 36 69.0 37 106.0 38 118.0 39 149.0 40 185.5 41 191.0 42 225.0 43 259.5 44 282.5 45 285.0 46 275.0 47 268.0 48 237.5 49 200.5 50 174.5 51 139.5 52 114.0 53 102.5 54 88.5 55 71.0 56 54.5 57 36.5 58 25.5 59 27.5 60 21.0 61 13.5 62 10.5 63 8.0 64 3.0 65 1.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.5 71 2.0 72 3.0 73 1.5 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 1.5 96 1.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.69466058492085 87.3 2 5.6882210893480005 10.6 3 0.3756372417493963 1.05 4 0.16098738932116982 0.6 5 0.0 0.0 6 0.08049369466058491 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.8875 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.225 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.4375 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGCTT 10 0.006830828 145.0 8 GGGCTTG 10 0.006830828 145.0 9 >>END_MODULE Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra Read 768386 spots for SRR12161378.sra Written 768386 spots for SRR12161378.sra Read 768368 spots for SRR12161378.sra Written 768368 spots for SRR12161378.sra SRR ids: ['SRR12161378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d8dz9qfz SRR12161378.sra spots: 15367378 blocks: [[1, 768368], [768369, 1536736], [1536737, 2305104], [2305105, 3073472], [3073473, 3841840], [3841841, 4610208], [4610209, 5378576], [5378577, 6146944], [6146945, 6915312], [6915313, 7683680], [7683681, 8452048], [8452049, 9220416], [9220417, 9988784], [9988785, 10757152], [10757153, 11525520], [11525521, 12293888], [12293889, 13062256], [13062257, 13830624], [13830625, 14598992], [14598993, 15367378]] SRR12161378 file size 5200806 SRR12161378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161378 SRR12161378_1.fastq SRR12161378_2.fastq Input file: SRR12161378_1.fastq Paired file: SRR12161378_2.fastq trimmed: SRR12161378-trimmed-pair1.fastq, SRR12161378-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:06:21 2025 >> started Thu Feb 13 19:06:40 2025 >> done (18.746s) 15367378 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 37787 ( 0.25%) empty read pairs filtered out after trimming by size control 15329560 (99.75%) read pairs available; of these: 1068154 ( 6.97%) trimmed read pairs available after processing 14261406 (93.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 9 0.00% 23 7 0.00% 24 4 0.00% 25 7 0.00% 26 11 0.00% 27 12 0.00% 28 12 0.00% 29 18 0.00% 30 14 0.00% 31 18 0.00% 32 14 0.00% 33 14 0.00% 34 11 0.00% 35 17 0.00% 36 6 0.00% 37 15 0.00% 38 17 0.00% 39 16 0.00% 40 10 0.00% 41 15 0.00% 42 8 0.00% 43 27 0.00% 44 17 0.00% 45 19 0.00% 46 14 0.00% 47 20 0.00% 48 21 0.00% 49 25 0.00% 50 31 0.00% 51 30 0.00% 52 26 0.00% 53 27 0.00% 54 47 0.00% 55 22 0.00% 56 39 0.00% 57 38 0.00% 58 62 0.00% 59 57 0.00% 60 66 0.00% 61 92 0.00% 62 76 0.00% 63 76 0.00% 64 123 0.00% 65 112 0.00% 66 121 0.00% 67 149 0.00% 68 170 0.00% 69 188 0.00% 70 227 0.00% 71 244 0.00% 72 279 0.00% 73 292 0.00% 74 333 0.00% 75 391 0.00% 76 414 0.00% 77 452 0.00% 78 520 0.00% 79 639 0.00% 80 702 0.00% 81 821 0.01% 82 921 0.01% 83 1006 0.01% 84 1114 0.01% 85 1307 0.01% 86 1413 0.01% 87 1464 0.01% 88 1641 0.01% 89 1773 0.01% 90 2077 0.01% 91 2392 0.02% 92 2597 0.02% 93 2876 0.02% 94 3219 0.02% 95 3425 0.02% 96 3731 0.02% 97 3982 0.03% 98 4329 0.03% 99 4767 0.03% 100 5021 0.03% 101 5426 0.04% 102 5884 0.04% 103 6497 0.04% 104 6963 0.05% 105 7369 0.05% 106 7666 0.05% 107 7958 0.05% 108 8559 0.06% 109 8905 0.06% 110 9354 0.06% 111 9957 0.06% 112 10783 0.07% 113 11418 0.07% 114 12005 0.08% 115 12635 0.08% 116 13402 0.09% 117 13663 0.09% 118 13854 0.09% 119 14583 0.10% 120 15070 0.10% 121 15846 0.10% 122 16550 0.11% 123 17592 0.11% 124 18401 0.12% 125 18907 0.12% 126 20325 0.13% 127 20399 0.13% 128 20900 0.14% 129 21719 0.14% 130 22038 0.14% 131 23179 0.15% 132 23661 0.15% 133 25070 0.16% 134 25796 0.17% 135 26803 0.17% 136 27399 0.18% 137 27914 0.18% 138 28523 0.19% 139 29276 0.19% 140 29811 0.19% 141 30455 0.20% 142 32043 0.21% 143 32854 0.21% 144 34138 0.22% 145 34924 0.23% 146 35804 0.23% 147 36635 0.24% 148 37158 0.24% 149 37447 0.24% 150 38306 0.25% 151 14261406 93.03% 15329560 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.82 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=8.57 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.2 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=23 prefix-density=1.05 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=128.83 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12161378 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:07:33 Started mapping on | Feb 13 19:07:34 Finished on | Feb 13 19:09:34 Mapping speed, Million of reads per hour | 459.89 Number of input reads | 15329560 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14345759 Uniquely mapped reads % | 93.58% Average mapped length | 297.86 Number of splices: Total | 15081517 Number of splices: Annotated (sjdb) | 14792269 Number of splices: GT/AG | 14771643 Number of splices: GC/AG | 261513 Number of splices: AT/AC | 10145 Number of splices: Non-canonical | 38216 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322264 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 82759 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 661537 661537 661537 N_multimapping 322264 322264 322264 N_noFeature 439347 14157535 493569 N_ambiguous 221128 829 86645 UnstrandedReadsAssigned:13685284 PositiveStrandReadsAssigned:187395 NegativeStrandReadsAssigned:13765545 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161378 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161378-trimmed-pair1.fastq SRR12161378-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,329,560 reads, 13,864,708 reads pseudoaligned [quant] estimated average fragment length: 271.194 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR12161378.ke.tsv 34699 SRR12161378.se.tsv 87100 total ==> SRR12161378.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.81 454 16.1984 Potri.005G024800.1.v4.1 1035 764.806 429 34.9796 Potri.004G059700.1.v4.1 961 691.029 43 3.88044 Potri.007G009000.2.v4.1 1416 1145.81 0 0 Potri.003G141000.2.v4.1 2943 2672.81 647 15.0954 Potri.016G087400.1.v4.1 270 76.892 523 424.159 Potri.015G069301.1.v4.1 564 310.1 0 0 Potri.010G195200.1.v4.1 1773 1502.81 9 0.373463 Potri.012G127500.1.v4.1 977 706.916 143 12.6147 ==> SRR12161378.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 299 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12161378 completed mapping pipeline successfully