Starting /dee2/code/volunteer_pipeline.sh SRR12161379 current disk space = 3087474323456 free memory = 1582521576 SRR12161379 SRAfilesize a138a604e8b34263716850fce3a91c5f SRR12161379.sra SRR12161379.sra file validated SRR12161379 is paired end SRR12161379 is conventional basespace SRR12161379 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.52975 37.0 37.0 37.0 37.0 37.0 2 36.4365 37.0 37.0 37.0 37.0 37.0 3 36.5485 37.0 37.0 37.0 37.0 37.0 4 36.5375 37.0 37.0 37.0 37.0 37.0 5 36.636 37.0 37.0 37.0 37.0 37.0 6 36.5155 37.0 37.0 37.0 37.0 37.0 7 36.593 37.0 37.0 37.0 37.0 37.0 8 36.531 37.0 37.0 37.0 37.0 37.0 9 36.551 37.0 37.0 37.0 37.0 37.0 10-14 36.5856 37.0 37.0 37.0 37.0 37.0 15-19 36.5871 37.0 37.0 37.0 37.0 37.0 20-24 36.5363 37.0 37.0 37.0 37.0 37.0 25-29 36.5132 37.0 37.0 37.0 37.0 37.0 30-34 36.4854 37.0 37.0 37.0 37.0 37.0 35-39 36.4129 37.0 37.0 37.0 37.0 37.0 40-44 36.436099999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.42810000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.3972 37.0 37.0 37.0 37.0 37.0 55-59 36.398399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.38439999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3546 37.0 37.0 37.0 37.0 37.0 70-74 36.3805 37.0 37.0 37.0 37.0 37.0 75-79 36.3284 37.0 37.0 37.0 37.0 37.0 80-84 36.3149 37.0 37.0 37.0 37.0 37.0 85-89 36.2729 37.0 37.0 37.0 37.0 37.0 90-94 36.287800000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2041 37.0 37.0 37.0 37.0 37.0 100-104 36.225300000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.2014 37.0 37.0 37.0 37.0 37.0 110-114 36.179500000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1682 37.0 37.0 37.0 37.0 37.0 120-124 36.160999999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0747 37.0 37.0 37.0 37.0 37.0 130-134 36.1092 37.0 37.0 37.0 37.0 37.0 135-139 36.0313 37.0 37.0 37.0 37.0 37.0 140-144 35.949600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.8999 37.0 37.0 37.0 37.0 37.0 150-151 35.784499999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 1.0 26 2.0 27 9.0 28 7.0 29 15.0 30 24.0 31 33.0 32 52.0 33 72.0 34 115.0 35 277.0 36 2960.0 37 430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.483870967741936 10.827706926731683 6.0765191297824455 47.61190297574394 2 18.099999999999998 13.375 38.2 30.325000000000003 3 16.175 14.625 29.15 40.050000000000004 4 21.625 23.549999999999997 23.474999999999998 31.35 5 22.775000000000002 30.65 24.575 22.0 6 19.400000000000002 35.199999999999996 23.95 21.45 7 15.075 27.175 40.675 17.075000000000003 8 17.125 25.825 33.375 23.674999999999997 9 17.9 22.7 35.575 23.825 10-14 19.595000000000002 29.299999999999997 27.575 23.53 15-19 19.955000000000002 29.015 27.065 23.965 20-24 20.05 27.97 28.53 23.45 25-29 19.395 28.215 28.055000000000003 24.335 30-34 19.52 28.294999999999998 27.915 24.27 35-39 20.200000000000003 28.044999999999998 27.88 23.875 40-44 19.515 28.884999999999998 27.145000000000003 24.455 45-49 20.26 28.29 27.71 23.74 50-54 20.064999999999998 28.660000000000004 26.915 24.36 55-59 20.19 28.105000000000004 27.284999999999997 24.42 60-64 19.18 28.59 27.58 24.65 65-69 20.244999999999997 27.834999999999997 28.09 23.830000000000002 70-74 20.615 28.24 27.625 23.52 75-79 20.13 28.144999999999996 28.38 23.345 80-84 20.415 27.725 28.28 23.580000000000002 85-89 19.825 28.720000000000002 27.650000000000002 23.805 90-94 20.36 28.499999999999996 27.435 23.705000000000002 95-99 20.75 27.61 28.139999999999997 23.5 100-104 20.085 28.205000000000002 27.865000000000002 23.845 105-109 20.005 28.125 27.51 24.36 110-114 20.474999999999998 27.52 27.96 24.044999999999998 115-119 20.395 28.685 27.655 23.265 120-124 20.635 27.62 27.744999999999997 24.0 125-129 20.44 27.785 28.005000000000003 23.77 130-134 20.549999999999997 28.244999999999997 27.595 23.61 135-139 20.76 28.035 27.255000000000003 23.95 140-144 21.23 27.875 27.650000000000002 23.244999999999997 145-149 20.349999999999998 28.59 27.595 23.465 150-151 21.337500000000002 27.800000000000004 27.237499999999997 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 2.0 26 1.5 27 7.5 28 10.5 29 13.5 30 16.0 31 22.0 32 37.0 33 39.0 34 37.0 35 58.5 36 94.5 37 120.0 38 140.0 39 163.5 40 187.0 41 204.5 42 223.5 43 241.0 44 257.0 45 260.0 46 251.5 47 247.5 48 233.0 49 224.0 50 199.0 51 151.5 52 125.5 53 108.5 54 79.0 55 57.0 56 55.5 57 42.5 58 23.0 59 19.5 60 17.0 61 9.5 62 4.5 63 3.0 64 2.5 65 2.0 66 0.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 93.8449240607514 88.05 2 5.808686384225953 10.9 3 0.2664535038635758 0.75 4 0.07993605115907274 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.9625 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.125 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.525 0.0 0.0 0.0 0.0 134-135 1.65 0.0 0.0 0.0 0.0 136-137 1.775 0.0 0.0 0.0 0.0 138-139 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATAAT 10 0.006830828 145.0 1 TCTTCAC 10 0.006830828 145.0 8 >>END_MODULE SRR12161379 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161379_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.358 37.0 37.0 37.0 37.0 37.0 2 36.0985 37.0 37.0 37.0 37.0 37.0 3 36.086 37.0 37.0 37.0 37.0 37.0 4 36.1535 37.0 37.0 37.0 37.0 37.0 5 36.1705 37.0 37.0 37.0 37.0 37.0 6 36.111 37.0 37.0 37.0 37.0 37.0 7 36.1225 37.0 37.0 37.0 37.0 37.0 8 36.2505 37.0 37.0 37.0 37.0 37.0 9 36.2435 37.0 37.0 37.0 37.0 37.0 10-14 36.266000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.286 37.0 37.0 37.0 37.0 37.0 20-24 36.2252 37.0 37.0 37.0 37.0 37.0 25-29 36.2156 37.0 37.0 37.0 37.0 37.0 30-34 36.1687 37.0 37.0 37.0 37.0 37.0 35-39 36.1198 37.0 37.0 37.0 37.0 37.0 40-44 36.142399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.0319 37.0 37.0 37.0 37.0 37.0 50-54 36.07430000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.0094 37.0 37.0 37.0 37.0 37.0 60-64 35.997699999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.9682 37.0 37.0 37.0 37.0 37.0 70-74 35.9071 37.0 37.0 37.0 37.0 37.0 75-79 35.774300000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9122 37.0 37.0 37.0 37.0 37.0 85-89 35.836 37.0 37.0 37.0 37.0 37.0 90-94 35.839600000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.872299999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.837300000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.8365 37.0 37.0 37.0 37.0 37.0 110-114 35.7029 37.0 37.0 37.0 37.0 37.0 115-119 35.736599999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.6876 37.0 37.0 37.0 37.0 37.0 125-129 35.626400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.5868 37.0 37.0 37.0 37.0 37.0 135-139 35.5604 37.0 37.0 37.0 37.0 37.0 140-144 35.4895 37.0 37.0 37.0 37.0 37.0 145-149 35.5218 37.0 37.0 37.0 37.0 37.0 150-151 34.966750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 0.0 16 3.0 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 5.0 23 2.0 24 6.0 25 8.0 26 7.0 27 13.0 28 16.0 29 18.0 30 21.0 31 49.0 32 76.0 33 109.0 34 179.0 35 529.0 36 2722.0 37 229.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.525 23.3 10.274999999999999 30.9 2 24.4 27.474999999999998 33.324999999999996 14.799999999999999 3 18.325 29.049999999999997 31.025000000000002 21.6 4 20.424999999999997 35.199999999999996 25.674999999999997 18.7 5 24.525 36.75 21.65 17.075000000000003 6 19.725 39.25 23.150000000000002 17.875 7 20.65 21.975 37.675 19.7 8 20.674999999999997 26.674999999999997 28.225 24.425 9 21.325 25.650000000000002 29.849999999999998 23.175 10-14 22.765 29.360000000000003 26.790000000000003 21.085 15-19 22.21 28.64 27.800000000000004 21.349999999999998 20-24 22.34 28.275 27.72 21.665 25-29 22.34 28.000000000000004 27.87 21.790000000000003 30-34 21.905 28.785 27.939999999999998 21.37 35-39 22.57 28.275 27.515 21.64 40-44 22.365 28.13 28.050000000000004 21.455 45-49 22.535 28.294999999999998 27.735 21.435000000000002 50-54 22.925 28.46 27.0 21.615000000000002 55-59 22.625 28.194999999999997 27.43 21.75 60-64 22.505 27.87 28.155 21.47 65-69 22.7 27.62 28.105000000000004 21.575 70-74 22.955000000000002 28.275 27.584999999999997 21.185000000000002 75-79 22.055 27.83 28.115000000000002 22.0 80-84 22.34 28.52 27.860000000000003 21.279999999999998 85-89 23.13 28.345 27.315 21.21 90-94 22.745 28.21 28.065 20.979999999999997 95-99 23.395 27.22 27.93 21.455 100-104 23.055 27.765 27.57 21.61 105-109 22.939999999999998 28.084999999999997 27.644999999999996 21.33 110-114 23.47 27.450000000000003 28.299999999999997 20.78 115-119 23.465 28.165000000000003 27.265 21.105 120-124 22.994999999999997 28.32 27.43 21.255 125-129 23.72 28.07 27.134999999999998 21.075 130-134 23.31 27.98 27.47 21.240000000000002 135-139 23.375 27.689999999999998 28.165000000000003 20.77 140-144 23.87 28.215 27.57 20.345 145-149 24.39 27.505000000000003 27.48 20.625 150-151 23.7625 28.7375 26.450000000000003 21.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 1.5 24 2.0 25 5.5 26 7.0 27 5.0 28 6.0 29 12.0 30 16.0 31 16.5 32 27.0 33 46.0 34 59.5 35 66.0 36 88.5 37 127.0 38 145.5 39 162.0 40 188.5 41 219.0 42 254.0 43 264.5 44 274.0 45 281.0 46 253.0 47 236.0 48 214.5 49 191.5 50 173.5 51 140.0 52 119.5 53 93.5 54 69.5 55 57.0 56 47.0 57 37.0 58 22.5 59 20.0 60 15.5 61 5.5 62 7.5 63 5.0 64 1.0 65 1.0 66 0.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.33962264150944 88.75 2 5.102311985118257 9.6 3 0.4783417486048365 1.35 4 0.07972362476747276 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.7875 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 0.9874999999999999 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.55 0.0 0.0 0.0 0.0 134-135 1.6749999999999998 0.0 0.0 0.0 0.0 136-137 1.8 0.0 0.0 0.0 0.0 138-139 2.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139094 spots for SRR12161379.sra Written 139094 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra Read 139088 spots for SRR12161379.sra Written 139088 spots for SRR12161379.sra SRR ids: ['SRR12161379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wuse6k64 SRR12161379.sra spots: 2781766 blocks: [[1, 139088], [139089, 278176], [278177, 417264], [417265, 556352], [556353, 695440], [695441, 834528], [834529, 973616], [973617, 1112704], [1112705, 1251792], [1251793, 1390880], [1390881, 1529968], [1529969, 1669056], [1669057, 1808144], [1808145, 1947232], [1947233, 2086320], [2086321, 2225408], [2225409, 2364496], [2364497, 2503584], [2503585, 2642672], [2642673, 2781766]] SRR12161379 file size 937763 SRR12161379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161379 SRR12161379_1.fastq SRR12161379_2.fastq Input file: SRR12161379_1.fastq Paired file: SRR12161379_2.fastq trimmed: SRR12161379-trimmed-pair1.fastq, SRR12161379-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:49:26 2025 >> started Thu Feb 13 19:49:28 2025 >> done (2.885s) 2781766 read pairs processed; of these: 5 ( 0.00%) short read pairs filtered out after trimming by size control 114 ( 0.00%) empty read pairs filtered out after trimming by size control 2781647 (100.00%) read pairs available; of these: 120890 ( 4.35%) trimmed read pairs available after processing 2660757 (95.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 1 0.00% 32 6 0.00% 33 0 0.00% 34 0 0.00% 35 6 0.00% 36 2 0.00% 37 2 0.00% 38 1 0.00% 39 3 0.00% 40 2 0.00% 41 2 0.00% 42 2 0.00% 43 2 0.00% 44 3 0.00% 45 0 0.00% 46 2 0.00% 47 4 0.00% 48 0 0.00% 49 5 0.00% 50 6 0.00% 51 5 0.00% 52 8 0.00% 53 3 0.00% 54 1 0.00% 55 7 0.00% 56 5 0.00% 57 3 0.00% 58 6 0.00% 59 7 0.00% 60 8 0.00% 61 6 0.00% 62 11 0.00% 63 6 0.00% 64 2 0.00% 65 10 0.00% 66 11 0.00% 67 12 0.00% 68 21 0.00% 69 25 0.00% 70 24 0.00% 71 13 0.00% 72 23 0.00% 73 44 0.00% 74 49 0.00% 75 32 0.00% 76 38 0.00% 77 34 0.00% 78 49 0.00% 79 55 0.00% 80 58 0.00% 81 74 0.00% 82 77 0.00% 83 112 0.00% 84 104 0.00% 85 116 0.00% 86 132 0.00% 87 155 0.01% 88 155 0.01% 89 181 0.01% 90 178 0.01% 91 228 0.01% 92 236 0.01% 93 250 0.01% 94 292 0.01% 95 282 0.01% 96 304 0.01% 97 374 0.01% 98 355 0.01% 99 405 0.01% 100 524 0.02% 101 553 0.02% 102 574 0.02% 103 611 0.02% 104 706 0.03% 105 663 0.02% 106 797 0.03% 107 815 0.03% 108 780 0.03% 109 925 0.03% 110 969 0.03% 111 1015 0.04% 112 1046 0.04% 113 1133 0.04% 114 1187 0.04% 115 1319 0.05% 116 1297 0.05% 117 1396 0.05% 118 1477 0.05% 119 1551 0.06% 120 1774 0.06% 121 1717 0.06% 122 1760 0.06% 123 1812 0.07% 124 1974 0.07% 125 2031 0.07% 126 2193 0.08% 127 2253 0.08% 128 2351 0.08% 129 2492 0.09% 130 2554 0.09% 131 2688 0.10% 132 2669 0.10% 133 2779 0.10% 134 2939 0.11% 135 2989 0.11% 136 3117 0.11% 137 3264 0.12% 138 3382 0.12% 139 3571 0.13% 140 3567 0.13% 141 3702 0.13% 142 3973 0.14% 143 3936 0.14% 144 4274 0.15% 145 4234 0.15% 146 4332 0.16% 147 4399 0.16% 148 4611 0.17% 149 4688 0.17% 150 4886 0.18% 151 2660757 95.65% 2781647 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=9.51 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.8 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=26 prefix-density=0.63 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=24 fanout-score=28.12 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=11.7 sequence=AAAGAAAAGAAAA SRR12161379 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:50:12 Started mapping on | Feb 13 19:50:12 Finished on | Feb 13 19:50:35 Mapping speed, Million of reads per hour | 435.39 Number of input reads | 2781647 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 2633666 Uniquely mapped reads % | 94.68% Average mapped length | 299.20 Number of splices: Total | 2698377 Number of splices: Annotated (sjdb) | 2639774 Number of splices: GT/AG | 2647522 Number of splices: GC/AG | 41521 Number of splices: AT/AC | 1912 Number of splices: Non-canonical | 7422 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 59869 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 13684 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 88112 88112 88112 N_multimapping 59869 59869 59869 N_noFeature 100707 2600361 110953 N_ambiguous 38619 221 15432 UnstrandedReadsAssigned:2494340 PositiveStrandReadsAssigned:33084 NegativeStrandReadsAssigned:2507281 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161379 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161379-trimmed-pair1.fastq SRR12161379-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,781,647 reads, 2,503,561 reads pseudoaligned [quant] estimated average fragment length: 282.436 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 908 rounds 52401 SRR12161379.ke.tsv 34699 SRR12161379.se.tsv 87100 total ==> SRR12161379.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.56 88 17.3507 Potri.005G024800.1.v4.1 1035 753.564 30 13.631 Potri.004G059700.1.v4.1 961 679.843 14 7.05092 Potri.007G009000.2.v4.1 1416 1134.56 0 0 Potri.003G141000.2.v4.1 2943 2661.56 105 13.5076 Potri.016G087400.1.v4.1 270 67.9992 150 755.29 Potri.015G069301.1.v4.1 564 297.835 0 0 Potri.010G195200.1.v4.1 1773 1491.56 7 1.60688 Potri.012G127500.1.v4.1 977 695.71 27 13.2881 ==> SRR12161379.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 32 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12161379 completed mapping pipeline successfully