Starting /dee2/code/volunteer_pipeline.sh SRR12161380 current disk space = 3087399624704 free memory = 1474658624 SRR12161380 SRAfilesize e7ac940755aaa1f0ebc3f4fb9218f8c4 SRR12161380.sra SRR12161380.sra file validated SRR12161380 is paired end SRR12161380 is conventional basespace SRR12161380 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161380_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45175 37.0 37.0 37.0 37.0 37.0 2 36.284 37.0 37.0 37.0 37.0 37.0 3 36.4505 37.0 37.0 37.0 37.0 37.0 4 36.505 37.0 37.0 37.0 37.0 37.0 5 36.607 37.0 37.0 37.0 37.0 37.0 6 36.544 37.0 37.0 37.0 37.0 37.0 7 36.536 37.0 37.0 37.0 37.0 37.0 8 36.5315 37.0 37.0 37.0 37.0 37.0 9 36.5745 37.0 37.0 37.0 37.0 37.0 10-14 36.5381 37.0 37.0 37.0 37.0 37.0 15-19 36.5322 37.0 37.0 37.0 37.0 37.0 20-24 36.524 37.0 37.0 37.0 37.0 37.0 25-29 36.4089 37.0 37.0 37.0 37.0 37.0 30-34 36.40050000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4046 37.0 37.0 37.0 37.0 37.0 40-44 36.3352 37.0 37.0 37.0 37.0 37.0 45-49 36.3485 37.0 37.0 37.0 37.0 37.0 50-54 36.251 37.0 37.0 37.0 37.0 37.0 55-59 36.3317 37.0 37.0 37.0 37.0 37.0 60-64 36.2875 37.0 37.0 37.0 37.0 37.0 65-69 36.257400000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.2519 37.0 37.0 37.0 37.0 37.0 75-79 36.2222 37.0 37.0 37.0 37.0 37.0 80-84 36.2887 37.0 37.0 37.0 37.0 37.0 85-89 36.1972 37.0 37.0 37.0 37.0 37.0 90-94 36.221700000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.1864 37.0 37.0 37.0 37.0 37.0 100-104 36.162 37.0 37.0 37.0 37.0 37.0 105-109 36.0542 37.0 37.0 37.0 37.0 37.0 110-114 36.0661 37.0 37.0 37.0 37.0 37.0 115-119 36.0391 37.0 37.0 37.0 37.0 37.0 120-124 36.0196 37.0 37.0 37.0 37.0 37.0 125-129 36.031400000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.9968 37.0 37.0 37.0 37.0 37.0 135-139 35.937 37.0 37.0 37.0 37.0 37.0 140-144 35.885799999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.88250000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.7375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 0.0 23 1.0 24 1.0 25 3.0 26 1.0 27 6.0 28 15.0 29 24.0 30 39.0 31 29.0 32 43.0 33 85.0 34 119.0 35 308.0 36 2947.0 37 377.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.685671417854465 12.578144536134033 5.051262815703926 39.68492123030758 2 19.725 12.174999999999999 36.35 31.75 3 16.150000000000002 15.9 27.575 40.375 4 20.9 26.174999999999997 23.599999999999998 29.325000000000003 5 23.35 31.874999999999996 23.875 20.9 6 20.225 34.2 23.474999999999998 22.1 7 14.524999999999999 26.424999999999997 41.8 17.25 8 17.1 26.150000000000002 32.375 24.375 9 17.275 22.650000000000002 35.675000000000004 24.4 10-14 19.195 29.915000000000003 28.389999999999997 22.5 15-19 19.205 28.175 28.365000000000002 24.255 20-24 19.055 29.28 28.125 23.54 25-29 19.955000000000002 28.79 27.975 23.28 30-34 19.575 28.139999999999997 27.905 24.38 35-39 20.119999999999997 28.754999999999995 26.97 24.154999999999998 40-44 19.830000000000002 28.98 27.405 23.785 45-49 19.545 28.13 27.985 24.34 50-54 19.96 28.255000000000003 27.79 23.995 55-59 19.3 28.845 27.72 24.135 60-64 19.900000000000002 28.275 28.1 23.724999999999998 65-69 19.49 28.810000000000002 28.03 23.669999999999998 70-74 19.900000000000002 28.935 27.74 23.425 75-79 19.97 28.415000000000003 27.595 24.02 80-84 20.115 28.044999999999998 27.87 23.97 85-89 19.650000000000002 28.549999999999997 28.095 23.705000000000002 90-94 20.01 28.744999999999997 27.439999999999998 23.805 95-99 20.14 28.305000000000003 27.96 23.595 100-104 19.96 28.189999999999998 28.084999999999997 23.765 105-109 20.565 28.189999999999998 27.529999999999998 23.715 110-114 19.84 27.965 28.615000000000002 23.580000000000002 115-119 20.205000000000002 28.375 27.6 23.82 120-124 20.419999999999998 28.03 27.744999999999997 23.805 125-129 20.685000000000002 28.67 27.265 23.380000000000003 130-134 20.65 27.905 27.525 23.919999999999998 135-139 20.474999999999998 27.98 27.589999999999996 23.955000000000002 140-144 20.86 27.985 27.575 23.580000000000002 145-149 20.16 27.98 28.33 23.53 150-151 21.475 27.625 27.6125 23.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.5 21 1.5 22 2.0 23 2.0 24 1.5 25 3.0 26 5.0 27 7.0 28 11.0 29 15.5 30 22.0 31 35.5 32 43.0 33 50.5 34 59.0 35 68.5 36 87.5 37 114.0 38 131.0 39 153.0 40 180.0 41 195.5 42 232.0 43 269.5 44 266.5 45 259.0 46 256.0 47 247.0 48 233.0 49 206.5 50 182.5 51 146.0 52 117.0 53 100.0 54 80.5 55 53.0 56 35.0 57 38.0 58 27.0 59 16.5 60 16.0 61 10.5 62 5.0 63 3.0 64 1.5 65 2.5 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.54624050301284 91.175 2 4.165575058946817 7.95 3 0.2619858527639507 0.75 4 0.0 0.0 5 0.026198585276395077 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCTTTTTTCCTATTTACAATTTCAACACTGTTTTTGATTCTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.9249999999999999 0.0 0.0 0.0 0.0 126-127 1.125 0.0 0.0 0.0 0.0 128-129 1.2374999999999998 0.0 0.0 0.0 0.0 130-131 1.3875 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.8375 0.0 0.0 0.0 0.0 138-139 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCGGCT 10 0.006830828 145.0 1 GGTAGTC 10 0.006830828 145.0 1 GTAGTCT 10 0.006830828 145.0 2 CCGGCTT 10 0.006830828 145.0 2 >>END_MODULE SRR12161380 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161380_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1395 37.0 37.0 37.0 37.0 37.0 2 35.706 37.0 37.0 37.0 37.0 37.0 3 35.865 37.0 37.0 37.0 37.0 37.0 4 35.966 37.0 37.0 37.0 37.0 37.0 5 36.1665 37.0 37.0 37.0 37.0 37.0 6 35.9775 37.0 37.0 37.0 37.0 37.0 7 36.0105 37.0 37.0 37.0 37.0 37.0 8 36.186 37.0 37.0 37.0 37.0 37.0 9 36.1715 37.0 37.0 37.0 37.0 37.0 10-14 36.111000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.096199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0601 37.0 37.0 37.0 37.0 37.0 25-29 36.0745 37.0 37.0 37.0 37.0 37.0 30-34 36.0058 37.0 37.0 37.0 37.0 37.0 35-39 35.94109999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.9576 37.0 37.0 37.0 37.0 37.0 45-49 35.9133 37.0 37.0 37.0 37.0 37.0 50-54 35.9268 37.0 37.0 37.0 37.0 37.0 55-59 35.8448 37.0 37.0 37.0 37.0 37.0 60-64 35.8409 37.0 37.0 37.0 37.0 37.0 65-69 35.898199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.7532 37.0 37.0 37.0 37.0 37.0 75-79 35.74340000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.782 37.0 37.0 37.0 37.0 37.0 85-89 35.749 37.0 37.0 37.0 37.0 37.0 90-94 35.6323 37.0 37.0 37.0 37.0 37.0 95-99 35.6806 37.0 37.0 37.0 37.0 37.0 100-104 35.6411 37.0 37.0 37.0 37.0 37.0 105-109 35.662800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.562 37.0 37.0 37.0 37.0 37.0 115-119 35.602 37.0 37.0 37.0 37.0 37.0 120-124 35.5875 37.0 37.0 37.0 37.0 37.0 125-129 35.4073 37.0 37.0 37.0 37.0 37.0 130-134 35.367399999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.4791 37.0 37.0 37.0 37.0 37.0 140-144 35.389300000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.3609 37.0 37.0 37.0 34.6 37.0 150-151 34.784499999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 3.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 4.0 23 2.0 24 4.0 25 9.0 26 16.0 27 16.0 28 16.0 29 21.0 30 34.0 31 57.0 32 74.0 33 122.0 34 264.0 35 585.0 36 2535.0 37 227.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.9 25.900000000000002 8.05 25.15 2 26.525 26.325 31.6 15.55 3 20.1 26.1 33.800000000000004 20.0 4 22.95 35.15 23.474999999999998 18.425 5 25.3 37.3 21.65 15.75 6 20.674999999999997 40.0 21.725 17.599999999999998 7 18.875 22.85 37.75 20.525 8 18.55 28.1 28.9 24.45 9 21.025 25.0 30.95 23.025000000000002 10-14 22.665 30.225 26.445 20.665 15-19 22.675 28.82 27.16 21.345 20-24 22.325 29.165000000000003 27.6 20.91 25-29 22.39 28.810000000000002 27.794999999999998 21.005 30-34 22.830000000000002 28.360000000000003 27.93 20.880000000000003 35-39 22.665 28.355000000000004 27.584999999999997 21.395 40-44 23.075000000000003 28.095 27.99 20.84 45-49 22.994999999999997 27.994999999999997 27.83 21.18 50-54 23.630000000000003 28.265 27.705000000000002 20.4 55-59 22.62 27.915 28.28 21.185000000000002 60-64 23.41 27.625 28.15 20.815 65-69 22.605 28.18 28.199999999999996 21.015 70-74 22.99 27.905 28.095 21.01 75-79 23.01 28.044999999999998 27.235 21.709999999999997 80-84 23.425 27.415 27.560000000000002 21.6 85-89 23.275000000000002 27.200000000000003 27.705000000000002 21.82 90-94 22.88 28.025 27.705000000000002 21.39 95-99 23.555 27.72 28.18 20.544999999999998 100-104 23.51 28.015 27.474999999999998 21.0 105-109 23.369999999999997 27.93 28.035 20.665 110-114 23.49 27.96 27.685 20.865000000000002 115-119 23.95 27.644999999999996 27.725 20.68 120-124 23.169999999999998 28.09 27.785 20.955 125-129 23.53 28.58 27.029999999999998 20.86 130-134 23.86 27.755000000000003 27.76 20.625 135-139 22.905 28.915000000000003 27.415 20.765 140-144 22.845 28.225 28.395 20.535 145-149 24.04 27.415 27.865000000000002 20.68 150-151 23.599999999999998 28.487499999999997 28.249999999999996 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.5 23 2.5 24 3.5 25 3.0 26 7.0 27 12.0 28 14.5 29 15.0 30 15.5 31 18.0 32 23.0 33 38.0 34 57.5 35 73.5 36 82.0 37 88.0 38 135.0 39 190.0 40 208.5 41 232.5 42 258.0 43 259.0 44 267.0 45 270.5 46 268.5 47 249.5 48 220.0 49 192.0 50 153.0 51 119.5 52 100.5 53 91.0 54 80.0 55 64.0 56 42.5 57 30.5 58 23.5 59 18.5 60 13.5 61 13.0 62 13.5 63 9.0 64 3.5 65 2.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.25941532789044 90.425 2 4.3455359494337635 8.25 3 0.26336581511719775 0.75 4 0.05267316302343956 0.2 5 0.07900974453515934 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGAGAAATACAACTCAAATAACCCACATGATCCAGGCTGCCACTGCC 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.4874999999999998 0.0 0.0 0.0 0.0 134-135 1.6375 0.0 0.0 0.0 0.0 136-137 1.8125 0.0 0.0 0.0 0.0 138-139 1.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGAGA 10 0.006830828 145.0 6 >>END_MODULE Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra Read 1333183 spots for SRR12161380.sra Written 1333183 spots for SRR12161380.sra Read 1333181 spots for SRR12161380.sra Written 1333181 spots for SRR12161380.sra SRR ids: ['SRR12161380.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vz5w98fq SRR12161380.sra spots: 26663622 blocks: [[1, 1333181], [1333182, 2666362], [2666363, 3999543], [3999544, 5332724], [5332725, 6665905], [6665906, 7999086], [7999087, 9332267], [9332268, 10665448], [10665449, 11998629], [11998630, 13331810], [13331811, 14664991], [14664992, 15998172], [15998173, 17331353], [17331354, 18664534], [18664535, 19997715], [19997716, 21330896], [21330897, 22664077], [22664078, 23997258], [23997259, 25330439], [25330440, 26663622]] SRR12161380 file size 9039764 SRR12161380 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161380 SRR12161380_1.fastq SRR12161380_2.fastq Input file: SRR12161380_1.fastq Paired file: SRR12161380_2.fastq trimmed: SRR12161380-trimmed-pair1.fastq, SRR12161380-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:42:09 2025 >> started Thu Feb 13 19:42:42 2025 >> done (32.741s) 26663622 read pairs processed; of these: 48 ( 0.00%) short read pairs filtered out after trimming by size control 1122 ( 0.00%) empty read pairs filtered out after trimming by size control 26662452 (100.00%) read pairs available; of these: 859976 ( 3.23%) trimmed read pairs available after processing 25802476 (96.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 5 0.00% 21 3 0.00% 22 11 0.00% 23 10 0.00% 24 13 0.00% 25 11 0.00% 26 16 0.00% 27 17 0.00% 28 14 0.00% 29 15 0.00% 30 16 0.00% 31 20 0.00% 32 19 0.00% 33 23 0.00% 34 15 0.00% 35 19 0.00% 36 25 0.00% 37 20 0.00% 38 27 0.00% 39 15 0.00% 40 9 0.00% 41 15 0.00% 42 27 0.00% 43 31 0.00% 44 27 0.00% 45 33 0.00% 46 23 0.00% 47 29 0.00% 48 28 0.00% 49 36 0.00% 50 45 0.00% 51 38 0.00% 52 36 0.00% 53 47 0.00% 54 50 0.00% 55 38 0.00% 56 55 0.00% 57 67 0.00% 58 69 0.00% 59 78 0.00% 60 81 0.00% 61 87 0.00% 62 86 0.00% 63 85 0.00% 64 117 0.00% 65 107 0.00% 66 120 0.00% 67 154 0.00% 68 142 0.00% 69 150 0.00% 70 175 0.00% 71 230 0.00% 72 215 0.00% 73 268 0.00% 74 299 0.00% 75 294 0.00% 76 375 0.00% 77 338 0.00% 78 394 0.00% 79 466 0.00% 80 524 0.00% 81 584 0.00% 82 677 0.00% 83 731 0.00% 84 819 0.00% 85 905 0.00% 86 951 0.00% 87 1135 0.00% 88 1225 0.00% 89 1314 0.00% 90 1556 0.01% 91 1651 0.01% 92 1797 0.01% 93 1988 0.01% 94 2228 0.01% 95 2436 0.01% 96 2606 0.01% 97 2868 0.01% 98 3038 0.01% 99 3208 0.01% 100 3545 0.01% 101 3727 0.01% 102 4200 0.02% 103 4436 0.02% 104 4829 0.02% 105 5088 0.02% 106 5531 0.02% 107 5840 0.02% 108 6043 0.02% 109 6316 0.02% 110 6668 0.03% 111 7122 0.03% 112 7818 0.03% 113 8022 0.03% 114 8601 0.03% 115 9026 0.03% 116 9577 0.04% 117 9824 0.04% 118 10476 0.04% 119 10775 0.04% 120 11581 0.04% 121 11980 0.04% 122 12662 0.05% 123 13183 0.05% 124 13842 0.05% 125 14394 0.05% 126 15224 0.06% 127 15554 0.06% 128 16308 0.06% 129 16781 0.06% 130 17623 0.07% 131 18106 0.07% 132 18759 0.07% 133 19546 0.07% 134 20665 0.08% 135 21377 0.08% 136 22160 0.08% 137 22946 0.09% 138 23709 0.09% 139 24820 0.09% 140 24870 0.09% 141 25747 0.10% 142 27277 0.10% 143 28114 0.11% 144 29598 0.11% 145 30813 0.12% 146 31459 0.12% 147 32552 0.12% 148 33395 0.13% 149 34295 0.13% 150 35647 0.13% 151 25802476 96.77% 26662452 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=7.38 fanout-score-rank=15 prefix-density=0.42 prefix-fanout=3.8 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=15.72 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=4.3 sequence=CACAAGCCTCATCTAGGAATACCGTCTTGGCACTGTTGTACTCTAAATATTCTCTATCAATCTGCTCTGAAGTGTTGGGAGTGGTACTTCTGGCATCTGGTTTGAGCTTCACTTCAGGATACATCTCAACATCACAAGCTTCTCCTCCTAT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=37 prefix-density=0.50 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=640.20 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=21.7 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGT SRR12161380 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:43:29 Started mapping on | Feb 13 19:43:29 Finished on | Feb 13 19:46:41 Mapping speed, Million of reads per hour | 499.92 Number of input reads | 26662452 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25013674 Uniquely mapped reads % | 93.82% Average mapped length | 299.39 Number of splices: Total | 25232434 Number of splices: Annotated (sjdb) | 24614505 Number of splices: GT/AG | 24754083 Number of splices: GC/AG | 382223 Number of splices: AT/AC | 20010 Number of splices: Non-canonical | 76118 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 565026 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 100072 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1083752 1083752 1083752 N_multimapping 565026 565026 565026 N_noFeature 996856 24686969 1102742 N_ambiguous 386671 1807 164857 UnstrandedReadsAssigned:23630147 PositiveStrandReadsAssigned:324898 NegativeStrandReadsAssigned:23746075 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161380 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161380-trimmed-pair1.fastq SRR12161380-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,662,452 reads, 23,704,255 reads pseudoaligned [quant] estimated average fragment length: 297.812 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR12161380.ke.tsv 34699 SRR12161380.se.tsv 87100 total ==> SRR12161380.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.19 915 19.4961 Potri.005G024800.1.v4.1 1035 738.188 600 29.8084 Potri.004G059700.1.v4.1 961 664.562 7 0.386292 Potri.007G009000.2.v4.1 1416 1119.19 0 0 Potri.003G141000.2.v4.1 2943 2646.19 895 12.4038 Potri.016G087400.1.v4.1 270 65.2015 1382 777.328 Potri.015G069301.1.v4.1 564 287.201 0 0 Potri.010G195200.1.v4.1 1773 1476.19 25 0.621087 Potri.012G127500.1.v4.1 977 680.357 284 15.3086 ==> SRR12161380.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 238 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 378 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR12161380 completed mapping pipeline successfully