Starting /dee2/code/volunteer_pipeline.sh SRR12161381 current disk space = 3087373672448 free memory = 1450054364 SRR12161381 SRAfilesize c7b2cf816551dbdab20435a003aa6347 SRR12161381.sra SRR12161381.sra file validated SRR12161381 is paired end SRR12161381 is conventional basespace SRR12161381 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161381_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.58775 37.0 37.0 37.0 37.0 37.0 2 36.4405 37.0 37.0 37.0 37.0 37.0 3 36.5585 37.0 37.0 37.0 37.0 37.0 4 36.5245 37.0 37.0 37.0 37.0 37.0 5 36.539 37.0 37.0 37.0 37.0 37.0 6 36.584 37.0 37.0 37.0 37.0 37.0 7 36.5635 37.0 37.0 37.0 37.0 37.0 8 36.571 37.0 37.0 37.0 37.0 37.0 9 36.5795 37.0 37.0 37.0 37.0 37.0 10-14 36.5813 37.0 37.0 37.0 37.0 37.0 15-19 36.578500000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.541999999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4858 37.0 37.0 37.0 37.0 37.0 30-34 36.5264 37.0 37.0 37.0 37.0 37.0 35-39 36.445899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.43919999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.3788 37.0 37.0 37.0 37.0 37.0 50-54 36.4041 37.0 37.0 37.0 37.0 37.0 55-59 36.4029 37.0 37.0 37.0 37.0 37.0 60-64 36.3595 37.0 37.0 37.0 37.0 37.0 65-69 36.342600000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3534 37.0 37.0 37.0 37.0 37.0 75-79 36.34250000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.2899 37.0 37.0 37.0 37.0 37.0 85-89 36.3023 37.0 37.0 37.0 37.0 37.0 90-94 36.2806 37.0 37.0 37.0 37.0 37.0 95-99 36.277300000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2344 37.0 37.0 37.0 37.0 37.0 105-109 36.1803 37.0 37.0 37.0 37.0 37.0 110-114 36.1955 37.0 37.0 37.0 37.0 37.0 115-119 36.1689 37.0 37.0 37.0 37.0 37.0 120-124 36.1793 37.0 37.0 37.0 37.0 37.0 125-129 36.1374 37.0 37.0 37.0 37.0 37.0 130-134 36.1288 37.0 37.0 37.0 37.0 37.0 135-139 36.0314 37.0 37.0 37.0 37.0 37.0 140-144 35.9576 37.0 37.0 37.0 37.0 37.0 145-149 35.8946 37.0 37.0 37.0 37.0 37.0 150-151 35.81625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 0.0 25 1.0 26 4.0 27 8.0 28 8.0 29 13.0 30 27.0 31 27.0 32 49.0 33 79.0 34 117.0 35 291.0 36 2890.0 37 483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.08427106776694 12.003000750187546 5.326331582895724 45.586396599149786 2 17.925 13.225000000000001 36.55 32.300000000000004 3 17.275 13.875000000000002 28.1 40.75 4 21.6 21.349999999999998 25.35 31.7 5 21.75 30.3 24.775 23.175 6 20.599999999999998 34.1 23.775 21.525 7 16.675 28.1 37.8 17.424999999999997 8 17.775 26.224999999999998 32.025 23.974999999999998 9 17.599999999999998 22.675 36.3 23.425 10-14 19.245 29.630000000000003 27.79 23.335 15-19 19.61 28.549999999999997 27.284999999999997 24.555 20-24 19.759999999999998 28.255000000000003 27.894999999999996 24.09 25-29 19.595000000000002 27.815 28.499999999999996 24.09 30-34 19.55 28.549999999999997 27.62 24.279999999999998 35-39 19.88 28.000000000000004 27.800000000000004 24.32 40-44 20.169999999999998 29.104999999999997 27.045 23.68 45-49 20.125 28.025 27.38 24.47 50-54 20.919999999999998 27.99 27.57 23.52 55-59 20.62 27.74 27.400000000000002 24.240000000000002 60-64 19.97 28.34 27.275 24.415 65-69 20.335 27.884999999999998 27.57 24.21 70-74 20.455000000000002 28.549999999999997 26.91 24.085 75-79 19.835 28.389999999999997 27.42 24.355 80-84 20.325 28.015 27.235 24.425 85-89 20.599999999999998 28.044999999999998 26.825 24.529999999999998 90-94 20.505000000000003 27.775 27.675 24.044999999999998 95-99 20.46 27.894999999999996 27.125 24.52 100-104 20.72 28.49 27.235 23.555 105-109 20.895 28.105000000000004 27.29 23.71 110-114 20.669999999999998 27.91 27.115000000000002 24.305 115-119 21.27 27.639999999999997 27.279999999999998 23.810000000000002 120-124 20.580000000000002 28.07 27.400000000000002 23.95 125-129 21.29 27.675 26.974999999999998 24.060000000000002 130-134 20.715 28.285 27.01 23.990000000000002 135-139 21.455 27.33 27.12 24.095 140-144 20.9 28.294999999999998 26.87 23.935000000000002 145-149 21.89 27.810000000000002 26.905 23.395 150-151 20.7125 27.975 26.974999999999998 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.5 26 4.0 27 6.5 28 12.5 29 13.0 30 13.5 31 22.5 32 32.5 33 36.5 34 50.5 35 71.0 36 81.0 37 99.5 38 118.5 39 131.5 40 155.0 41 184.5 42 209.0 43 237.0 44 262.5 45 253.0 46 249.0 47 271.5 48 260.0 49 225.5 50 197.0 51 166.5 52 141.5 53 121.0 54 95.0 55 71.5 56 51.5 57 36.5 58 33.0 59 26.0 60 21.0 61 14.0 62 5.0 63 4.0 64 3.0 65 1.0 66 0.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 95.0039442545359 90.325 2 4.811990533789114 9.15 3 0.18406521167499343 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.25 0.0 0.0 0.0 0.0 126-127 2.5375 0.0 0.0 0.0 0.0 128-129 2.9 0.0 0.0 0.0 0.0 130-131 3.0999999999999996 0.0 0.0 0.0 0.0 132-133 3.3125 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTATCC 10 0.006830828 145.0 7 GCACACG 20 3.5877043E-4 108.75 145 >>END_MODULE SRR12161381 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161381_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0355 37.0 37.0 37.0 37.0 37.0 2 35.6735 37.0 37.0 37.0 37.0 37.0 3 35.8465 37.0 37.0 37.0 37.0 37.0 4 36.0195 37.0 37.0 37.0 37.0 37.0 5 36.078 37.0 37.0 37.0 37.0 37.0 6 36.0635 37.0 37.0 37.0 37.0 37.0 7 36.074 37.0 37.0 37.0 37.0 37.0 8 36.114 37.0 37.0 37.0 37.0 37.0 9 36.166 37.0 37.0 37.0 37.0 37.0 10-14 36.1136 37.0 37.0 37.0 37.0 37.0 15-19 36.137100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.139300000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.0754 37.0 37.0 37.0 37.0 37.0 30-34 36.0278 37.0 37.0 37.0 37.0 37.0 35-39 36.0468 37.0 37.0 37.0 37.0 37.0 40-44 35.989000000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9595 37.0 37.0 37.0 37.0 37.0 50-54 35.9869 37.0 37.0 37.0 37.0 37.0 55-59 35.977199999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.8702 37.0 37.0 37.0 37.0 37.0 65-69 35.9369 37.0 37.0 37.0 37.0 37.0 70-74 35.7718 37.0 37.0 37.0 37.0 37.0 75-79 35.73800000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.803399999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.7593 37.0 37.0 37.0 37.0 37.0 90-94 35.7102 37.0 37.0 37.0 37.0 37.0 95-99 35.716300000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.762 37.0 37.0 37.0 37.0 37.0 105-109 35.711499999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.662 37.0 37.0 37.0 37.0 37.0 115-119 35.67819999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.6648 37.0 37.0 37.0 37.0 37.0 125-129 35.5104 37.0 37.0 37.0 37.0 37.0 130-134 35.3996 37.0 37.0 37.0 34.6 37.0 135-139 35.4386 37.0 37.0 37.0 37.0 37.0 140-144 35.345400000000005 37.0 37.0 37.0 32.2 37.0 145-149 35.3596 37.0 37.0 37.0 32.2 37.0 150-151 34.759 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 2.0 18 1.0 19 1.0 20 2.0 21 2.0 22 1.0 23 2.0 24 2.0 25 7.0 26 15.0 27 9.0 28 16.0 29 23.0 30 35.0 31 66.0 32 70.0 33 122.0 34 222.0 35 684.0 36 2543.0 37 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.6 25.974999999999998 10.15 30.275000000000002 2 26.900000000000002 26.275 31.175000000000004 15.65 3 20.075000000000003 28.799999999999997 31.724999999999998 19.400000000000002 4 22.900000000000002 34.2 25.5 17.4 5 26.224999999999998 36.025 21.9 15.85 6 20.724999999999998 41.75 21.275 16.25 7 20.525 23.25 37.724999999999994 18.5 8 21.85 25.900000000000002 28.4 23.849999999999998 9 21.7 25.224999999999998 30.325000000000003 22.75 10-14 22.900000000000002 29.23 26.56 21.310000000000002 15-19 22.74 28.299999999999997 27.515 21.445 20-24 22.845 28.235 27.66 21.26 25-29 23.330000000000002 28.244999999999997 27.465 20.96 30-34 22.425 27.805000000000003 27.884999999999998 21.884999999999998 35-39 23.025000000000002 27.515 28.23 21.23 40-44 22.825 27.725 27.794999999999998 21.654999999999998 45-49 23.49 27.800000000000004 27.82 20.89 50-54 23.18 27.150000000000002 27.79 21.88 55-59 23.69 27.435 27.425 21.45 60-64 23.735 27.834999999999997 26.99 21.44 65-69 23.315 27.85 27.185 21.65 70-74 23.205000000000002 28.205000000000002 26.669999999999998 21.92 75-79 23.415 27.884999999999998 27.215 21.485000000000003 80-84 22.955000000000002 28.32 27.07 21.654999999999998 85-89 23.549999999999997 27.52 27.975 20.955 90-94 23.62 27.994999999999997 27.534999999999997 20.849999999999998 95-99 23.775 27.744999999999997 27.805000000000003 20.674999999999997 100-104 24.235 27.834999999999997 26.655 21.275 105-109 23.45 28.144999999999996 27.500000000000004 20.905 110-114 23.845 27.605 27.544999999999998 21.005 115-119 23.785 28.01 27.38 20.825 120-124 23.635 27.625 27.275 21.465 125-129 24.375 27.855 27.1 20.669999999999998 130-134 24.025 28.360000000000003 26.895000000000003 20.72 135-139 24.255 27.215 27.63 20.9 140-144 24.740000000000002 28.27 26.529999999999998 20.46 145-149 25.045 27.224999999999998 27.139999999999997 20.59 150-151 25.174999999999997 27.250000000000004 27.5625 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 4.0 26 5.5 27 5.0 28 5.5 29 10.5 30 14.5 31 18.0 32 25.0 33 33.5 34 43.5 35 64.0 36 86.0 37 102.0 38 124.5 39 161.0 40 195.5 41 211.5 42 223.5 43 253.5 44 275.0 45 277.5 46 274.0 47 261.5 48 243.0 49 206.0 50 171.5 51 135.0 52 113.5 53 100.5 54 80.0 55 70.0 56 53.5 57 39.5 58 31.0 59 19.0 60 15.5 61 14.0 62 6.5 63 5.0 64 4.5 65 3.0 66 3.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.043501186396 90.125 2 4.640126548905879 8.799999999999999 3 0.23727919852359608 0.675 4 0.02636435539151068 0.1 5 0.0 0.0 6 0.05272871078302136 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.875 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCATAG 10 0.006830828 145.0 8 CACTGCA 10 0.006830828 145.0 5 GAGCACT 10 0.006830828 145.0 2 GCACTGC 10 0.006830828 145.0 4 CTGCATA 10 0.006830828 145.0 7 GCGTCGT 20 3.5877043E-4 108.75 145 >>END_MODULE Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661776 spots for SRR12161381.sra Written 661776 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra Read 661763 spots for SRR12161381.sra Written 661763 spots for SRR12161381.sra SRR ids: ['SRR12161381.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5dm0s_0r SRR12161381.sra spots: 13235273 blocks: [[1, 661763], [661764, 1323526], [1323527, 1985289], [1985290, 2647052], [2647053, 3308815], [3308816, 3970578], [3970579, 4632341], [4632342, 5294104], [5294105, 5955867], [5955868, 6617630], [6617631, 7279393], [7279394, 7941156], [7941157, 8602919], [8602920, 9264682], [9264683, 9926445], [9926446, 10588208], [10588209, 11249971], [11249972, 11911734], [11911735, 12573497], [12573498, 13235273]] SRR12161381 file size 4476224 SRR12161381 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161381 SRR12161381_1.fastq SRR12161381_2.fastq Input file: SRR12161381_1.fastq Paired file: SRR12161381_2.fastq trimmed: SRR12161381-trimmed-pair1.fastq, SRR12161381-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:36:58 2025 >> started Thu Feb 13 19:37:12 2025 >> done (14.334s) 13235273 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 849 ( 0.01%) empty read pairs filtered out after trimming by size control 13234406 (99.99%) read pairs available; of these: 833822 ( 6.30%) trimmed read pairs available after processing 12400584 (93.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 0 0.00% 22 1 0.00% 23 4 0.00% 24 2 0.00% 25 2 0.00% 26 2 0.00% 27 6 0.00% 28 4 0.00% 29 4 0.00% 30 4 0.00% 31 2 0.00% 32 2 0.00% 33 4 0.00% 34 4 0.00% 35 5 0.00% 36 10 0.00% 37 4 0.00% 38 4 0.00% 39 12 0.00% 40 11 0.00% 41 7 0.00% 42 13 0.00% 43 13 0.00% 44 7 0.00% 45 12 0.00% 46 8 0.00% 47 9 0.00% 48 17 0.00% 49 14 0.00% 50 20 0.00% 51 28 0.00% 52 18 0.00% 53 22 0.00% 54 31 0.00% 55 30 0.00% 56 33 0.00% 57 41 0.00% 58 44 0.00% 59 34 0.00% 60 71 0.00% 61 62 0.00% 62 66 0.00% 63 95 0.00% 64 97 0.00% 65 94 0.00% 66 93 0.00% 67 110 0.00% 68 122 0.00% 69 145 0.00% 70 165 0.00% 71 206 0.00% 72 225 0.00% 73 243 0.00% 74 283 0.00% 75 345 0.00% 76 359 0.00% 77 389 0.00% 78 442 0.00% 79 532 0.00% 80 598 0.00% 81 680 0.01% 82 763 0.01% 83 842 0.01% 84 944 0.01% 85 1107 0.01% 86 1215 0.01% 87 1265 0.01% 88 1382 0.01% 89 1597 0.01% 90 1763 0.01% 91 1893 0.01% 92 2168 0.02% 93 2384 0.02% 94 2661 0.02% 95 2942 0.02% 96 3181 0.02% 97 3401 0.03% 98 3793 0.03% 99 3937 0.03% 100 4270 0.03% 101 4554 0.03% 102 4796 0.04% 103 5196 0.04% 104 5644 0.04% 105 5958 0.05% 106 6483 0.05% 107 6764 0.05% 108 7151 0.05% 109 7585 0.06% 110 7892 0.06% 111 8230 0.06% 112 8821 0.07% 113 9180 0.07% 114 9357 0.07% 115 10146 0.08% 116 10620 0.08% 117 11045 0.08% 118 11628 0.09% 119 11793 0.09% 120 12417 0.09% 121 13026 0.10% 122 13313 0.10% 123 13844 0.10% 124 14467 0.11% 125 14875 0.11% 126 15714 0.12% 127 16101 0.12% 128 16734 0.13% 129 17116 0.13% 130 17657 0.13% 131 18109 0.14% 132 18609 0.14% 133 18947 0.14% 134 19555 0.15% 135 20079 0.15% 136 20809 0.16% 137 21111 0.16% 138 21804 0.16% 139 22747 0.17% 140 23223 0.18% 141 23595 0.18% 142 24658 0.19% 143 24944 0.19% 144 25380 0.19% 145 25962 0.20% 146 26337 0.20% 147 27120 0.20% 148 27829 0.21% 149 28155 0.21% 150 29315 0.22% 151 12400584 93.70% 13234406 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=10.86 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.4 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.89 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=108.72 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.3 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12161381 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:37:58 Started mapping on | Feb 13 19:37:58 Finished on | Feb 13 19:39:24 Mapping speed, Million of reads per hour | 554.00 Number of input reads | 13234406 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12597334 Uniquely mapped reads % | 95.19% Average mapped length | 298.18 Number of splices: Total | 13004760 Number of splices: Annotated (sjdb) | 12737311 Number of splices: GT/AG | 12743659 Number of splices: GC/AG | 215730 Number of splices: AT/AC | 9639 Number of splices: Non-canonical | 35732 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309691 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 93689 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.61% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 327381 327381 327381 N_multimapping 309691 309691 309691 N_noFeature 414933 12435544 461954 N_ambiguous 195239 871 79931 UnstrandedReadsAssigned:11987162 PositiveStrandReadsAssigned:160919 NegativeStrandReadsAssigned:12055449 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161381 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161381-trimmed-pair1.fastq SRR12161381-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,234,406 reads, 12,046,418 reads pseudoaligned [quant] estimated average fragment length: 273.277 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR12161381.ke.tsv 34699 SRR12161381.se.tsv 87100 total ==> SRR12161381.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.72 415 16.9332 Potri.005G024800.1.v4.1 1035 762.723 191 17.8374 Potri.004G059700.1.v4.1 961 688.843 42 4.34304 Potri.007G009000.2.v4.1 1416 1143.72 0 0 Potri.003G141000.2.v4.1 2943 2670.72 649.461 17.3217 Potri.016G087400.1.v4.1 270 73.5727 662 640.924 Potri.015G069301.1.v4.1 564 304.96 0 0 Potri.010G195200.1.v4.1 1773 1500.72 20 0.949281 Potri.012G127500.1.v4.1 977 704.805 196 19.8085 ==> SRR12161381.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 201 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 167 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12161381 completed mapping pipeline successfully