Starting /dee2/code/volunteer_pipeline.sh SRR12161382 current disk space = 3088819212288 free memory = 1582394072 SRR12161382 SRAfilesize d28e08689ef6e8905e1db6b79792bf3b SRR12161382.sra SRR12161382.sra file validated SRR12161382 is paired end SRR12161382 is conventional basespace SRR12161382 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161382_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5605 37.0 37.0 37.0 37.0 37.0 2 36.3275 37.0 37.0 37.0 37.0 37.0 3 36.465 37.0 37.0 37.0 37.0 37.0 4 36.531 37.0 37.0 37.0 37.0 37.0 5 36.514 37.0 37.0 37.0 37.0 37.0 6 36.5945 37.0 37.0 37.0 37.0 37.0 7 36.423 37.0 37.0 37.0 37.0 37.0 8 36.588 37.0 37.0 37.0 37.0 37.0 9 36.4825 37.0 37.0 37.0 37.0 37.0 10-14 36.560500000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5387 37.0 37.0 37.0 37.0 37.0 20-24 36.5207 37.0 37.0 37.0 37.0 37.0 25-29 36.5047 37.0 37.0 37.0 37.0 37.0 30-34 36.444199999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4248 37.0 37.0 37.0 37.0 37.0 40-44 36.390699999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.40650000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.372400000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3765 37.0 37.0 37.0 37.0 37.0 60-64 36.348299999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2469 37.0 37.0 37.0 37.0 37.0 70-74 36.2704 37.0 37.0 37.0 37.0 37.0 75-79 36.2394 37.0 37.0 37.0 37.0 37.0 80-84 36.275099999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.243300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2331 37.0 37.0 37.0 37.0 37.0 95-99 36.1948 37.0 37.0 37.0 37.0 37.0 100-104 36.1241 37.0 37.0 37.0 37.0 37.0 105-109 36.1163 37.0 37.0 37.0 37.0 37.0 110-114 36.1262 37.0 37.0 37.0 37.0 37.0 115-119 36.1408 37.0 37.0 37.0 37.0 37.0 120-124 36.124900000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0461 37.0 37.0 37.0 37.0 37.0 130-134 36.0475 37.0 37.0 37.0 37.0 37.0 135-139 35.9777 37.0 37.0 37.0 37.0 37.0 140-144 35.9477 37.0 37.0 37.0 37.0 37.0 145-149 35.888600000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.79975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 5.0 26 4.0 27 10.0 28 16.0 29 15.0 30 18.0 31 31.0 32 51.0 33 73.0 34 120.0 35 292.0 36 2936.0 37 423.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.09804902451226 12.73136568284142 6.278139069534768 34.892446223111556 2 20.925 12.525 31.974999999999998 34.575 3 16.25 18.025 30.375000000000004 35.35 4 21.325 25.35 23.599999999999998 29.725 5 23.325000000000003 31.5 22.8 22.375 6 20.925 34.275 23.45 21.349999999999998 7 15.575 27.375 40.675 16.375 8 18.725 25.525 29.849999999999998 25.900000000000002 9 16.650000000000002 24.099999999999998 35.099999999999994 24.15 10-14 19.384999999999998 29.505 27.32 23.79 15-19 19.265 27.915 28.455000000000002 24.365000000000002 20-24 20.560000000000002 28.349999999999998 27.265 23.825 25-29 20.599999999999998 28.095 27.105 24.2 30-34 20.015 28.34 27.115000000000002 24.529999999999998 35-39 20.355 27.860000000000003 27.46 24.325 40-44 20.830000000000002 28.854999999999997 26.26 24.055 45-49 20.78 28.09 26.935 24.195 50-54 20.169999999999998 28.549999999999997 27.32 23.96 55-59 20.325 28.46 26.939999999999998 24.275 60-64 20.8 27.755000000000003 27.29 24.154999999999998 65-69 20.885 28.33 26.825 23.96 70-74 20.935000000000002 28.345 26.495 24.224999999999998 75-79 21.05 27.650000000000002 27.025 24.275 80-84 20.415 28.144999999999996 26.72 24.72 85-89 20.87 28.16 26.895000000000003 24.075 90-94 21.115000000000002 26.950000000000003 27.825 24.11 95-99 20.445 27.944999999999997 27.639999999999997 23.97 100-104 20.835 27.224999999999998 27.375 24.565 105-109 20.865000000000002 27.584999999999997 27.555000000000003 23.995 110-114 21.740000000000002 27.089999999999996 27.575 23.595 115-119 21.215 27.715 26.950000000000003 24.12 120-124 21.205 27.35 27.169999999999998 24.275 125-129 20.685000000000002 27.725 27.36 24.23 130-134 21.095 27.425 26.939999999999998 24.54 135-139 21.335 27.750000000000004 26.915 24.0 140-144 21.42 27.295 26.55 24.735 145-149 21.14 27.405 27.045 24.41 150-151 21.2375 27.9375 26.8 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 3.0 24 3.0 25 3.0 26 2.5 27 6.5 28 13.0 29 15.0 30 12.5 31 20.0 32 31.0 33 30.5 34 39.0 35 66.5 36 90.5 37 99.5 38 119.5 39 142.5 40 157.0 41 170.5 42 179.5 43 200.5 44 231.0 45 274.0 46 284.0 47 263.0 48 227.5 49 202.5 50 195.5 51 176.5 52 154.5 53 124.0 54 103.5 55 89.0 56 69.5 57 52.0 58 41.0 59 32.0 60 21.5 61 15.0 62 10.0 63 3.5 64 1.5 65 3.5 66 4.5 67 2.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.3851098018211 87.175 2 6.106052490626674 11.4 3 0.5088377075522228 1.425 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.4249999999999998 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 2.925 0.0 0.0 0.0 0.0 134-135 3.2125000000000004 0.0 0.0 0.0 0.0 136-137 3.6 0.0 0.0 0.0 0.0 138-139 3.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAACC 10 0.006830828 145.0 7 >>END_MODULE SRR12161382 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161382_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.229 37.0 37.0 37.0 37.0 37.0 2 35.8295 37.0 37.0 37.0 37.0 37.0 3 35.881 37.0 37.0 37.0 37.0 37.0 4 35.9205 37.0 37.0 37.0 37.0 37.0 5 36.241 37.0 37.0 37.0 37.0 37.0 6 36.088 37.0 37.0 37.0 37.0 37.0 7 35.997 37.0 37.0 37.0 37.0 37.0 8 36.1995 37.0 37.0 37.0 37.0 37.0 9 35.9945 37.0 37.0 37.0 37.0 37.0 10-14 36.1035 37.0 37.0 37.0 37.0 37.0 15-19 36.0207 37.0 37.0 37.0 37.0 37.0 20-24 35.928000000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.9614 37.0 37.0 37.0 37.0 37.0 30-34 35.8592 37.0 37.0 37.0 37.0 37.0 35-39 35.8663 37.0 37.0 37.0 37.0 37.0 40-44 35.8856 37.0 37.0 37.0 37.0 37.0 45-49 35.7941 37.0 37.0 37.0 37.0 37.0 50-54 35.8454 37.0 37.0 37.0 37.0 37.0 55-59 35.810199999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.7838 37.0 37.0 37.0 37.0 37.0 65-69 35.73960000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.616499999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.6783 37.0 37.0 37.0 37.0 37.0 80-84 35.747499999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.741200000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.6819 37.0 37.0 37.0 37.0 37.0 95-99 35.609899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.6379 37.0 37.0 37.0 37.0 37.0 105-109 35.6231 37.0 37.0 37.0 37.0 37.0 110-114 35.559099999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.5578 37.0 37.0 37.0 37.0 37.0 120-124 35.6022 37.0 37.0 37.0 37.0 37.0 125-129 35.384800000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.39 37.0 37.0 37.0 37.0 37.0 135-139 35.4424 37.0 37.0 37.0 37.0 37.0 140-144 35.343399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.334199999999996 37.0 37.0 37.0 37.0 37.0 150-151 34.76675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 10.0 14 11.0 15 5.0 16 3.0 17 3.0 18 3.0 19 2.0 20 4.0 21 1.0 22 8.0 23 6.0 24 10.0 25 7.0 26 14.0 27 13.0 28 12.0 29 21.0 30 26.0 31 36.0 32 60.0 33 87.0 34 199.0 35 553.0 36 2643.0 37 259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.175000000000004 25.75 8.825 22.25 2 28.749999999999996 26.674999999999997 28.275 16.3 3 21.75 27.55 32.0 18.7 4 24.675 34.625 22.075 18.625 5 25.05 37.525 20.175 17.25 6 21.45 38.675 21.775 18.099999999999998 7 20.7 23.225 36.875 19.2 8 21.325 26.325 26.125 26.224999999999998 9 22.6 24.474999999999998 28.599999999999998 24.325 10-14 24.19 28.88 25.695 21.235 15-19 23.735 27.639999999999997 27.284999999999997 21.34 20-24 23.7 28.355000000000004 26.889999999999997 21.055 25-29 23.455000000000002 27.785 27.47 21.29 30-34 23.635 27.265 27.55 21.55 35-39 23.855 28.26 26.91 20.974999999999998 40-44 23.255 28.110000000000003 27.455000000000002 21.18 45-49 22.785 28.084999999999997 26.875 22.255 50-54 23.25 28.095 26.985 21.67 55-59 23.305 28.265 26.935 21.495 60-64 23.935000000000002 27.57 26.75 21.745 65-69 23.935000000000002 27.685 26.91 21.47 70-74 24.12 27.125 27.02 21.735 75-79 23.544999999999998 28.205000000000002 26.590000000000003 21.66 80-84 24.315 28.310000000000002 26.265 21.11 85-89 24.23 27.87 26.27 21.63 90-94 24.099999999999998 28.294999999999998 26.605 21.0 95-99 23.48 27.875 27.245 21.4 100-104 24.43 27.865000000000002 26.68 21.025 105-109 24.0 27.560000000000002 26.415 22.025 110-114 24.15 27.965 26.72 21.165 115-119 24.4 28.515 26.200000000000003 20.885 120-124 23.885 28.02 27.250000000000004 20.845 125-129 24.665 27.57 26.665 21.099999999999998 130-134 25.22 28.21 26.52 20.05 135-139 24.834999999999997 27.055 27.405 20.705000000000002 140-144 24.41 27.32 26.85 21.42 145-149 25.995 27.185 26.284999999999997 20.535 150-151 25.387500000000003 27.075 27.05 20.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 1.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.5 22 2.0 23 0.5 24 2.0 25 2.5 26 4.0 27 6.0 28 4.0 29 7.0 30 11.0 31 13.0 32 18.0 33 26.0 34 39.0 35 50.0 36 74.5 37 88.5 38 98.0 39 143.0 40 189.5 41 207.5 42 219.0 43 258.5 44 271.0 45 275.0 46 272.5 47 251.5 48 239.5 49 217.5 50 177.5 51 144.5 52 131.0 53 110.5 54 101.0 55 84.5 56 57.0 57 42.0 58 35.5 59 26.5 60 18.5 61 14.0 62 11.0 63 8.5 64 6.5 65 4.5 66 1.5 67 0.0 68 0.0 69 1.0 70 2.0 71 2.0 72 1.5 73 1.0 74 1.0 75 1.0 76 1.0 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 1.0 86 1.0 87 0.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.75167605256101 87.4 2 5.5779029230356665 10.4 3 0.4827031375703942 1.35 4 0.08045052292839903 0.3 5 0.053633681952266025 0.25 6 0.053633681952266025 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAACCG 10 0.006830828 145.0 9 >>END_MODULE Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869461 spots for SRR12161382.sra Written 869461 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra Read 869460 spots for SRR12161382.sra Written 869460 spots for SRR12161382.sra SRR ids: ['SRR12161382.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6_7k2qu9 SRR12161382.sra spots: 17389201 blocks: [[1, 869460], [869461, 1738920], [1738921, 2608380], [2608381, 3477840], [3477841, 4347300], [4347301, 5216760], [5216761, 6086220], [6086221, 6955680], [6955681, 7825140], [7825141, 8694600], [8694601, 9564060], [9564061, 10433520], [10433521, 11302980], [11302981, 12172440], [12172441, 13041900], [13041901, 13911360], [13911361, 14780820], [14780821, 15650280], [15650281, 16519740], [16519741, 17389201]] SRR12161382 file size 5887910 SRR12161382 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161382 SRR12161382_1.fastq SRR12161382_2.fastq Input file: SRR12161382_1.fastq Paired file: SRR12161382_2.fastq trimmed: SRR12161382-trimmed-pair1.fastq, SRR12161382-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:58:02 2025 >> started Thu Feb 13 16:58:20 2025 >> done (18.541s) 17389201 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 4029 ( 0.02%) empty read pairs filtered out after trimming by size control 17385157 (99.98%) read pairs available; of these: 1221260 ( 7.02%) trimmed read pairs available after processing 16163897 (92.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 4 0.00% 21 7 0.00% 22 5 0.00% 23 13 0.00% 24 6 0.00% 25 5 0.00% 26 16 0.00% 27 11 0.00% 28 6 0.00% 29 9 0.00% 30 14 0.00% 31 5 0.00% 32 10 0.00% 33 6 0.00% 34 14 0.00% 35 11 0.00% 36 17 0.00% 37 14 0.00% 38 24 0.00% 39 11 0.00% 40 12 0.00% 41 13 0.00% 42 13 0.00% 43 18 0.00% 44 23 0.00% 45 18 0.00% 46 18 0.00% 47 19 0.00% 48 22 0.00% 49 25 0.00% 50 33 0.00% 51 35 0.00% 52 48 0.00% 53 44 0.00% 54 56 0.00% 55 45 0.00% 56 48 0.00% 57 63 0.00% 58 66 0.00% 59 71 0.00% 60 88 0.00% 61 124 0.00% 62 105 0.00% 63 148 0.00% 64 151 0.00% 65 161 0.00% 66 161 0.00% 67 186 0.00% 68 229 0.00% 69 286 0.00% 70 301 0.00% 71 316 0.00% 72 391 0.00% 73 425 0.00% 74 487 0.00% 75 565 0.00% 76 606 0.00% 77 651 0.00% 78 709 0.00% 79 824 0.00% 80 941 0.01% 81 1159 0.01% 82 1271 0.01% 83 1433 0.01% 84 1684 0.01% 85 1826 0.01% 86 1903 0.01% 87 2142 0.01% 88 2261 0.01% 89 2551 0.01% 90 2912 0.02% 91 3235 0.02% 92 3488 0.02% 93 3803 0.02% 94 4385 0.03% 95 4636 0.03% 96 4917 0.03% 97 5301 0.03% 98 5650 0.03% 99 6064 0.03% 100 6548 0.04% 101 6788 0.04% 102 7617 0.04% 103 8049 0.05% 104 8704 0.05% 105 9062 0.05% 106 9359 0.05% 107 9823 0.06% 108 10153 0.06% 109 10775 0.06% 110 11314 0.07% 111 11971 0.07% 112 12950 0.07% 113 13271 0.08% 114 14017 0.08% 115 14774 0.08% 116 15485 0.09% 117 16039 0.09% 118 16523 0.10% 119 16865 0.10% 120 17675 0.10% 121 18530 0.11% 122 19133 0.11% 123 20242 0.12% 124 20978 0.12% 125 21823 0.13% 126 22556 0.13% 127 23172 0.13% 128 23911 0.14% 129 24519 0.14% 130 24848 0.14% 131 25446 0.15% 132 26290 0.15% 133 27817 0.16% 134 28372 0.16% 135 29835 0.17% 136 30542 0.18% 137 30827 0.18% 138 31627 0.18% 139 32873 0.19% 140 33186 0.19% 141 34220 0.20% 142 34979 0.20% 143 36584 0.21% 144 37593 0.22% 145 38621 0.22% 146 39626 0.23% 147 40115 0.23% 148 41740 0.24% 149 40968 0.24% 150 43145 0.25% 151 16163897 92.98% 17385157 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.96 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=45.64 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.0 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=26 prefix-density=1.13 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=27 fanout-score=18.78 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=6.6 sequence=GCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12161382 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:59:03 Started mapping on | Feb 13 16:59:04 Finished on | Feb 13 17:01:10 Mapping speed, Million of reads per hour | 496.72 Number of input reads | 17385157 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16057920 Uniquely mapped reads % | 92.37% Average mapped length | 297.83 Number of splices: Total | 17004677 Number of splices: Annotated (sjdb) | 16724060 Number of splices: GT/AG | 16672857 Number of splices: GC/AG | 265239 Number of splices: AT/AC | 11777 Number of splices: Non-canonical | 54804 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382963 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 140364 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 944274 944274 944274 N_multimapping 382963 382963 382963 N_noFeature 439538 15767296 505928 N_ambiguous 327472 1160 102543 UnstrandedReadsAssigned:15290910 PositiveStrandReadsAssigned:289464 NegativeStrandReadsAssigned:15449449 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161382 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161382-trimmed-pair1.fastq SRR12161382-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,385,157 reads, 15,550,626 reads pseudoaligned [quant] estimated average fragment length: 263.303 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR12161382.ke.tsv 34699 SRR12161382.se.tsv 87100 total ==> SRR12161382.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.7 605 14.0846 Potri.005G024800.1.v4.1 1035 772.697 726 38.403 Potri.004G059700.1.v4.1 961 698.893 55 3.21655 Potri.007G009000.2.v4.1 1416 1153.7 0 0 Potri.003G141000.2.v4.1 2943 2680.7 483.393 7.37038 Potri.016G087400.1.v4.1 270 75.3913 1125 609.914 Potri.015G069301.1.v4.1 564 314.56 0 0 Potri.010G195200.1.v4.1 1773 1510.7 122 3.30081 Potri.012G127500.1.v4.1 977 714.824 379 21.6709 ==> SRR12161382.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR12161382 completed mapping pipeline successfully