Starting /dee2/code/volunteer_pipeline.sh SRR12161383 current disk space = 3088960311296 free memory = 1426112212 SRR12161383 SRAfilesize 5b22b42d47ab0d4f67a0a2dbfe17330e SRR12161383.sra SRR12161383.sra file validated SRR12161383 is paired end SRR12161383 is conventional basespace SRR12161383 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161383_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6295 37.0 37.0 37.0 37.0 37.0 2 36.531 37.0 37.0 37.0 37.0 37.0 3 36.596 37.0 37.0 37.0 37.0 37.0 4 36.675 37.0 37.0 37.0 37.0 37.0 5 36.6625 37.0 37.0 37.0 37.0 37.0 6 36.6495 37.0 37.0 37.0 37.0 37.0 7 36.5675 37.0 37.0 37.0 37.0 37.0 8 36.5065 37.0 37.0 37.0 37.0 37.0 9 36.5505 37.0 37.0 37.0 37.0 37.0 10-14 36.590999999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.6048 37.0 37.0 37.0 37.0 37.0 20-24 36.519400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.501 37.0 37.0 37.0 37.0 37.0 30-34 36.4713 37.0 37.0 37.0 37.0 37.0 35-39 36.479200000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4567 37.0 37.0 37.0 37.0 37.0 45-49 36.4342 37.0 37.0 37.0 37.0 37.0 50-54 36.4165 37.0 37.0 37.0 37.0 37.0 55-59 36.4091 37.0 37.0 37.0 37.0 37.0 60-64 36.3871 37.0 37.0 37.0 37.0 37.0 65-69 36.3568 37.0 37.0 37.0 37.0 37.0 70-74 36.3876 37.0 37.0 37.0 37.0 37.0 75-79 36.371500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.4182 37.0 37.0 37.0 37.0 37.0 85-89 36.327600000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.33 37.0 37.0 37.0 37.0 37.0 95-99 36.2396 37.0 37.0 37.0 37.0 37.0 100-104 36.262299999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1971 37.0 37.0 37.0 37.0 37.0 110-114 36.2217 37.0 37.0 37.0 37.0 37.0 115-119 36.2299 37.0 37.0 37.0 37.0 37.0 120-124 36.1614 37.0 37.0 37.0 37.0 37.0 125-129 36.1158 37.0 37.0 37.0 37.0 37.0 130-134 36.100699999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.065599999999996 37.0 37.0 37.0 37.0 37.0 140-144 36.0662 37.0 37.0 37.0 37.0 37.0 145-149 35.9764 37.0 37.0 37.0 37.0 37.0 150-151 35.95 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 2.0 26 8.0 27 6.0 28 8.0 29 18.0 30 19.0 31 33.0 32 38.0 33 58.0 34 119.0 35 249.0 36 2976.0 37 465.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.54727363681841 13.081540770385192 5.902951475737869 36.46823411705853 2 19.950000000000003 13.3 36.375 30.375000000000004 3 16.525000000000002 16.25 29.799999999999997 37.425000000000004 4 20.849999999999998 24.325 25.900000000000002 28.925 5 22.3 30.5 24.474999999999998 22.725 6 20.075000000000003 35.5 23.35 21.075 7 14.825 28.15 40.275 16.75 8 17.1 27.6 31.85 23.45 9 16.025 24.825 35.575 23.575 10-14 18.575 30.995 27.375 23.055 15-19 19.465 28.82 27.425 24.29 20-24 19.55 29.425 27.13 23.895 25-29 19.735 28.994999999999997 27.33 23.94 30-34 19.42 29.549999999999997 26.945000000000004 24.085 35-39 19.925 28.88 26.889999999999997 24.305 40-44 19.57 29.315 27.575 23.54 45-49 20.125 29.095 26.985 23.794999999999998 50-54 19.6 29.435 27.36 23.605 55-59 20.365 29.244999999999997 26.200000000000003 24.19 60-64 19.99 28.915000000000003 26.83 24.265 65-69 20.905 28.84 26.540000000000003 23.715 70-74 20.265 28.665000000000003 26.735 24.335 75-79 19.665 29.035 26.86 24.44 80-84 19.435 28.365000000000002 27.215 24.985 85-89 20.565 28.845 26.825 23.765 90-94 20.085 28.155 27.625 24.135 95-99 20.544999999999998 28.34 27.07 24.044999999999998 100-104 20.465 28.205000000000002 26.87 24.46 105-109 21.39 27.54 27.339999999999996 23.73 110-114 20.535 28.02 27.195000000000004 24.25 115-119 20.990000000000002 27.97 26.939999999999998 24.099999999999998 120-124 20.810000000000002 28.28 26.619999999999997 24.29 125-129 20.52 27.565 27.025 24.89 130-134 21.21 27.325 27.38 24.085 135-139 21.404999999999998 27.145000000000003 27.605 23.845 140-144 21.145 26.919999999999998 27.46 24.474999999999998 145-149 20.64 27.845 27.11 24.404999999999998 150-151 21.462500000000002 28.9 25.874999999999996 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 1.0 21 1.5 22 2.0 23 1.5 24 3.0 25 7.0 26 5.5 27 8.5 28 18.0 29 18.0 30 20.5 31 27.5 32 36.5 33 59.0 34 78.0 35 84.0 36 92.0 37 111.5 38 135.0 39 145.5 40 165.0 41 186.5 42 210.5 43 226.5 44 230.0 45 229.0 46 235.0 47 242.0 48 225.0 49 201.5 50 183.5 51 159.0 52 138.0 53 131.0 54 105.5 55 72.5 56 49.5 57 40.5 58 31.0 59 24.5 60 21.5 61 13.0 62 6.0 63 4.0 64 4.0 65 2.5 66 1.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.05491868834977 88.2 2 5.3319114902692615 10.0 3 0.5331911490269262 1.5 4 0.07997867235403892 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.225 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161383 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161383_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3835 37.0 37.0 37.0 37.0 37.0 2 36.1315 37.0 37.0 37.0 37.0 37.0 3 36.2685 37.0 37.0 37.0 37.0 37.0 4 36.307 37.0 37.0 37.0 37.0 37.0 5 36.348 37.0 37.0 37.0 37.0 37.0 6 36.2695 37.0 37.0 37.0 37.0 37.0 7 36.2505 37.0 37.0 37.0 37.0 37.0 8 36.375 37.0 37.0 37.0 37.0 37.0 9 36.3805 37.0 37.0 37.0 37.0 37.0 10-14 36.321999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2996 37.0 37.0 37.0 37.0 37.0 20-24 36.2989 37.0 37.0 37.0 37.0 37.0 25-29 36.283100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.281499999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.2959 37.0 37.0 37.0 37.0 37.0 40-44 36.2111 37.0 37.0 37.0 37.0 37.0 45-49 36.1586 37.0 37.0 37.0 37.0 37.0 50-54 36.1924 37.0 37.0 37.0 37.0 37.0 55-59 36.153800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1419 37.0 37.0 37.0 37.0 37.0 65-69 36.155800000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.03589999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.014500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.0898 37.0 37.0 37.0 37.0 37.0 85-89 36.0533 37.0 37.0 37.0 37.0 37.0 90-94 35.9671 37.0 37.0 37.0 37.0 37.0 95-99 36.0563 37.0 37.0 37.0 37.0 37.0 100-104 35.973400000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.9322 37.0 37.0 37.0 37.0 37.0 110-114 35.94160000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.936899999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.9435 37.0 37.0 37.0 37.0 37.0 125-129 35.812 37.0 37.0 37.0 37.0 37.0 130-134 35.7481 37.0 37.0 37.0 37.0 37.0 135-139 35.8465 37.0 37.0 37.0 37.0 37.0 140-144 35.7892 37.0 37.0 37.0 37.0 37.0 145-149 35.7863 37.0 37.0 37.0 37.0 37.0 150-151 35.210499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 1.0 21 4.0 22 1.0 23 9.0 24 2.0 25 8.0 26 2.0 27 6.0 28 4.0 29 20.0 30 26.0 31 29.0 32 39.0 33 68.0 34 167.0 35 504.0 36 2828.0 37 274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.975 28.499999999999996 7.025 24.5 2 28.525 27.950000000000003 27.800000000000004 15.725 3 20.175 28.599999999999998 31.2 20.025000000000002 4 22.375 36.075 24.349999999999998 17.2 5 24.975 37.275000000000006 20.724999999999998 17.025000000000002 6 22.95 39.975 19.55 17.525 7 21.85 22.225 36.3 19.625 8 21.45 25.900000000000002 28.499999999999996 24.15 9 21.75 25.474999999999998 29.525000000000002 23.25 10-14 24.495 29.294999999999998 25.53 20.68 15-19 23.915 28.33 26.685 21.07 20-24 24.4 28.38 26.275 20.945 25-29 24.13 28.92 26.590000000000003 20.36 30-34 23.94 27.860000000000003 27.42 20.78 35-39 23.885 27.01 27.650000000000002 21.455 40-44 24.165 28.015 27.055 20.765 45-49 23.895 28.515 27.045 20.544999999999998 50-54 24.16 28.075 27.015 20.75 55-59 24.095 27.88 27.26 20.765 60-64 23.93 27.58 27.655 20.835 65-69 24.0 27.295 27.48 21.224999999999998 70-74 24.665 27.655 26.815 20.865000000000002 75-79 24.085 27.345000000000002 27.189999999999998 21.38 80-84 23.875 28.32 26.805 21.0 85-89 23.94 27.805000000000003 27.015 21.240000000000002 90-94 24.265 27.63 27.0 21.105 95-99 24.265 27.175 27.57 20.990000000000002 100-104 24.335 28.125 26.245 21.295 105-109 23.715 28.02 27.29 20.974999999999998 110-114 23.855 28.075 27.644999999999996 20.424999999999997 115-119 24.605 27.3 27.48 20.615 120-124 25.15 27.63 26.955000000000002 20.265 125-129 24.685000000000002 27.145000000000003 27.315 20.855 130-134 25.765 27.12 26.965 20.150000000000002 135-139 24.935 27.405 27.150000000000002 20.51 140-144 24.27 28.194999999999997 27.07 20.465 145-149 24.975 27.589999999999996 26.729999999999997 20.705000000000002 150-151 24.975 28.15 27.212500000000002 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.0 24 2.5 25 3.0 26 2.5 27 3.0 28 6.5 29 6.5 30 7.0 31 11.5 32 20.5 33 30.0 34 35.0 35 54.0 36 73.5 37 92.0 38 121.0 39 151.5 40 178.0 41 208.5 42 233.0 43 239.5 44 260.5 45 282.0 46 265.5 47 252.5 48 237.5 49 219.5 50 200.0 51 154.0 52 134.5 53 122.0 54 89.5 55 71.0 56 58.5 57 42.5 58 32.5 59 29.0 60 21.5 61 13.0 62 7.5 63 4.0 64 2.5 65 0.0 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.43705083843493 88.7 2 4.950758583976577 9.3 3 0.4524886877828055 1.275 4 0.07985094490284801 0.3 5 0.053233963268565346 0.25 6 0.0 0.0 7 0.026616981634282673 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.8625 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.0 0.0 0.0 0.0 0.0 138-139 3.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGTC 10 0.006830828 145.0 3 TTGAGGC 10 0.006830828 145.0 5 >>END_MODULE Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra Read 997133 spots for SRR12161383.sra Written 997133 spots for SRR12161383.sra Read 997122 spots for SRR12161383.sra Written 997122 spots for SRR12161383.sra SRR ids: ['SRR12161383.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ji8lmin2 SRR12161383.sra spots: 19942451 blocks: [[1, 997122], [997123, 1994244], [1994245, 2991366], [2991367, 3988488], [3988489, 4985610], [4985611, 5982732], [5982733, 6979854], [6979855, 7976976], [7976977, 8974098], [8974099, 9971220], [9971221, 10968342], [10968343, 11965464], [11965465, 12962586], [12962587, 13959708], [13959709, 14956830], [14956831, 15953952], [15953953, 16951074], [16951075, 17948196], [17948197, 18945318], [18945319, 19942451]] SRR12161383 file size 6755616 SRR12161383 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161383 SRR12161383_1.fastq SRR12161383_2.fastq Input file: SRR12161383_1.fastq Paired file: SRR12161383_2.fastq trimmed: SRR12161383-trimmed-pair1.fastq, SRR12161383-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:06:58 2025 >> started Thu Feb 13 16:07:21 2025 >> done (22.758s) 19942451 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 6109 ( 0.03%) empty read pairs filtered out after trimming by size control 19936323 (99.97%) read pairs available; of these: 1234824 ( 6.19%) trimmed read pairs available after processing 18701499 (93.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 2 0.00% 21 8 0.00% 22 7 0.00% 23 7 0.00% 24 13 0.00% 25 10 0.00% 26 26 0.00% 27 9 0.00% 28 9 0.00% 29 10 0.00% 30 12 0.00% 31 13 0.00% 32 16 0.00% 33 12 0.00% 34 19 0.00% 35 11 0.00% 36 16 0.00% 37 14 0.00% 38 19 0.00% 39 16 0.00% 40 11 0.00% 41 18 0.00% 42 14 0.00% 43 17 0.00% 44 16 0.00% 45 12 0.00% 46 24 0.00% 47 17 0.00% 48 31 0.00% 49 39 0.00% 50 36 0.00% 51 37 0.00% 52 48 0.00% 53 38 0.00% 54 53 0.00% 55 60 0.00% 56 50 0.00% 57 63 0.00% 58 72 0.00% 59 94 0.00% 60 99 0.00% 61 96 0.00% 62 109 0.00% 63 102 0.00% 64 128 0.00% 65 140 0.00% 66 181 0.00% 67 188 0.00% 68 181 0.00% 69 252 0.00% 70 308 0.00% 71 316 0.00% 72 362 0.00% 73 399 0.00% 74 453 0.00% 75 502 0.00% 76 517 0.00% 77 605 0.00% 78 650 0.00% 79 722 0.00% 80 800 0.00% 81 974 0.00% 82 1149 0.01% 83 1243 0.01% 84 1357 0.01% 85 1658 0.01% 86 1732 0.01% 87 1896 0.01% 88 2165 0.01% 89 2399 0.01% 90 2575 0.01% 91 2886 0.01% 92 3153 0.02% 93 3517 0.02% 94 3919 0.02% 95 4234 0.02% 96 4507 0.02% 97 4798 0.02% 98 5140 0.03% 99 5405 0.03% 100 5892 0.03% 101 6322 0.03% 102 6879 0.03% 103 7235 0.04% 104 7743 0.04% 105 8467 0.04% 106 8942 0.04% 107 9389 0.05% 108 9717 0.05% 109 10392 0.05% 110 10914 0.05% 111 11257 0.06% 112 11808 0.06% 113 12408 0.06% 114 13143 0.07% 115 14090 0.07% 116 14946 0.07% 117 15793 0.08% 118 16133 0.08% 119 16874 0.08% 120 17268 0.09% 121 17828 0.09% 122 18789 0.09% 123 19561 0.10% 124 20562 0.10% 125 21183 0.11% 126 22207 0.11% 127 23209 0.12% 128 23741 0.12% 129 24697 0.12% 130 25587 0.13% 131 26336 0.13% 132 27205 0.14% 133 28294 0.14% 134 29287 0.15% 135 30344 0.15% 136 31409 0.16% 137 32231 0.16% 138 33338 0.17% 139 34447 0.17% 140 35265 0.18% 141 36182 0.18% 142 37262 0.19% 143 38431 0.19% 144 39679 0.20% 145 40655 0.20% 146 41405 0.21% 147 42866 0.22% 148 43970 0.22% 149 43994 0.22% 150 46426 0.23% 151 18701499 93.81% 19936323 reads passed initial QC criterion=sequence-density sequence-density=1.23 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=11 prefix-density=1.28 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=42.37 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=2.3 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCCATAGAAAGT criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=1.08 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=52.76 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.2 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR12161383 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:08:06 Started mapping on | Feb 13 16:08:06 Finished on | Feb 13 16:10:51 Mapping speed, Million of reads per hour | 434.97 Number of input reads | 19936323 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18704579 Uniquely mapped reads % | 93.82% Average mapped length | 298.37 Number of splices: Total | 17978317 Number of splices: Annotated (sjdb) | 17642405 Number of splices: GT/AG | 17609452 Number of splices: GC/AG | 301275 Number of splices: AT/AC | 22131 Number of splices: Non-canonical | 45459 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484628 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 121904 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 747116 747116 747116 N_multimapping 484628 484628 484628 N_noFeature 409911 18457265 468657 N_ambiguous 326026 1198 136717 UnstrandedReadsAssigned:17968642 PositiveStrandReadsAssigned:246116 NegativeStrandReadsAssigned:18099205 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161383 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161383-trimmed-pair1.fastq SRR12161383-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,936,323 reads, 18,178,187 reads pseudoaligned [quant] estimated average fragment length: 263.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR12161383.ke.tsv 34699 SRR12161383.se.tsv 87100 total ==> SRR12161383.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.94 324 7.1854 Potri.005G024800.1.v4.1 1035 772.935 224 11.2855 Potri.004G059700.1.v4.1 961 699.045 33 1.83833 Potri.007G009000.2.v4.1 1416 1153.94 0 0 Potri.003G141000.2.v4.1 2943 2680.94 364.205 5.29022 Potri.016G087400.1.v4.1 270 73.7299 1567 827.637 Potri.015G069301.1.v4.1 564 311.995 0 0 Potri.010G195200.1.v4.1 1773 1510.94 6 0.154639 Potri.012G127500.1.v4.1 977 714.985 2798 152.393 ==> SRR12161383.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR12161383 completed mapping pipeline successfully