Starting /dee2/code/volunteer_pipeline.sh SRR12161384 current disk space = 3087412584448 free memory = 1444436780 SRR12161384 SRAfilesize 2c4d6ff77e9e540100b0021103e58687 SRR12161384.sra SRR12161384.sra file validated SRR12161384 is paired end SRR12161384 is conventional basespace SRR12161384 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161384_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.54025 37.0 37.0 37.0 37.0 37.0 2 36.432 37.0 37.0 37.0 37.0 37.0 3 36.541 37.0 37.0 37.0 37.0 37.0 4 36.561 37.0 37.0 37.0 37.0 37.0 5 36.5465 37.0 37.0 37.0 37.0 37.0 6 36.589 37.0 37.0 37.0 37.0 37.0 7 36.55 37.0 37.0 37.0 37.0 37.0 8 36.5655 37.0 37.0 37.0 37.0 37.0 9 36.5805 37.0 37.0 37.0 37.0 37.0 10-14 36.582 37.0 37.0 37.0 37.0 37.0 15-19 36.5701 37.0 37.0 37.0 37.0 37.0 20-24 36.53849999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.509499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.457 37.0 37.0 37.0 37.0 37.0 35-39 36.4831 37.0 37.0 37.0 37.0 37.0 40-44 36.4193 37.0 37.0 37.0 37.0 37.0 45-49 36.4222 37.0 37.0 37.0 37.0 37.0 50-54 36.363800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.425 37.0 37.0 37.0 37.0 37.0 60-64 36.385799999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3731 37.0 37.0 37.0 37.0 37.0 70-74 36.36560000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.308299999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3683 37.0 37.0 37.0 37.0 37.0 85-89 36.26129999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.26780000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.2379 37.0 37.0 37.0 37.0 37.0 100-104 36.2484 37.0 37.0 37.0 37.0 37.0 105-109 36.1993 37.0 37.0 37.0 37.0 37.0 110-114 36.202 37.0 37.0 37.0 37.0 37.0 115-119 36.217200000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.18769999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.1464 37.0 37.0 37.0 37.0 37.0 130-134 36.05499999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.9955 37.0 37.0 37.0 37.0 37.0 140-144 35.981500000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.903000000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.74675 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 0.0 25 1.0 26 2.0 27 8.0 28 9.0 29 15.0 30 28.0 31 30.0 32 48.0 33 65.0 34 133.0 35 257.0 36 2985.0 37 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.7813360020015 11.908931698774081 5.804353264948712 40.505379034275705 2 18.575 12.925 37.05 31.45 3 15.925 16.1 27.800000000000004 40.175 4 20.1 23.325000000000003 24.75 31.825 5 21.475 29.849999999999998 23.599999999999998 25.074999999999996 6 20.75 32.800000000000004 24.025 22.425 7 16.25 26.950000000000003 39.025 17.775 8 16.975 28.1 30.675 24.25 9 16.175 24.5 35.5 23.825 10-14 19.155 29.9 27.169999999999998 23.775 15-19 19.57 27.68 27.55 25.2 20-24 20.1 27.994999999999997 27.32 24.585 25-29 20.119999999999997 27.794999999999998 27.54 24.545 30-34 19.900000000000002 28.42 26.695 24.985 35-39 19.885 28.335 27.375 24.404999999999998 40-44 19.98 28.415000000000003 26.840000000000003 24.765 45-49 20.57 28.244999999999997 27.02 24.165 50-54 20.195 28.175 26.790000000000003 24.84 55-59 20.035 28.015 26.875 25.074999999999996 60-64 19.555 28.125 27.24 25.080000000000002 65-69 19.945 28.155 26.939999999999998 24.959999999999997 70-74 20.255000000000003 27.705000000000002 27.425 24.615000000000002 75-79 20.285 27.32 27.105 25.290000000000003 80-84 20.150000000000002 27.755000000000003 26.91 25.185000000000002 85-89 19.855 27.66 27.48 25.005 90-94 20.385 27.71 26.96 24.945 95-99 20.715 27.200000000000003 27.305 24.779999999999998 100-104 20.515 27.905 26.605 24.975 105-109 20.044999999999998 27.644999999999996 27.345000000000002 24.965 110-114 21.075 27.195000000000004 26.939999999999998 24.79 115-119 20.69 27.439999999999998 27.235 24.635 120-124 21.095 27.255000000000003 26.945000000000004 24.705 125-129 20.62 27.500000000000004 26.775 25.105 130-134 21.18 27.675 26.590000000000003 24.555 135-139 21.6 27.060000000000002 26.919999999999998 24.42 140-144 21.36 26.93 27.24 24.47 145-149 21.555 27.05 26.66 24.735 150-151 21.65 26.2875 27.725 24.337500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 2.0 26 3.5 27 5.0 28 7.0 29 8.5 30 12.0 31 27.5 32 42.0 33 43.5 34 46.0 35 64.0 36 79.0 37 94.0 38 115.5 39 137.5 40 148.0 41 162.5 42 190.5 43 200.0 44 229.5 45 246.0 46 237.0 47 234.5 48 239.5 49 255.5 50 236.5 51 192.5 52 156.0 53 127.5 54 108.5 55 93.0 56 69.0 57 47.0 58 35.5 59 32.5 60 28.0 61 15.5 62 8.5 63 5.5 64 2.0 65 1.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.06441309555497 88.35 2 5.4564812350279475 10.25 3 0.42587170614852277 1.2 4 0.053233963268565346 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.6375 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.775 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.5375 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGCGA 10 0.006830828 145.0 1 >>END_MODULE SRR12161384 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161384_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.397 37.0 37.0 37.0 37.0 37.0 2 36.219 37.0 37.0 37.0 37.0 37.0 3 36.274 37.0 37.0 37.0 37.0 37.0 4 36.2545 37.0 37.0 37.0 37.0 37.0 5 36.3665 37.0 37.0 37.0 37.0 37.0 6 36.2355 37.0 37.0 37.0 37.0 37.0 7 36.196 37.0 37.0 37.0 37.0 37.0 8 36.394 37.0 37.0 37.0 37.0 37.0 9 36.3835 37.0 37.0 37.0 37.0 37.0 10-14 36.4063 37.0 37.0 37.0 37.0 37.0 15-19 36.320100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2983 37.0 37.0 37.0 37.0 37.0 25-29 36.2784 37.0 37.0 37.0 37.0 37.0 30-34 36.2883 37.0 37.0 37.0 37.0 37.0 35-39 36.2468 37.0 37.0 37.0 37.0 37.0 40-44 36.304500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.1706 37.0 37.0 37.0 37.0 37.0 50-54 36.218399999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.14970000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.1349 37.0 37.0 37.0 37.0 37.0 65-69 36.125 37.0 37.0 37.0 37.0 37.0 70-74 36.0347 37.0 37.0 37.0 37.0 37.0 75-79 35.9936 37.0 37.0 37.0 37.0 37.0 80-84 36.1066 37.0 37.0 37.0 37.0 37.0 85-89 36.0518 37.0 37.0 37.0 37.0 37.0 90-94 35.9947 37.0 37.0 37.0 37.0 37.0 95-99 36.0029 37.0 37.0 37.0 37.0 37.0 100-104 36.005700000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9445 37.0 37.0 37.0 37.0 37.0 110-114 35.927299999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.950900000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.883500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.8223 37.0 37.0 37.0 37.0 37.0 130-134 35.798 37.0 37.0 37.0 37.0 37.0 135-139 35.7728 37.0 37.0 37.0 37.0 37.0 140-144 35.726299999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.756 37.0 37.0 37.0 37.0 37.0 150-151 35.19625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 5.0 15 2.0 16 2.0 17 2.0 18 1.0 19 0.0 20 1.0 21 2.0 22 2.0 23 3.0 24 5.0 25 4.0 26 8.0 27 7.0 28 7.0 29 16.0 30 21.0 31 30.0 32 49.0 33 75.0 34 156.0 35 467.0 36 2829.0 37 306.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.3 27.825 8.075000000000001 26.8 2 27.825 28.275 28.925 14.975 3 20.325 27.950000000000003 32.7 19.025 4 22.675 33.45 24.275 19.6 5 23.425 36.75 21.55 18.275 6 21.15 39.525 22.15 17.175 7 21.725 22.55 36.125 19.6 8 22.875 25.575 26.5 25.05 9 23.150000000000002 23.35 29.475 24.025 10-14 23.56 29.79 24.965 21.685 15-19 23.535 28.22 26.840000000000003 21.404999999999998 20-24 23.815 28.215 26.334999999999997 21.634999999999998 25-29 23.745 27.48 27.595 21.18 30-34 23.474999999999998 27.805000000000003 26.68 22.040000000000003 35-39 23.18 28.249999999999996 26.224999999999998 22.345000000000002 40-44 23.505000000000003 27.944999999999997 26.884999999999998 21.665 45-49 23.549999999999997 27.91 26.72 21.82 50-54 23.96 27.865000000000002 26.275 21.9 55-59 23.974999999999998 26.884999999999998 27.3 21.84 60-64 24.565 26.61 26.97 21.855 65-69 24.285 28.155 26.27 21.29 70-74 24.065 27.665 26.265 22.005 75-79 24.095 27.839999999999996 26.58 21.485000000000003 80-84 24.575 27.98 25.515 21.93 85-89 24.11 27.02 26.950000000000003 21.92 90-94 24.3 27.445000000000004 26.36 21.895 95-99 24.779999999999998 27.61 26.755000000000003 20.855 100-104 24.45 27.21 26.99 21.349999999999998 105-109 25.374999999999996 27.11 26.625 20.89 110-114 25.165 27.67 26.224999999999998 20.94 115-119 24.84 27.265 26.515 21.38 120-124 24.94 27.095000000000002 27.375 20.59 125-129 25.11 27.825 26.07 20.995 130-134 24.735 27.975 26.77 20.52 135-139 24.709999999999997 27.41 26.72 21.16 140-144 25.46 26.88 26.640000000000004 21.02 145-149 25.915 27.065 26.365 20.655 150-151 25.8125 28.225 25.525 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 3.0 28 3.5 29 4.5 30 9.5 31 13.5 32 18.0 33 20.5 34 28.5 35 46.5 36 66.5 37 85.5 38 101.0 39 123.5 40 154.0 41 186.5 42 221.0 43 236.5 44 250.5 45 269.5 46 280.0 47 274.5 48 256.0 49 242.5 50 215.0 51 171.5 52 137.0 53 122.0 54 115.5 55 82.0 56 56.5 57 51.0 58 36.0 59 32.0 60 24.5 61 17.0 62 13.0 63 7.5 64 4.0 65 1.0 66 1.0 67 1.0 68 0.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.45 #Duplication Level Percentage of deduplicated Percentage of total 1 93.90048154093098 87.75 2 5.537720706260032 10.35 3 0.37453183520599254 1.05 4 0.1070090957731407 0.4 5 0.05350454788657035 0.25 6 0.0 0.0 7 0.0 0.0 8 0.026752273943285176 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATCACCAT 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit CATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.2375 0.0 0.0 0.0 0.0 122-123 1.3625 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.9749999999999999 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.25 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCGGT 10 0.006830828 145.0 8 AAAGGTG 10 0.006830828 145.0 5 TGCCACC 10 0.006830828 145.0 1 GCCACCG 10 0.006830828 145.0 2 TCCAAAG 10 0.006830828 145.0 2 >>END_MODULE Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658276 spots for SRR12161384.sra Written 658276 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra Read 658257 spots for SRR12161384.sra Written 658257 spots for SRR12161384.sra SRR ids: ['SRR12161384.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aqg5v0zp SRR12161384.sra spots: 13165159 blocks: [[1, 658257], [658258, 1316514], [1316515, 1974771], [1974772, 2633028], [2633029, 3291285], [3291286, 3949542], [3949543, 4607799], [4607800, 5266056], [5266057, 5924313], [5924314, 6582570], [6582571, 7240827], [7240828, 7899084], [7899085, 8557341], [8557342, 9215598], [9215599, 9873855], [9873856, 10532112], [10532113, 11190369], [11190370, 11848626], [11848627, 12506883], [12506884, 13165159]] SRR12161384 file size 4452396 SRR12161384 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161384 SRR12161384_1.fastq SRR12161384_2.fastq Input file: SRR12161384_1.fastq Paired file: SRR12161384_2.fastq trimmed: SRR12161384-trimmed-pair1.fastq, SRR12161384-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:44:54 2025 >> started Thu Feb 13 19:45:09 2025 >> done (14.586s) 13165159 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 4225 ( 0.03%) empty read pairs filtered out after trimming by size control 13160919 (99.97%) read pairs available; of these: 772601 ( 5.87%) trimmed read pairs available after processing 12388318 (94.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 0 0.00% 23 6 0.00% 24 6 0.00% 25 4 0.00% 26 5 0.00% 27 5 0.00% 28 6 0.00% 29 4 0.00% 30 13 0.00% 31 12 0.00% 32 9 0.00% 33 6 0.00% 34 11 0.00% 35 12 0.00% 36 8 0.00% 37 9 0.00% 38 15 0.00% 39 11 0.00% 40 7 0.00% 41 17 0.00% 42 16 0.00% 43 24 0.00% 44 9 0.00% 45 13 0.00% 46 15 0.00% 47 15 0.00% 48 18 0.00% 49 19 0.00% 50 21 0.00% 51 16 0.00% 52 30 0.00% 53 34 0.00% 54 28 0.00% 55 48 0.00% 56 38 0.00% 57 35 0.00% 58 48 0.00% 59 46 0.00% 60 66 0.00% 61 55 0.00% 62 76 0.00% 63 84 0.00% 64 100 0.00% 65 90 0.00% 66 104 0.00% 67 100 0.00% 68 122 0.00% 69 129 0.00% 70 168 0.00% 71 175 0.00% 72 243 0.00% 73 247 0.00% 74 275 0.00% 75 319 0.00% 76 342 0.00% 77 430 0.00% 78 398 0.00% 79 488 0.00% 80 535 0.00% 81 656 0.00% 82 731 0.01% 83 803 0.01% 84 959 0.01% 85 945 0.01% 86 1098 0.01% 87 1220 0.01% 88 1360 0.01% 89 1455 0.01% 90 1683 0.01% 91 1790 0.01% 92 1920 0.01% 93 2125 0.02% 94 2371 0.02% 95 2608 0.02% 96 2882 0.02% 97 3064 0.02% 98 3252 0.02% 99 3292 0.03% 100 3678 0.03% 101 3978 0.03% 102 4377 0.03% 103 4460 0.03% 104 4859 0.04% 105 5082 0.04% 106 5419 0.04% 107 5772 0.04% 108 6129 0.05% 109 6541 0.05% 110 6655 0.05% 111 6945 0.05% 112 7400 0.06% 113 7631 0.06% 114 8334 0.06% 115 8719 0.07% 116 9218 0.07% 117 9652 0.07% 118 9967 0.08% 119 10383 0.08% 120 11091 0.08% 121 11459 0.09% 122 11781 0.09% 123 12249 0.09% 124 12815 0.10% 125 13236 0.10% 126 13917 0.11% 127 14381 0.11% 128 14761 0.11% 129 15315 0.12% 130 16286 0.12% 131 16238 0.12% 132 16938 0.13% 133 17694 0.13% 134 18466 0.14% 135 18589 0.14% 136 19473 0.15% 137 20081 0.15% 138 20350 0.15% 139 21631 0.16% 140 21699 0.16% 141 22635 0.17% 142 23447 0.18% 143 23862 0.18% 144 24584 0.19% 145 25315 0.19% 146 26040 0.20% 147 27195 0.21% 148 28162 0.21% 149 28459 0.22% 150 29845 0.23% 151 12388318 94.13% 13160919 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=30 prefix-density=0.93 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=139.12 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=7.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.64 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=29 prefix-density=1.62 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=39.93 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.5 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12161384 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:45:50 Started mapping on | Feb 13 19:45:50 Finished on | Feb 13 19:47:01 Mapping speed, Million of reads per hour | 667.31 Number of input reads | 13160919 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12464742 Uniquely mapped reads % | 94.71% Average mapped length | 298.57 Number of splices: Total | 11463527 Number of splices: Annotated (sjdb) | 11267509 Number of splices: GT/AG | 11224510 Number of splices: GC/AG | 188339 Number of splices: AT/AC | 13929 Number of splices: Non-canonical | 36749 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324682 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 152801 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 371495 371495 371495 N_multimapping 324682 324682 324682 N_noFeature 290757 12212883 338932 N_ambiguous 290954 639 86880 UnstrandedReadsAssigned:11883031 PositiveStrandReadsAssigned:251220 NegativeStrandReadsAssigned:12038930 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161384 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161384-trimmed-pair1.fastq SRR12161384-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,160,919 reads, 12,017,569 reads pseudoaligned [quant] estimated average fragment length: 263.874 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,002 rounds 52401 SRR12161384.ke.tsv 34699 SRR12161384.se.tsv 87100 total ==> SRR12161384.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.13 256 7.07832 Potri.005G024800.1.v4.1 1035 772.126 213 13.3872 Potri.004G059700.1.v4.1 961 698.197 99 6.88107 Potri.007G009000.2.v4.1 1416 1153.13 0 0 Potri.003G141000.2.v4.1 2943 2680.13 253 4.58104 Potri.016G087400.1.v4.1 270 71.8526 816 551.12 Potri.015G069301.1.v4.1 564 310.837 0 0 Potri.010G195200.1.v4.1 1773 1510.13 2 0.064271 Potri.012G127500.1.v4.1 977 714.176 186 12.6388 ==> SRR12161384.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 59 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 147 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR12161384 completed mapping pipeline successfully