Starting /dee2/code/volunteer_pipeline.sh SRR12161385 current disk space = 3087421255680 free memory = 1477099892 SRR12161385 SRAfilesize 843b7e703dc00f79b5af1dfe38608a5a SRR12161385.sra SRR12161385.sra file validated SRR12161385 is paired end SRR12161385 is conventional basespace SRR12161385 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161385_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59225 37.0 37.0 37.0 37.0 37.0 2 36.4735 37.0 37.0 37.0 37.0 37.0 3 36.5815 37.0 37.0 37.0 37.0 37.0 4 36.5665 37.0 37.0 37.0 37.0 37.0 5 36.632 37.0 37.0 37.0 37.0 37.0 6 36.5735 37.0 37.0 37.0 37.0 37.0 7 36.4865 37.0 37.0 37.0 37.0 37.0 8 36.532 37.0 37.0 37.0 37.0 37.0 9 36.5845 37.0 37.0 37.0 37.0 37.0 10-14 36.5351 37.0 37.0 37.0 37.0 37.0 15-19 36.553999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5173 37.0 37.0 37.0 37.0 37.0 25-29 36.4653 37.0 37.0 37.0 37.0 37.0 30-34 36.4544 37.0 37.0 37.0 37.0 37.0 35-39 36.472 37.0 37.0 37.0 37.0 37.0 40-44 36.4292 37.0 37.0 37.0 37.0 37.0 45-49 36.4425 37.0 37.0 37.0 37.0 37.0 50-54 36.4064 37.0 37.0 37.0 37.0 37.0 55-59 36.3021 37.0 37.0 37.0 37.0 37.0 60-64 36.349000000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3092 37.0 37.0 37.0 37.0 37.0 70-74 36.302099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.2949 37.0 37.0 37.0 37.0 37.0 80-84 36.3057 37.0 37.0 37.0 37.0 37.0 85-89 36.2552 37.0 37.0 37.0 37.0 37.0 90-94 36.327999999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2581 37.0 37.0 37.0 37.0 37.0 100-104 36.2374 37.0 37.0 37.0 37.0 37.0 105-109 36.1836 37.0 37.0 37.0 37.0 37.0 110-114 36.1567 37.0 37.0 37.0 37.0 37.0 115-119 36.1441 37.0 37.0 37.0 37.0 37.0 120-124 36.101299999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0837 37.0 37.0 37.0 37.0 37.0 130-134 36.078500000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.005 37.0 37.0 37.0 37.0 37.0 140-144 35.9486 37.0 37.0 37.0 37.0 37.0 145-149 35.981899999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.7525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 1.0 26 3.0 27 13.0 28 15.0 29 19.0 30 25.0 31 33.0 32 38.0 33 70.0 34 102.0 35 300.0 36 2938.0 37 441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.0112528132033 12.378094523630907 5.901475368842211 36.70917729432358 2 20.125 11.825 32.45 35.6 3 16.25 16.725 28.375 38.65 4 20.349999999999998 26.224999999999998 24.025 29.4 5 22.15 30.599999999999998 25.674999999999997 21.575 6 21.525 34.1 24.25 20.125 7 15.875 27.224999999999998 39.25 17.65 8 17.45 25.874999999999996 31.25 25.424999999999997 9 17.150000000000002 24.525 33.7 24.625 10-14 19.325 30.44 26.805 23.43 15-19 19.134999999999998 28.515 28.084999999999997 24.265 20-24 19.735 27.775 28.605000000000004 23.885 25-29 20.200000000000003 28.33 28.075 23.395 30-34 20.355 28.345 27.295 24.005000000000003 35-39 20.285 28.02 27.565 24.13 40-44 20.424999999999997 28.03 27.66 23.885 45-49 20.369999999999997 27.725 27.750000000000004 24.154999999999998 50-54 20.505000000000003 27.634999999999998 27.625 24.235 55-59 19.439999999999998 28.599999999999998 27.73 24.23 60-64 20.630000000000003 27.900000000000002 27.765 23.705000000000002 65-69 20.09 27.700000000000003 28.28 23.93 70-74 20.419999999999998 28.225 27.255000000000003 24.099999999999998 75-79 19.8 27.85 27.875 24.474999999999998 80-84 20.165 27.935 27.36 24.54 85-89 20.51 28.349999999999998 26.955000000000002 24.185000000000002 90-94 20.645 28.244999999999997 27.29 23.82 95-99 20.474999999999998 27.88 27.889999999999997 23.755000000000003 100-104 20.674999999999997 28.04 27.0 24.285 105-109 20.724999999999998 28.26 27.29 23.724999999999998 110-114 20.91 28.110000000000003 27.22 23.76 115-119 20.835 27.905 27.97 23.29 120-124 21.0 27.905 27.12 23.974999999999998 125-129 21.065 27.93 27.395000000000003 23.61 130-134 21.32 27.845 27.339999999999996 23.494999999999997 135-139 20.72 28.244999999999997 27.375 23.66 140-144 20.94 27.6 26.924999999999997 24.535 145-149 20.985 27.32 27.505000000000003 24.19 150-151 20.724999999999998 26.325 28.050000000000004 24.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 3.5 26 7.0 27 7.0 28 7.0 29 11.5 30 16.5 31 27.0 32 34.5 33 43.0 34 57.0 35 71.0 36 82.5 37 89.0 38 113.5 39 145.0 40 180.5 41 207.0 42 220.5 43 226.5 44 233.5 45 239.5 46 245.0 47 254.5 48 250.0 49 236.0 50 209.5 51 165.0 52 121.5 53 99.5 54 92.0 55 80.5 56 58.5 57 47.0 58 35.5 59 23.5 60 17.0 61 9.0 62 6.0 63 6.0 64 3.0 65 2.0 66 1.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.64825193488124 87.725 2 5.978115825994128 11.200000000000001 3 0.3469442220443021 0.975 4 0.02668801708033093 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.2625 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.7000000000000002 0.0 0.0 0.0 0.0 136-137 1.8624999999999998 0.0 0.0 0.0 0.0 138-139 2.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGAAT 10 0.006830828 145.0 6 >>END_MODULE SRR12161385 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161385_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.256 37.0 37.0 37.0 37.0 37.0 2 35.912 37.0 37.0 37.0 37.0 37.0 3 35.9965 37.0 37.0 37.0 37.0 37.0 4 36.022 37.0 37.0 37.0 37.0 37.0 5 36.1355 37.0 37.0 37.0 37.0 37.0 6 36.038 37.0 37.0 37.0 37.0 37.0 7 36.0485 37.0 37.0 37.0 37.0 37.0 8 36.1395 37.0 37.0 37.0 37.0 37.0 9 36.0715 37.0 37.0 37.0 37.0 37.0 10-14 36.1367 37.0 37.0 37.0 37.0 37.0 15-19 36.134 37.0 37.0 37.0 37.0 37.0 20-24 36.065099999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.969300000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.9841 37.0 37.0 37.0 37.0 37.0 35-39 35.9992 37.0 37.0 37.0 37.0 37.0 40-44 35.9653 37.0 37.0 37.0 37.0 37.0 45-49 35.9022 37.0 37.0 37.0 37.0 37.0 50-54 35.88510000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.8755 37.0 37.0 37.0 37.0 37.0 60-64 35.8515 37.0 37.0 37.0 37.0 37.0 65-69 35.8382 37.0 37.0 37.0 37.0 37.0 70-74 35.7653 37.0 37.0 37.0 37.0 37.0 75-79 35.735400000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.79 37.0 37.0 37.0 37.0 37.0 85-89 35.739799999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.677800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.7238 37.0 37.0 37.0 37.0 37.0 100-104 35.733799999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.64710000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.6991 37.0 37.0 37.0 37.0 37.0 115-119 35.6287 37.0 37.0 37.0 37.0 37.0 120-124 35.6819 37.0 37.0 37.0 37.0 37.0 125-129 35.539699999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.4952 37.0 37.0 37.0 37.0 37.0 135-139 35.482600000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.5139 37.0 37.0 37.0 37.0 37.0 145-149 35.4741 37.0 37.0 37.0 37.0 37.0 150-151 35.06375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 12.0 14 3.0 15 4.0 16 1.0 17 1.0 18 0.0 19 0.0 20 3.0 21 7.0 22 9.0 23 6.0 24 2.0 25 8.0 26 10.0 27 8.0 28 22.0 29 24.0 30 25.0 31 41.0 32 60.0 33 85.0 34 207.0 35 541.0 36 2697.0 37 224.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.3 26.424999999999997 8.875 23.400000000000002 2 28.349999999999998 27.725 27.650000000000002 16.275000000000002 3 21.15 28.025 31.4 19.425 4 22.325 35.35 24.25 18.075 5 24.625 36.449999999999996 21.375 17.549999999999997 6 21.5 38.725 20.95 18.825 7 20.549999999999997 23.35 37.925 18.175 8 21.25 27.224999999999998 27.150000000000002 24.375 9 22.95 25.45 28.825 22.775000000000002 10-14 23.235 29.635 26.290000000000003 20.84 15-19 23.150000000000002 28.28 27.384999999999998 21.185000000000002 20-24 23.325000000000003 28.33 27.700000000000003 20.645 25-29 22.805 28.470000000000002 27.544999999999998 21.18 30-34 22.73 28.134999999999998 27.605 21.529999999999998 35-39 22.905 27.49 27.894999999999996 21.709999999999997 40-44 22.625 27.860000000000003 27.845 21.67 45-49 23.595 28.37 27.21 20.825 50-54 23.13 27.950000000000003 27.045 21.875 55-59 23.47 27.565 27.62 21.345 60-64 23.01 28.044999999999998 27.51 21.435000000000002 65-69 23.7 27.529999999999998 27.650000000000002 21.12 70-74 23.1 27.589999999999996 27.35 21.959999999999997 75-79 23.155 27.91 27.700000000000003 21.235 80-84 23.990000000000002 27.495000000000005 26.995 21.52 85-89 23.265 27.42 27.865000000000002 21.45 90-94 23.62 27.060000000000002 27.439999999999998 21.88 95-99 22.97 28.355000000000004 27.405 21.27 100-104 23.810000000000002 27.215 27.384999999999998 21.59 105-109 23.45 27.650000000000002 27.875 21.025 110-114 24.03 28.360000000000003 27.265 20.345 115-119 23.599999999999998 27.62 27.345000000000002 21.435000000000002 120-124 23.990000000000002 27.83 27.1 21.08 125-129 23.66 28.595 26.745 21.0 130-134 23.86 28.115000000000002 27.375 20.65 135-139 24.560000000000002 27.22 27.3 20.919999999999998 140-144 24.205 28.13 26.86 20.805 145-149 24.415 27.74 27.175 20.669999999999998 150-151 24.9875 28.0875 26.75 20.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.5 24 3.5 25 5.0 26 3.5 27 3.0 28 9.0 29 15.5 30 16.5 31 20.5 32 27.0 33 39.5 34 48.0 35 57.5 36 77.0 37 90.5 38 119.5 39 152.0 40 193.0 41 217.5 42 243.5 43 271.0 44 274.5 45 265.0 46 251.0 47 239.5 48 217.0 49 199.0 50 182.0 51 153.5 52 114.5 53 94.5 54 92.5 55 78.5 56 52.5 57 37.0 58 26.0 59 21.0 60 16.0 61 10.5 62 10.5 63 10.0 64 6.0 65 3.5 66 2.0 67 0.5 68 0.5 69 1.5 70 1.5 71 1.0 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.5 87 2.0 88 1.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.08157824580113 88.225 2 5.438549720074646 10.2 3 0.37323380431884834 1.05 4 0.053319114902692616 0.2 5 0.026659557451346308 0.125 6 0.0 0.0 7 0.0 0.0 8 0.026659557451346308 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.7000000000000002 0.0 0.0 0.0 0.0 136-137 1.8624999999999998 0.0 0.0 0.0 0.0 138-139 2.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAC 10 0.006830828 145.0 9 CACATTC 10 0.006830828 145.0 5 AGAACAC 10 0.006830828 145.0 1 GAACACA 10 0.006830828 145.0 2 ATTCATA 10 0.006830828 145.0 8 >>END_MODULE Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650511 spots for SRR12161385.sra Written 650511 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra Read 650508 spots for SRR12161385.sra Written 650508 spots for SRR12161385.sra SRR ids: ['SRR12161385.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dyggfytz SRR12161385.sra spots: 13010163 blocks: [[1, 650508], [650509, 1301016], [1301017, 1951524], [1951525, 2602032], [2602033, 3252540], [3252541, 3903048], [3903049, 4553556], [4553557, 5204064], [5204065, 5854572], [5854573, 6505080], [6505081, 7155588], [7155589, 7806096], [7806097, 8456604], [8456605, 9107112], [9107113, 9757620], [9757621, 10408128], [10408129, 11058636], [11058637, 11709144], [11709145, 12359652], [12359653, 13010163]] SRR12161385 file size 4399722 SRR12161385 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161385 SRR12161385_1.fastq SRR12161385_2.fastq Input file: SRR12161385_1.fastq Paired file: SRR12161385_2.fastq trimmed: SRR12161385-trimmed-pair1.fastq, SRR12161385-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:45:14 2025 >> started Thu Feb 13 19:45:27 2025 >> done (13.411s) 13010163 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 1839 ( 0.01%) empty read pairs filtered out after trimming by size control 13008312 (99.99%) read pairs available; of these: 556271 ( 4.28%) trimmed read pairs available after processing 12452041 (95.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 6 0.00% 22 3 0.00% 23 8 0.00% 24 6 0.00% 25 7 0.00% 26 9 0.00% 27 4 0.00% 28 8 0.00% 29 4 0.00% 30 6 0.00% 31 14 0.00% 32 8 0.00% 33 10 0.00% 34 4 0.00% 35 11 0.00% 36 16 0.00% 37 11 0.00% 38 6 0.00% 39 11 0.00% 40 19 0.00% 41 5 0.00% 42 9 0.00% 43 9 0.00% 44 12 0.00% 45 13 0.00% 46 13 0.00% 47 16 0.00% 48 8 0.00% 49 18 0.00% 50 16 0.00% 51 13 0.00% 52 21 0.00% 53 16 0.00% 54 18 0.00% 55 24 0.00% 56 16 0.00% 57 26 0.00% 58 24 0.00% 59 38 0.00% 60 40 0.00% 61 38 0.00% 62 73 0.00% 63 81 0.00% 64 62 0.00% 65 61 0.00% 66 72 0.00% 67 75 0.00% 68 82 0.00% 69 87 0.00% 70 104 0.00% 71 115 0.00% 72 136 0.00% 73 140 0.00% 74 166 0.00% 75 203 0.00% 76 195 0.00% 77 254 0.00% 78 261 0.00% 79 310 0.00% 80 325 0.00% 81 384 0.00% 82 439 0.00% 83 421 0.00% 84 531 0.00% 85 600 0.00% 86 662 0.01% 87 651 0.01% 88 725 0.01% 89 851 0.01% 90 938 0.01% 91 1027 0.01% 92 1116 0.01% 93 1360 0.01% 94 1390 0.01% 95 1625 0.01% 96 1729 0.01% 97 1897 0.01% 98 2009 0.02% 99 2167 0.02% 100 2329 0.02% 101 2419 0.02% 102 2661 0.02% 103 2877 0.02% 104 3109 0.02% 105 3325 0.03% 106 3594 0.03% 107 3849 0.03% 108 3876 0.03% 109 4084 0.03% 110 4393 0.03% 111 4544 0.03% 112 5011 0.04% 113 5255 0.04% 114 5723 0.04% 115 5801 0.04% 116 6194 0.05% 117 6627 0.05% 118 6688 0.05% 119 7020 0.05% 120 7336 0.06% 121 7761 0.06% 122 7842 0.06% 123 8660 0.07% 124 9075 0.07% 125 9477 0.07% 126 9859 0.08% 127 10310 0.08% 128 10599 0.08% 129 11001 0.08% 130 11357 0.09% 131 11794 0.09% 132 12336 0.09% 133 12962 0.10% 134 13427 0.10% 135 13832 0.11% 136 14309 0.11% 137 14574 0.11% 138 15214 0.12% 139 15964 0.12% 140 16398 0.13% 141 16701 0.13% 142 17557 0.13% 143 18106 0.14% 144 19140 0.15% 145 20159 0.15% 146 20399 0.16% 147 20491 0.16% 148 21624 0.17% 149 21714 0.17% 150 23018 0.18% 151 12452041 95.72% 13008312 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.18 sequence-density-rank=18 fanout-score=21.99 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=8.0 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=25 prefix-density=0.51 prefix-fanout=2.2 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=62.63 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12161385 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:46:08 Started mapping on | Feb 13 19:46:08 Finished on | Feb 13 19:47:45 Mapping speed, Million of reads per hour | 482.78 Number of input reads | 13008312 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12084839 Uniquely mapped reads % | 92.90% Average mapped length | 299.07 Number of splices: Total | 12195407 Number of splices: Annotated (sjdb) | 11927844 Number of splices: GT/AG | 11954745 Number of splices: GC/AG | 194712 Number of splices: AT/AC | 8753 Number of splices: Non-canonical | 37197 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295086 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 101570 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.82% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 628387 628387 628387 N_multimapping 295086 295086 295086 N_noFeature 419090 11906148 465862 N_ambiguous 213975 957 81453 UnstrandedReadsAssigned:11451774 PositiveStrandReadsAssigned:177734 NegativeStrandReadsAssigned:11537524 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161385 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161385-trimmed-pair1.fastq SRR12161385-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,008,312 reads, 11,569,422 reads pseudoaligned [quant] estimated average fragment length: 274.73 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR12161385.ke.tsv 34699 SRR12161385.se.tsv 87100 total ==> SRR12161385.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.27 306 11.1807 Potri.005G024800.1.v4.1 1035 761.27 172 14.3996 Potri.004G059700.1.v4.1 961 687.379 24 2.22523 Potri.007G009000.2.v4.1 1416 1142.27 0 0 Potri.003G141000.2.v4.1 2943 2669.27 451.904 10.7898 Potri.016G087400.1.v4.1 270 67.8078 692.571 650.946 Potri.015G069301.1.v4.1 564 303.121 0 0 Potri.010G195200.1.v4.1 1773 1499.27 18 0.765162 Potri.012G127500.1.v4.1 977 703.305 200 18.1237 ==> SRR12161385.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 175 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 187 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12161385 completed mapping pipeline successfully