Starting /dee2/code/volunteer_pipeline.sh SRR12161386 current disk space = 3087401730048 free memory = 1449209952 SRR12161386 SRAfilesize 0e4b0d19502972ce8c2c6d4089cb9ffe SRR12161386.sra SRR12161386.sra file validated SRR12161386 is paired end SRR12161386 is conventional basespace SRR12161386 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161386_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.56075 37.0 37.0 37.0 37.0 37.0 2 36.397 37.0 37.0 37.0 37.0 37.0 3 36.4625 37.0 37.0 37.0 37.0 37.0 4 36.612 37.0 37.0 37.0 37.0 37.0 5 36.652 37.0 37.0 37.0 37.0 37.0 6 36.49 37.0 37.0 37.0 37.0 37.0 7 36.5155 37.0 37.0 37.0 37.0 37.0 8 36.502 37.0 37.0 37.0 37.0 37.0 9 36.448 37.0 37.0 37.0 37.0 37.0 10-14 36.5628 37.0 37.0 37.0 37.0 37.0 15-19 36.5612 37.0 37.0 37.0 37.0 37.0 20-24 36.493700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.446400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.422200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.408 37.0 37.0 37.0 37.0 37.0 40-44 36.3949 37.0 37.0 37.0 37.0 37.0 45-49 36.386100000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3192 37.0 37.0 37.0 37.0 37.0 55-59 36.3587 37.0 37.0 37.0 37.0 37.0 60-64 36.32940000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.283500000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.2962 37.0 37.0 37.0 37.0 37.0 75-79 36.2919 37.0 37.0 37.0 37.0 37.0 80-84 36.2963 37.0 37.0 37.0 37.0 37.0 85-89 36.2063 37.0 37.0 37.0 37.0 37.0 90-94 36.2173 37.0 37.0 37.0 37.0 37.0 95-99 36.1831 37.0 37.0 37.0 37.0 37.0 100-104 36.184000000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1577 37.0 37.0 37.0 37.0 37.0 110-114 36.1507 37.0 37.0 37.0 37.0 37.0 115-119 36.114999999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.056 37.0 37.0 37.0 37.0 37.0 125-129 36.061 37.0 37.0 37.0 37.0 37.0 130-134 36.0264 37.0 37.0 37.0 37.0 37.0 135-139 35.949799999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8866 37.0 37.0 37.0 37.0 37.0 145-149 35.898900000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.69725 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 3.0 26 9.0 27 6.0 28 10.0 29 21.0 30 26.0 31 31.0 32 54.0 33 80.0 34 129.0 35 279.0 36 2921.0 37 427.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.485371342835705 13.378344586146538 5.701425356339085 39.434858714678676 2 19.75 12.425 35.949999999999996 31.874999999999996 3 16.075 16.225 28.199999999999996 39.5 4 21.4 24.675 23.549999999999997 30.375000000000004 5 23.35 30.349999999999998 24.45 21.85 6 21.55 34.825 22.725 20.9 7 15.975 26.700000000000003 39.300000000000004 18.025 8 16.75 27.825 30.875000000000004 24.55 9 16.45 24.3 35.9 23.35 10-14 20.085 29.549999999999997 27.165 23.200000000000003 15-19 20.044999999999998 27.72 28.1 24.135 20-24 20.035 28.48 27.525 23.96 25-29 20.349999999999998 28.615000000000002 27.52 23.515 30-34 20.150000000000002 28.694999999999997 27.435 23.72 35-39 20.150000000000002 28.53 26.68 24.64 40-44 20.515 29.18 26.68 23.625 45-49 20.195 28.470000000000002 26.884999999999998 24.45 50-54 20.845 28.110000000000003 27.185 23.86 55-59 20.294999999999998 28.51 27.224999999999998 23.97 60-64 20.41 28.325 27.055 24.21 65-69 20.16 28.15 27.55 24.14 70-74 20.645 27.99 27.200000000000003 24.165 75-79 20.585 28.515 26.884999999999998 24.015 80-84 20.294999999999998 28.305000000000003 26.924999999999997 24.474999999999998 85-89 20.105 27.625 28.189999999999998 24.08 90-94 20.805 27.589999999999996 27.18 24.425 95-99 20.875 28.22 26.729999999999997 24.175 100-104 20.885 28.92 26.39 23.805 105-109 21.095 27.565 27.01 24.33 110-114 21.11 27.705000000000002 26.810000000000002 24.375 115-119 21.45 27.700000000000003 26.915 23.935000000000002 120-124 21.01 27.85 26.924999999999997 24.215 125-129 21.04 27.779999999999998 27.43 23.75 130-134 21.87 27.779999999999998 26.490000000000002 23.86 135-139 21.91 27.939999999999998 26.505000000000003 23.645 140-144 21.795 27.775 26.87 23.56 145-149 21.775 27.939999999999998 26.51 23.775 150-151 20.7875 28.875 26.2625 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 3.5 26 5.5 27 6.0 28 7.5 29 9.0 30 12.0 31 18.5 32 31.5 33 40.0 34 56.0 35 68.0 36 71.0 37 88.5 38 109.0 39 147.5 40 178.5 41 189.0 42 208.5 43 244.0 44 263.5 45 259.0 46 272.0 47 259.5 48 226.5 49 222.0 50 205.0 51 158.0 52 119.5 53 112.0 54 99.0 55 67.5 56 53.5 57 53.0 58 40.0 59 28.0 60 22.0 61 14.5 62 9.5 63 5.0 64 3.0 65 1.5 66 0.5 67 1.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12858660998937 88.575 2 5.499468650371945 10.35 3 0.34537725823591925 0.975 4 0.026567481402763018 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.725 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.5 0.0 0.0 0.0 0.0 130-131 3.8375000000000004 0.0 0.0 0.0 0.0 132-133 4.125 0.0 0.0 0.0 0.0 134-135 4.45 0.0 0.0 0.0 0.0 136-137 4.85 0.0 0.0 0.0 0.0 138-139 5.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACAAT 10 0.006830828 145.0 9 GACAAAT 10 0.006830828 145.0 1 CAAATTA 10 0.006830828 145.0 3 >>END_MODULE SRR12161386 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161386_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.308 37.0 37.0 37.0 37.0 37.0 2 36.0515 37.0 37.0 37.0 37.0 37.0 3 36.022 37.0 37.0 37.0 37.0 37.0 4 36.0595 37.0 37.0 37.0 37.0 37.0 5 36.233 37.0 37.0 37.0 37.0 37.0 6 36.2475 37.0 37.0 37.0 37.0 37.0 7 36.1805 37.0 37.0 37.0 37.0 37.0 8 36.2105 37.0 37.0 37.0 37.0 37.0 9 36.1855 37.0 37.0 37.0 37.0 37.0 10-14 36.2222 37.0 37.0 37.0 37.0 37.0 15-19 36.197500000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.139700000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1211 37.0 37.0 37.0 37.0 37.0 30-34 36.0381 37.0 37.0 37.0 37.0 37.0 35-39 36.0574 37.0 37.0 37.0 37.0 37.0 40-44 36.0886 37.0 37.0 37.0 37.0 37.0 45-49 35.9804 37.0 37.0 37.0 37.0 37.0 50-54 36.0028 37.0 37.0 37.0 37.0 37.0 55-59 36.0492 37.0 37.0 37.0 37.0 37.0 60-64 35.9803 37.0 37.0 37.0 37.0 37.0 65-69 35.9579 37.0 37.0 37.0 37.0 37.0 70-74 35.8483 37.0 37.0 37.0 37.0 37.0 75-79 35.8563 37.0 37.0 37.0 37.0 37.0 80-84 35.9294 37.0 37.0 37.0 37.0 37.0 85-89 35.803700000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.808299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7823 37.0 37.0 37.0 37.0 37.0 100-104 35.7778 37.0 37.0 37.0 37.0 37.0 105-109 35.79700000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.76519999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.747 37.0 37.0 37.0 37.0 37.0 120-124 35.699 37.0 37.0 37.0 37.0 37.0 125-129 35.5473 37.0 37.0 37.0 37.0 37.0 130-134 35.4568 37.0 37.0 37.0 37.0 37.0 135-139 35.5226 37.0 37.0 37.0 37.0 37.0 140-144 35.4063 37.0 37.0 37.0 37.0 37.0 145-149 35.3878 37.0 37.0 37.0 37.0 37.0 150-151 34.83475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 3.0 15 2.0 16 1.0 17 0.0 18 2.0 19 1.0 20 2.0 21 2.0 22 4.0 23 5.0 24 7.0 25 9.0 26 10.0 27 9.0 28 11.0 29 20.0 30 34.0 31 34.0 32 55.0 33 118.0 34 213.0 35 529.0 36 2695.0 37 229.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.925 25.4 8.575000000000001 27.1 2 27.05 26.674999999999997 30.3 15.975 3 19.6 28.025 32.05 20.325 4 22.2 35.4 24.0 18.4 5 25.074999999999996 36.55 22.225 16.150000000000002 6 20.575 38.525 22.900000000000002 18.0 7 21.975 22.475 36.4 19.15 8 20.5 27.224999999999998 27.775 24.5 9 21.5 24.125 29.4 24.975 10-14 23.419999999999998 29.509999999999998 25.585 21.485000000000003 15-19 22.575 28.585 27.235 21.605 20-24 23.275000000000002 28.075 27.295 21.355 25-29 23.29 27.76 27.275 21.675 30-34 22.895 28.435 26.91 21.759999999999998 35-39 22.58 28.15 28.175 21.095 40-44 22.759999999999998 28.294999999999998 27.224999999999998 21.72 45-49 23.27 27.615000000000002 27.6 21.515 50-54 23.075000000000003 27.265 27.85 21.81 55-59 23.549999999999997 26.69 27.72 22.040000000000003 60-64 23.76 27.215 27.57 21.455 65-69 23.39 27.57 27.375 21.665 70-74 23.87 27.560000000000002 26.61 21.959999999999997 75-79 22.919999999999998 27.474999999999998 27.665 21.94 80-84 23.28 28.22 27.084999999999997 21.415 85-89 23.025000000000002 27.944999999999997 27.025 22.005 90-94 23.41 27.334999999999997 27.24 22.015 95-99 23.775 27.32 27.265 21.64 100-104 23.615 27.810000000000002 27.189999999999998 21.385 105-109 23.915 27.139999999999997 27.625 21.32 110-114 23.13 28.09 27.16 21.62 115-119 23.799999999999997 27.994999999999997 27.139999999999997 21.065 120-124 23.935000000000002 27.42 27.58 21.065 125-129 24.709999999999997 28.16 26.165 20.965 130-134 24.104999999999997 28.01 27.02 20.865000000000002 135-139 24.73 26.705000000000002 27.655 20.91 140-144 24.87 27.49 27.16 20.48 145-149 25.055 27.275 26.889999999999997 20.78 150-151 25.2875 27.5875 26.337500000000002 20.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.5 21 2.0 22 2.0 23 3.5 24 3.0 25 4.0 26 5.5 27 6.0 28 5.5 29 5.0 30 10.0 31 12.5 32 22.5 33 33.0 34 34.0 35 50.5 36 75.5 37 100.5 38 134.5 39 157.0 40 180.0 41 206.0 42 231.0 43 252.0 44 263.5 45 259.0 46 261.0 47 264.0 48 244.5 49 207.0 50 168.0 51 148.5 52 124.5 53 105.0 54 96.0 55 76.5 56 62.0 57 52.0 58 36.0 59 31.0 60 17.0 61 8.5 62 9.0 63 8.0 64 6.5 65 1.5 66 0.0 67 0.0 68 1.0 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 94.16777629826898 88.4 2 5.326231691078561 10.0 3 0.37283621837549935 1.05 4 0.07989347536617843 0.3 5 0.05326231691078562 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.4749999999999996 0.0 0.0 0.0 0.0 122-123 2.775 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.8875 0.0 0.0 0.0 0.0 132-133 4.2 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 4.9375 0.0 0.0 0.0 0.0 138-139 5.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAAAG 10 0.006830828 145.0 9 GTTTTTA 10 0.006830828 145.0 1 GATTCAA 10 0.006830828 145.0 5 >>END_MODULE Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717542 spots for SRR12161386.sra Written 717542 spots for SRR12161386.sra Read 717553 spots for SRR12161386.sra Written 717553 spots for SRR12161386.sra SRR ids: ['SRR12161386.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_moea99yh SRR12161386.sra spots: 14350851 blocks: [[1, 717542], [717543, 1435084], [1435085, 2152626], [2152627, 2870168], [2870169, 3587710], [3587711, 4305252], [4305253, 5022794], [5022795, 5740336], [5740337, 6457878], [6457879, 7175420], [7175421, 7892962], [7892963, 8610504], [8610505, 9328046], [9328047, 10045588], [10045589, 10763130], [10763131, 11480672], [11480673, 12198214], [12198215, 12915756], [12915757, 13633298], [13633299, 14350851]] SRR12161386 file size 4855346 SRR12161386 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161386 SRR12161386_1.fastq SRR12161386_2.fastq Input file: SRR12161386_1.fastq Paired file: SRR12161386_2.fastq trimmed: SRR12161386-trimmed-pair1.fastq, SRR12161386-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:41:35 2025 >> started Thu Feb 13 19:41:59 2025 >> done (24.089s) 14350851 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 1565 ( 0.01%) empty read pairs filtered out after trimming by size control 14349258 (99.99%) read pairs available; of these: 1125356 ( 7.84%) trimmed read pairs available after processing 13223902 (92.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 1 0.00% 21 9 0.00% 22 4 0.00% 23 7 0.00% 24 2 0.00% 25 6 0.00% 26 8 0.00% 27 10 0.00% 28 8 0.00% 29 4 0.00% 30 11 0.00% 31 3 0.00% 32 4 0.00% 33 16 0.00% 34 5 0.00% 35 7 0.00% 36 7 0.00% 37 7 0.00% 38 4 0.00% 39 9 0.00% 40 12 0.00% 41 7 0.00% 42 19 0.00% 43 13 0.00% 44 5 0.00% 45 27 0.00% 46 15 0.00% 47 12 0.00% 48 20 0.00% 49 22 0.00% 50 23 0.00% 51 28 0.00% 52 23 0.00% 53 26 0.00% 54 31 0.00% 55 40 0.00% 56 39 0.00% 57 56 0.00% 58 53 0.00% 59 78 0.00% 60 91 0.00% 61 90 0.00% 62 91 0.00% 63 97 0.00% 64 144 0.00% 65 126 0.00% 66 164 0.00% 67 193 0.00% 68 223 0.00% 69 250 0.00% 70 298 0.00% 71 310 0.00% 72 375 0.00% 73 370 0.00% 74 410 0.00% 75 509 0.00% 76 598 0.00% 77 655 0.00% 78 706 0.00% 79 859 0.01% 80 981 0.01% 81 1012 0.01% 82 1223 0.01% 83 1365 0.01% 84 1566 0.01% 85 1781 0.01% 86 1877 0.01% 87 2161 0.02% 88 2268 0.02% 89 2486 0.02% 90 2779 0.02% 91 3040 0.02% 92 3426 0.02% 93 3677 0.03% 94 4212 0.03% 95 4519 0.03% 96 4881 0.03% 97 5049 0.04% 98 5348 0.04% 99 5845 0.04% 100 6374 0.04% 101 6690 0.05% 102 7439 0.05% 103 7865 0.05% 104 8262 0.06% 105 8681 0.06% 106 9256 0.06% 107 9628 0.07% 108 9884 0.07% 109 10782 0.08% 110 11080 0.08% 111 11673 0.08% 112 12443 0.09% 113 12739 0.09% 114 13479 0.09% 115 14179 0.10% 116 14637 0.10% 117 15600 0.11% 118 15612 0.11% 119 16308 0.11% 120 16953 0.12% 121 17331 0.12% 122 18249 0.13% 123 19091 0.13% 124 19798 0.14% 125 20190 0.14% 126 21362 0.15% 127 21495 0.15% 128 22015 0.15% 129 22689 0.16% 130 23670 0.16% 131 23683 0.17% 132 24723 0.17% 133 25748 0.18% 134 26114 0.18% 135 26813 0.19% 136 27852 0.19% 137 28388 0.20% 138 29182 0.20% 139 29786 0.21% 140 30167 0.21% 141 30590 0.21% 142 31798 0.22% 143 32289 0.23% 144 33301 0.23% 145 34221 0.24% 146 34354 0.24% 147 35026 0.24% 148 35854 0.25% 149 36369 0.25% 150 36900 0.26% 151 13223902 92.16% 14349258 reads passed initial QC criterion=sequence-density sequence-density=1.15 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=16 prefix-density=1.16 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=21 fanout-score=10.24 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=5.2 sequence=GCTCCAAGCATGGCCCACCTGGAATGGATGACTTCAAGCTCACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=1.90 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=21 prefix-density=1.91 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=35.94 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTATGGCGATGGTTGTTAGTGCACCTCTAGCAGAAGCTGCCATCTCATGCGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAGGCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12161386 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:42:43 Started mapping on | Feb 13 19:42:43 Finished on | Feb 13 19:44:24 Mapping speed, Million of reads per hour | 511.46 Number of input reads | 14349258 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13443728 Uniquely mapped reads % | 93.69% Average mapped length | 297.36 Number of splices: Total | 13277555 Number of splices: Annotated (sjdb) | 13014288 Number of splices: GT/AG | 13008654 Number of splices: GC/AG | 224886 Number of splices: AT/AC | 11601 Number of splices: Non-canonical | 32414 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415264 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 138362 % of reads mapped to too many loci | 0.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.26% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 490266 490266 490266 N_multimapping 415264 415264 415264 N_noFeature 408585 13300262 451331 N_ambiguous 197325 792 96140 UnstrandedReadsAssigned:12837818 PositiveStrandReadsAssigned:142674 NegativeStrandReadsAssigned:12896257 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161386 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161386-trimmed-pair1.fastq SRR12161386-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,349,258 reads, 12,963,182 reads pseudoaligned [quant] estimated average fragment length: 266.404 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR12161386.ke.tsv 34699 SRR12161386.se.tsv 87100 total ==> SRR12161386.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.6 355 13.0829 Potri.005G024800.1.v4.1 1035 769.596 82 6.8819 Potri.004G059700.1.v4.1 961 695.768 142 13.182 Potri.007G009000.2.v4.1 1416 1150.6 0 0 Potri.003G141000.2.v4.1 2943 2677.6 370.467 8.93638 Potri.016G087400.1.v4.1 270 78.7867 997 817.333 Potri.015G069301.1.v4.1 564 314.308 0 0 Potri.010G195200.1.v4.1 1773 1507.6 1 0.0428422 Potri.012G127500.1.v4.1 977 711.696 1648 149.562 ==> SRR12161386.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 150 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 28 Potri.001G452600.v4.1 1 SRR12161386 completed mapping pipeline successfully