Starting /dee2/code/volunteer_pipeline.sh SRR12161387 current disk space = 3087622938624 free memory = 1449884208 SRR12161387 SRAfilesize fda5b5e1b82c4ddace89fb735ac2a86f SRR12161387.sra SRR12161387.sra file validated SRR12161387 is paired end SRR12161387 is conventional basespace SRR12161387 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161387_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57625 37.0 37.0 37.0 37.0 37.0 2 36.452 37.0 37.0 37.0 37.0 37.0 3 36.493 37.0 37.0 37.0 37.0 37.0 4 36.592 37.0 37.0 37.0 37.0 37.0 5 36.55 37.0 37.0 37.0 37.0 37.0 6 36.5215 37.0 37.0 37.0 37.0 37.0 7 36.5585 37.0 37.0 37.0 37.0 37.0 8 36.501 37.0 37.0 37.0 37.0 37.0 9 36.5375 37.0 37.0 37.0 37.0 37.0 10-14 36.5771 37.0 37.0 37.0 37.0 37.0 15-19 36.541799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5355 37.0 37.0 37.0 37.0 37.0 25-29 36.5221 37.0 37.0 37.0 37.0 37.0 30-34 36.487199999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.443 37.0 37.0 37.0 37.0 37.0 40-44 36.423199999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.4259 37.0 37.0 37.0 37.0 37.0 50-54 36.382 37.0 37.0 37.0 37.0 37.0 55-59 36.3819 37.0 37.0 37.0 37.0 37.0 60-64 36.3246 37.0 37.0 37.0 37.0 37.0 65-69 36.327099999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.330200000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.295 37.0 37.0 37.0 37.0 37.0 80-84 36.27140000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.293800000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.293099999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1851 37.0 37.0 37.0 37.0 37.0 100-104 36.2524 37.0 37.0 37.0 37.0 37.0 105-109 36.1824 37.0 37.0 37.0 37.0 37.0 110-114 36.1092 37.0 37.0 37.0 37.0 37.0 115-119 36.142100000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.1238 37.0 37.0 37.0 37.0 37.0 125-129 36.108000000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0486 37.0 37.0 37.0 37.0 37.0 135-139 35.965500000000006 37.0 37.0 37.0 37.0 37.0 140-144 36.0125 37.0 37.0 37.0 37.0 37.0 145-149 35.948899999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.7665 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 2.0 26 5.0 27 4.0 28 10.0 29 21.0 30 31.0 31 37.0 32 38.0 33 73.0 34 118.0 35 277.0 36 2944.0 37 436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.98574643660915 12.178044511127782 7.051762940735183 37.78444611152788 2 19.725 11.675 35.475 33.125 3 16.85 15.525 29.099999999999998 38.525 4 21.375 23.65 24.825 30.15 5 22.625 30.15 24.474999999999998 22.75 6 22.625 31.974999999999998 23.974999999999998 21.425 7 15.7 26.025 41.699999999999996 16.575 8 17.150000000000002 25.25 32.15 25.45 9 16.900000000000002 25.2 34.775 23.125 10-14 19.89 29.585 27.155 23.369999999999997 15-19 19.82 28.13 27.605 24.445 20-24 20.625 28.095 27.98 23.3 25-29 19.384999999999998 29.225 27.24 24.15 30-34 20.044999999999998 28.65 27.015 24.29 35-39 20.119999999999997 28.199999999999996 27.305 24.375 40-44 20.41 28.17 27.155 24.265 45-49 20.695 28.265 27.27 23.77 50-54 20.544999999999998 28.310000000000002 27.005000000000003 24.14 55-59 19.99 27.91 27.61 24.490000000000002 60-64 20.51 27.97 27.99 23.53 65-69 20.919999999999998 27.534999999999997 27.51 24.035 70-74 20.25 28.595 26.974999999999998 24.18 75-79 20.785 28.134999999999998 26.825 24.255 80-84 20.285 28.294999999999998 27.52 23.9 85-89 20.905 27.750000000000004 27.529999999999998 23.815 90-94 21.05 27.63 27.305 24.015 95-99 20.87 27.16 27.735 24.235 100-104 21.21 27.639999999999997 27.474999999999998 23.674999999999997 105-109 20.615 28.02 27.105 24.26 110-114 20.505000000000003 27.894999999999996 27.73 23.87 115-119 21.45 28.49 26.705000000000002 23.355 120-124 21.16 27.67 27.21 23.96 125-129 20.715 28.525 26.474999999999998 24.285 130-134 21.310000000000002 28.144999999999996 27.29 23.255 135-139 21.66 27.755000000000003 26.96 23.625 140-144 21.44 28.285 26.415 23.86 145-149 21.595 27.439999999999998 26.655 24.310000000000002 150-151 21.2625 27.6 26.775 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 3.5 26 7.0 27 8.5 28 7.0 29 12.0 30 17.0 31 24.0 32 41.5 33 49.0 34 62.5 35 66.5 36 69.0 37 95.5 38 108.0 39 119.0 40 158.5 41 188.5 42 203.0 43 238.5 44 266.0 45 260.0 46 245.5 47 250.0 48 238.0 49 211.0 50 202.0 51 166.5 52 138.0 53 123.5 54 92.5 55 72.5 56 59.5 57 51.0 58 47.0 59 36.0 60 21.5 61 11.5 62 6.5 63 5.5 64 3.0 65 2.5 66 2.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.22411498536066 88.5 2 5.216928400319404 9.8 3 0.5057226510513707 1.425 4 0.026616981634282673 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026616981634282673 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.4500000000000002 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.6624999999999996 0.0 0.0 0.0 0.0 126-127 3.025 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 4.012499999999999 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.325 0.0 0.0 0.0 0.0 138-139 5.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTAAC 10 0.006830828 145.0 6 GATCAGG 10 0.006830828 145.0 5 GTCAGGC 10 0.006830828 145.0 1 >>END_MODULE SRR12161387 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161387_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.424 37.0 37.0 37.0 37.0 37.0 2 36.1375 37.0 37.0 37.0 37.0 37.0 3 36.2195 37.0 37.0 37.0 37.0 37.0 4 36.1065 37.0 37.0 37.0 37.0 37.0 5 36.2835 37.0 37.0 37.0 37.0 37.0 6 36.246 37.0 37.0 37.0 37.0 37.0 7 36.294 37.0 37.0 37.0 37.0 37.0 8 36.343 37.0 37.0 37.0 37.0 37.0 9 36.2885 37.0 37.0 37.0 37.0 37.0 10-14 36.3498 37.0 37.0 37.0 37.0 37.0 15-19 36.2979 37.0 37.0 37.0 37.0 37.0 20-24 36.247800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.2449 37.0 37.0 37.0 37.0 37.0 30-34 36.1919 37.0 37.0 37.0 37.0 37.0 35-39 36.174600000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.195499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.176 37.0 37.0 37.0 37.0 37.0 50-54 36.1472 37.0 37.0 37.0 37.0 37.0 55-59 36.1235 37.0 37.0 37.0 37.0 37.0 60-64 36.031 37.0 37.0 37.0 37.0 37.0 65-69 36.09310000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.9577 37.0 37.0 37.0 37.0 37.0 75-79 35.9233 37.0 37.0 37.0 37.0 37.0 80-84 36.0125 37.0 37.0 37.0 37.0 37.0 85-89 35.96 37.0 37.0 37.0 37.0 37.0 90-94 35.9643 37.0 37.0 37.0 37.0 37.0 95-99 35.946200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.9539 37.0 37.0 37.0 37.0 37.0 105-109 35.901500000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.8457 37.0 37.0 37.0 37.0 37.0 115-119 35.8642 37.0 37.0 37.0 37.0 37.0 120-124 35.8196 37.0 37.0 37.0 37.0 37.0 125-129 35.6854 37.0 37.0 37.0 37.0 37.0 130-134 35.6639 37.0 37.0 37.0 37.0 37.0 135-139 35.7185 37.0 37.0 37.0 37.0 37.0 140-144 35.5816 37.0 37.0 37.0 37.0 37.0 145-149 35.5241 37.0 37.0 37.0 37.0 37.0 150-151 35.05275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 0.0 15 2.0 16 0.0 17 1.0 18 2.0 19 1.0 20 1.0 21 1.0 22 5.0 23 5.0 24 2.0 25 10.0 26 7.0 27 3.0 28 9.0 29 20.0 30 27.0 31 31.0 32 60.0 33 84.0 34 161.0 35 526.0 36 2752.0 37 284.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.400000000000006 24.0 9.275 26.325 2 27.650000000000002 27.700000000000003 29.4 15.25 3 21.4 28.125 31.35 19.125 4 23.575 35.025 22.55 18.85 5 23.225 38.375 22.05 16.35 6 20.9 39.300000000000004 22.85 16.950000000000003 7 21.175 22.8 38.025 18.0 8 22.425 26.55 26.775 24.25 9 22.275 25.4 28.675 23.65 10-14 23.715 29.24 26.295 20.75 15-19 23.32 28.38 26.735 21.565 20-24 23.494999999999997 28.310000000000002 26.605 21.59 25-29 23.46 28.815 26.810000000000002 20.915 30-34 22.795 27.92 27.615000000000002 21.67 35-39 23.494999999999997 28.565 26.745 21.195 40-44 23.935000000000002 27.834999999999997 27.24 20.990000000000002 45-49 23.62 28.15 27.075 21.154999999999998 50-54 23.825 27.79 27.52 20.865000000000002 55-59 23.285 27.794999999999998 27.250000000000004 21.67 60-64 23.48 27.465 27.255000000000003 21.8 65-69 23.57 28.035 27.215 21.18 70-74 24.04 27.445000000000004 27.139999999999997 21.375 75-79 23.400000000000002 27.445000000000004 27.900000000000002 21.255 80-84 24.060000000000002 27.63 26.875 21.435000000000002 85-89 23.810000000000002 26.979999999999997 28.15 21.060000000000002 90-94 24.240000000000002 26.775 27.865000000000002 21.12 95-99 23.94 27.785 27.24 21.035 100-104 24.044999999999998 27.735 26.86 21.36 105-109 23.330000000000002 27.47 27.805000000000003 21.395 110-114 24.154999999999998 27.46 27.295 21.09 115-119 24.154999999999998 27.625 27.825 20.395 120-124 24.3 27.32 27.810000000000002 20.57 125-129 24.525 27.26 27.655 20.560000000000002 130-134 25.15 28.155 26.525 20.169999999999998 135-139 24.98 28.48 26.415 20.125 140-144 25.740000000000002 27.675 26.695 19.89 145-149 25.715 27.58 26.61 20.095 150-151 26.5125 28.199999999999996 25.8125 19.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 1.5 20 2.0 21 1.0 22 1.0 23 0.5 24 0.5 25 2.5 26 2.5 27 2.5 28 5.0 29 6.5 30 10.5 31 17.0 32 20.5 33 31.5 34 45.5 35 58.0 36 75.5 37 111.0 38 129.5 39 138.5 40 173.0 41 206.5 42 233.0 43 251.0 44 262.0 45 252.0 46 242.0 47 255.5 48 258.0 49 230.0 50 197.5 51 174.0 52 137.5 53 109.0 54 87.0 55 60.0 56 43.5 57 38.5 58 33.5 59 23.5 60 17.5 61 11.5 62 11.0 63 8.0 64 3.5 65 3.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.17890520694259 88.175 2 5.313751668891856 9.950000000000001 3 0.4272363150867824 1.2 4 0.0267022696929239 0.1 5 0.0267022696929239 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0267022696929239 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 18 0.44999999999999996 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.4249999999999998 0.0 0.0 0.0 0.0 116-117 1.5125 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.8875000000000002 0.0 0.0 0.0 0.0 122-123 2.225 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 4.050000000000001 0.0 0.0 0.0 0.0 132-133 4.525 0.0 0.0 0.0 0.0 134-135 4.9 0.0 0.0 0.0 0.0 136-137 5.3875 0.0 0.0 0.0 0.0 138-139 6.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTCT 10 0.006830828 145.0 6 >>END_MODULE Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra Read 595591 spots for SRR12161387.sra Written 595591 spots for SRR12161387.sra Read 595586 spots for SRR12161387.sra Written 595586 spots for SRR12161387.sra SRR ids: ['SRR12161387.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pb7i89jv SRR12161387.sra spots: 11911725 blocks: [[1, 595586], [595587, 1191172], [1191173, 1786758], [1786759, 2382344], [2382345, 2977930], [2977931, 3573516], [3573517, 4169102], [4169103, 4764688], [4764689, 5360274], [5360275, 5955860], [5955861, 6551446], [6551447, 7147032], [7147033, 7742618], [7742619, 8338204], [8338205, 8933790], [8933791, 9529376], [9529377, 10124962], [10124963, 10720548], [10720549, 11316134], [11316135, 11911725]] SRR12161387 file size 4026424 SRR12161387 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161387 SRR12161387_1.fastq SRR12161387_2.fastq Input file: SRR12161387_1.fastq Paired file: SRR12161387_2.fastq trimmed: SRR12161387-trimmed-pair1.fastq, SRR12161387-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:05:10 2025 >> started Thu Feb 13 20:05:25 2025 >> done (15.710s) 11911725 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 2496 ( 0.02%) empty read pairs filtered out after trimming by size control 11909211 (99.98%) read pairs available; of these: 1061943 ( 8.92%) trimmed read pairs available after processing 10847268 (91.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 0 0.00% 22 3 0.00% 23 5 0.00% 24 7 0.00% 25 5 0.00% 26 5 0.00% 27 10 0.00% 28 8 0.00% 29 6 0.00% 30 5 0.00% 31 8 0.00% 32 5 0.00% 33 9 0.00% 34 5 0.00% 35 12 0.00% 36 4 0.00% 37 13 0.00% 38 15 0.00% 39 9 0.00% 40 13 0.00% 41 11 0.00% 42 15 0.00% 43 17 0.00% 44 18 0.00% 45 10 0.00% 46 13 0.00% 47 15 0.00% 48 24 0.00% 49 22 0.00% 50 24 0.00% 51 25 0.00% 52 27 0.00% 53 35 0.00% 54 32 0.00% 55 35 0.00% 56 33 0.00% 57 53 0.00% 58 48 0.00% 59 64 0.00% 60 72 0.00% 61 74 0.00% 62 82 0.00% 63 102 0.00% 64 105 0.00% 65 118 0.00% 66 129 0.00% 67 141 0.00% 68 171 0.00% 69 194 0.00% 70 202 0.00% 71 228 0.00% 72 283 0.00% 73 307 0.00% 74 364 0.00% 75 391 0.00% 76 482 0.00% 77 527 0.00% 78 553 0.00% 79 610 0.01% 80 684 0.01% 81 717 0.01% 82 915 0.01% 83 988 0.01% 84 1266 0.01% 85 1356 0.01% 86 1414 0.01% 87 1620 0.01% 88 1719 0.01% 89 1924 0.02% 90 2118 0.02% 91 2335 0.02% 92 2630 0.02% 93 2977 0.02% 94 3213 0.03% 95 3561 0.03% 96 3798 0.03% 97 4058 0.03% 98 4455 0.04% 99 4814 0.04% 100 5301 0.04% 101 5495 0.05% 102 6079 0.05% 103 6424 0.05% 104 6769 0.06% 105 7486 0.06% 106 7976 0.07% 107 8193 0.07% 108 8787 0.07% 109 9205 0.08% 110 9646 0.08% 111 10303 0.09% 112 10798 0.09% 113 11165 0.09% 114 11935 0.10% 115 12582 0.11% 116 13032 0.11% 117 14129 0.12% 118 14346 0.12% 119 14767 0.12% 120 15658 0.13% 121 16228 0.14% 122 16770 0.14% 123 17888 0.15% 124 18422 0.15% 125 18933 0.16% 126 19980 0.17% 127 20628 0.17% 128 21327 0.18% 129 21879 0.18% 130 22420 0.19% 131 22879 0.19% 132 23900 0.20% 133 25174 0.21% 134 25258 0.21% 135 26046 0.22% 136 26995 0.23% 137 27484 0.23% 138 28287 0.24% 139 29635 0.25% 140 29907 0.25% 141 30410 0.26% 142 31411 0.26% 143 31846 0.27% 144 32796 0.28% 145 33747 0.28% 146 34379 0.29% 147 35244 0.30% 148 35925 0.30% 149 36058 0.30% 150 37639 0.32% 151 10847268 91.08% 11909211 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=15 prefix-density=0.97 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=8.76 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=3.2 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=1.10 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=29.56 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR12161387 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:06:11 Started mapping on | Feb 13 20:06:12 Finished on | Feb 13 20:07:38 Mapping speed, Million of reads per hour | 498.53 Number of input reads | 11909211 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11190395 Uniquely mapped reads % | 93.96% Average mapped length | 297.20 Number of splices: Total | 11118581 Number of splices: Annotated (sjdb) | 10901939 Number of splices: GT/AG | 10886601 Number of splices: GC/AG | 193742 Number of splices: AT/AC | 9541 Number of splices: Non-canonical | 28697 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265535 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 75420 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 453281 453281 453281 N_multimapping 265535 265535 265535 N_noFeature 286273 11040577 327857 N_ambiguous 184019 567 75472 UnstrandedReadsAssigned:10720103 PositiveStrandReadsAssigned:149251 NegativeStrandReadsAssigned:10787066 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161387 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161387-trimmed-pair1.fastq SRR12161387-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,909,211 reads, 10,859,059 reads pseudoaligned [quant] estimated average fragment length: 254.783 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR12161387.ke.tsv 34699 SRR12161387.se.tsv 87100 total ==> SRR12161387.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.22 245 10.137 Potri.005G024800.1.v4.1 1035 781.217 131 12.2404 Potri.004G059700.1.v4.1 961 707.335 95 9.80375 Potri.007G009000.2.v4.1 1416 1162.22 0 0 Potri.003G141000.2.v4.1 2943 2689.22 322 8.74026 Potri.016G087400.1.v4.1 270 80.4675 775.015 703.046 Potri.015G069301.1.v4.1 564 322.4 0 0 Potri.010G195200.1.v4.1 1773 1519.22 5 0.24024 Potri.012G127500.1.v4.1 977 723.255 529 53.3898 ==> SRR12161387.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 126 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 160 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR12161387 completed mapping pipeline successfully