Starting /dee2/code/volunteer_pipeline.sh SRR12161388 current disk space = 3088075014144 free memory = 1582501072 SRR12161388 SRAfilesize b81c5951326a8be5a1d4dcd647787762 SRR12161388.sra SRR12161388.sra file validated SRR12161388 is paired end SRR12161388 is conventional basespace SRR12161388 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161388_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.517 37.0 37.0 37.0 37.0 37.0 2 36.435 37.0 37.0 37.0 37.0 37.0 3 36.451 37.0 37.0 37.0 37.0 37.0 4 36.4715 37.0 37.0 37.0 37.0 37.0 5 36.514 37.0 37.0 37.0 37.0 37.0 6 36.546 37.0 37.0 37.0 37.0 37.0 7 36.5345 37.0 37.0 37.0 37.0 37.0 8 36.528 37.0 37.0 37.0 37.0 37.0 9 36.4305 37.0 37.0 37.0 37.0 37.0 10-14 36.543000000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.50619999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4605 37.0 37.0 37.0 37.0 37.0 25-29 36.4187 37.0 37.0 37.0 37.0 37.0 30-34 36.3981 37.0 37.0 37.0 37.0 37.0 35-39 36.4031 37.0 37.0 37.0 37.0 37.0 40-44 36.3439 37.0 37.0 37.0 37.0 37.0 45-49 36.311600000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.288599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3557 37.0 37.0 37.0 37.0 37.0 60-64 36.3003 37.0 37.0 37.0 37.0 37.0 65-69 36.302299999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3091 37.0 37.0 37.0 37.0 37.0 75-79 36.255 37.0 37.0 37.0 37.0 37.0 80-84 36.2821 37.0 37.0 37.0 37.0 37.0 85-89 36.242399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2274 37.0 37.0 37.0 37.0 37.0 95-99 36.2125 37.0 37.0 37.0 37.0 37.0 100-104 36.150099999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1265 37.0 37.0 37.0 37.0 37.0 110-114 36.137800000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.112100000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.098200000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.0237 37.0 37.0 37.0 37.0 37.0 130-134 36.077600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9494 37.0 37.0 37.0 37.0 37.0 140-144 35.9009 37.0 37.0 37.0 37.0 37.0 145-149 35.8378 37.0 37.0 37.0 37.0 37.0 150-151 35.67025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 2.0 24 1.0 25 2.0 26 6.0 27 9.0 28 12.0 29 13.0 30 26.0 31 51.0 32 50.0 33 67.0 34 124.0 35 295.0 36 2937.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.35067533766884 11.905952976488244 6.453226613306653 30.29014507253627 2 21.4 12.125 33.75 32.725 3 17.525 19.1 31.15 32.225 4 20.45 25.650000000000002 26.150000000000002 27.750000000000004 5 22.0 32.2 24.5 21.3 6 20.974999999999998 33.300000000000004 23.525 22.2 7 15.55 27.35 41.5 15.6 8 15.4 27.675 32.1 24.825 9 17.525 24.275 34.449999999999996 23.75 10-14 19.955000000000002 29.73 27.445000000000004 22.869999999999997 15-19 20.48 28.455000000000002 27.439999999999998 23.625 20-24 20.064999999999998 28.9 27.689999999999998 23.345 25-29 19.74 28.815 27.79 23.655 30-34 20.415 28.49 27.72 23.375 35-39 20.085 28.025 28.26 23.630000000000003 40-44 20.380000000000003 28.07 27.57 23.98 45-49 20.4 28.82 27.27 23.51 50-54 20.3 28.58 27.605 23.515 55-59 20.615 28.349999999999998 27.265 23.77 60-64 20.665 28.825 27.084999999999997 23.425 65-69 20.505000000000003 28.720000000000002 27.065 23.71 70-74 20.39 28.335 27.16 24.115000000000002 75-79 20.695 27.77 27.810000000000002 23.724999999999998 80-84 20.11 28.23 27.935 23.724999999999998 85-89 20.11 28.720000000000002 26.685 24.485 90-94 20.74 28.050000000000004 26.974999999999998 24.235 95-99 20.82 27.85 27.76 23.57 100-104 20.82 28.355000000000004 27.22 23.605 105-109 21.154999999999998 28.21 26.919999999999998 23.715 110-114 20.865000000000002 27.894999999999996 27.37 23.87 115-119 20.979999999999997 28.185 27.215 23.62 120-124 21.17 27.785 27.35 23.695 125-129 20.91 28.244999999999997 26.939999999999998 23.905 130-134 20.71 27.855 27.27 24.165 135-139 21.27 27.445000000000004 27.065 24.22 140-144 21.615000000000002 27.47 27.084999999999997 23.830000000000002 145-149 21.025 27.97 26.884999999999998 24.12 150-151 21.1375 28.000000000000004 27.125 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.0 24 1.5 25 3.0 26 8.0 27 9.5 28 10.0 29 14.5 30 17.5 31 24.0 32 33.0 33 47.0 34 53.5 35 67.0 36 93.5 37 121.0 38 127.0 39 134.5 40 174.5 41 211.0 42 210.0 43 209.5 44 249.0 45 262.5 46 256.0 47 262.5 48 242.0 49 209.5 50 191.5 51 160.5 52 128.0 53 99.5 54 80.5 55 72.5 56 59.5 57 44.5 58 29.5 59 22.0 60 15.0 61 8.5 62 6.5 63 4.5 64 3.5 65 3.0 66 3.0 67 2.5 68 1.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.5019920318725 88.94999999999999 2 4.966799468791501 9.35 3 0.4249667994687915 1.2 4 0.05312084993359894 0.2 5 0.02656042496679947 0.125 6 0.0 0.0 7 0.02656042496679947 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTA 7 0.17500000000000002 No Hit GGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.5 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.45 0.0 0.0 0.0 0.0 136-137 4.8625 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161388 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161388_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.266 37.0 37.0 37.0 37.0 37.0 2 35.914 37.0 37.0 37.0 37.0 37.0 3 35.974 37.0 37.0 37.0 37.0 37.0 4 36.055 37.0 37.0 37.0 37.0 37.0 5 36.126 37.0 37.0 37.0 37.0 37.0 6 36.065 37.0 37.0 37.0 37.0 37.0 7 36.0415 37.0 37.0 37.0 37.0 37.0 8 36.112 37.0 37.0 37.0 37.0 37.0 9 36.0705 37.0 37.0 37.0 37.0 37.0 10-14 36.1643 37.0 37.0 37.0 37.0 37.0 15-19 36.1232 37.0 37.0 37.0 37.0 37.0 20-24 36.0728 37.0 37.0 37.0 37.0 37.0 25-29 36.0198 37.0 37.0 37.0 37.0 37.0 30-34 36.01030000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.9906 37.0 37.0 37.0 37.0 37.0 40-44 35.9107 37.0 37.0 37.0 37.0 37.0 45-49 35.868 37.0 37.0 37.0 37.0 37.0 50-54 35.884899999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.82430000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.814 37.0 37.0 37.0 37.0 37.0 65-69 35.8272 37.0 37.0 37.0 37.0 37.0 70-74 35.713800000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.706100000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.8082 37.0 37.0 37.0 37.0 37.0 85-89 35.689 37.0 37.0 37.0 37.0 37.0 90-94 35.6492 37.0 37.0 37.0 37.0 37.0 95-99 35.637 37.0 37.0 37.0 37.0 37.0 100-104 35.7168 37.0 37.0 37.0 37.0 37.0 105-109 35.6163 37.0 37.0 37.0 37.0 37.0 110-114 35.596599999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.6104 37.0 37.0 37.0 37.0 37.0 120-124 35.5583 37.0 37.0 37.0 37.0 37.0 125-129 35.4015 37.0 37.0 37.0 37.0 37.0 130-134 35.4062 37.0 37.0 37.0 37.0 37.0 135-139 35.4204 37.0 37.0 37.0 37.0 37.0 140-144 35.2831 37.0 37.0 37.0 32.2 37.0 145-149 35.3546 37.0 37.0 37.0 37.0 37.0 150-151 34.76925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 6.0 14 8.0 15 7.0 16 4.0 17 1.0 18 2.0 19 2.0 20 5.0 21 3.0 22 5.0 23 5.0 24 11.0 25 6.0 26 9.0 27 11.0 28 19.0 29 22.0 30 19.0 31 45.0 32 65.0 33 108.0 34 205.0 35 507.0 36 2630.0 37 292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.525 25.650000000000002 7.5249999999999995 20.3 2 28.65 25.825 27.55 17.974999999999998 3 22.400000000000002 26.55 32.75 18.3 4 24.325 34.125 22.925 18.625 5 24.85 37.75 19.825 17.575 6 23.075000000000003 39.550000000000004 20.150000000000002 17.224999999999998 7 22.05 24.3 34.949999999999996 18.7 8 22.25 27.325 26.05 24.375 9 23.325000000000003 25.4 28.025 23.25 10-14 24.37 29.45 25.45 20.73 15-19 23.435 28.73 26.63 21.205 20-24 23.405 28.915000000000003 26.655 21.025 25-29 23.605 28.03 27.139999999999997 21.224999999999998 30-34 22.95 28.560000000000002 27.139999999999997 21.349999999999998 35-39 23.935000000000002 27.815 26.915 21.335 40-44 22.955000000000002 27.815 27.965 21.265 45-49 23.655 27.455000000000002 27.47 21.42 50-54 23.544999999999998 27.725 27.57 21.16 55-59 23.79 27.62 27.750000000000004 20.84 60-64 23.695 27.485 27.55 21.27 65-69 23.805 26.740000000000002 27.939999999999998 21.515 70-74 23.595 27.525 27.089999999999996 21.790000000000003 75-79 23.380000000000003 28.345 26.795 21.48 80-84 23.715 28.455000000000002 26.76 21.07 85-89 24.15 27.339999999999996 27.155 21.355 90-94 23.810000000000002 28.375 26.825 20.990000000000002 95-99 23.86 28.34 26.279999999999998 21.52 100-104 23.925 28.17 26.965 20.94 105-109 23.705000000000002 27.74 28.09 20.465 110-114 23.59 27.765 27.52 21.125 115-119 24.169999999999998 28.175 27.21 20.445 120-124 24.16 28.33 27.279999999999998 20.23 125-129 24.715 27.439999999999998 26.965 20.880000000000003 130-134 24.415 27.834999999999997 26.939999999999998 20.810000000000002 135-139 25.0 27.589999999999996 26.985 20.424999999999997 140-144 24.305 27.355 27.439999999999998 20.9 145-149 25.215 27.744999999999997 26.985 20.055 150-151 25.174999999999997 28.3375 26.637499999999996 19.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 1.0 6 1.5 7 1.0 8 1.5 9 1.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.5 23 2.5 24 2.5 25 3.0 26 3.5 27 4.5 28 5.5 29 9.5 30 15.0 31 13.0 32 18.0 33 28.5 34 42.0 35 58.5 36 77.5 37 101.5 38 111.5 39 139.5 40 181.0 41 216.5 42 251.0 43 247.0 44 236.5 45 255.5 46 258.5 47 248.0 48 233.5 49 218.0 50 202.0 51 168.0 52 127.0 53 98.0 54 94.0 55 80.5 56 61.5 57 43.5 58 26.0 59 26.0 60 20.5 61 11.5 62 6.0 63 3.0 64 1.5 65 0.0 66 1.0 67 2.0 68 1.0 69 1.0 70 1.5 71 1.5 72 1.0 73 0.0 74 0.5 75 1.0 76 1.5 77 2.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 2.0 85 2.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 1.5 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.6003742314889 88.47500000000001 2 4.570970328789094 8.55 3 0.5880780539962577 1.6500000000000001 4 0.13365410318096765 0.5 5 0.0 0.0 6 0.02673082063619353 0.15 7 0.02673082063619353 0.17500000000000002 8 0.0 0.0 9 0.02673082063619353 0.22499999999999998 >10 0.02673082063619353 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.2374999999999998 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.8 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 3.1624999999999996 0.0 0.0 0.0 0.0 128-129 3.5250000000000004 0.0 0.0 0.0 0.0 130-131 3.7249999999999996 0.0 0.0 0.0 0.0 132-133 4.0875 0.0 0.0 0.0 0.0 134-135 4.45 0.0 0.0 0.0 0.0 136-137 4.8625 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATGC 20 0.00593511 29.0 100-104 >>END_MODULE Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763199 spots for SRR12161388.sra Written 763199 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra Read 763183 spots for SRR12161388.sra Written 763183 spots for SRR12161388.sra SRR ids: ['SRR12161388.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ixumc2af SRR12161388.sra spots: 15263676 blocks: [[1, 763183], [763184, 1526366], [1526367, 2289549], [2289550, 3052732], [3052733, 3815915], [3815916, 4579098], [4579099, 5342281], [5342282, 6105464], [6105465, 6868647], [6868648, 7631830], [7631831, 8395013], [8395014, 9158196], [9158197, 9921379], [9921380, 10684562], [10684563, 11447745], [11447746, 12210928], [12210929, 12974111], [12974112, 13737294], [13737295, 14500477], [14500478, 15263676]] SRR12161388 file size 5165564 SRR12161388 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161388 SRR12161388_1.fastq SRR12161388_2.fastq Input file: SRR12161388_1.fastq Paired file: SRR12161388_2.fastq trimmed: SRR12161388-trimmed-pair1.fastq, SRR12161388-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:57:46 2025 >> started Thu Feb 13 20:58:02 2025 >> done (16.396s) 15263676 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 6800 ( 0.04%) empty read pairs filtered out after trimming by size control 15256846 (99.96%) read pairs available; of these: 1298337 ( 8.51%) trimmed read pairs available after processing 13958509 (91.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 12 0.00% 24 6 0.00% 25 10 0.00% 26 18 0.00% 27 15 0.00% 28 11 0.00% 29 22 0.00% 30 12 0.00% 31 13 0.00% 32 14 0.00% 33 10 0.00% 34 15 0.00% 35 11 0.00% 36 14 0.00% 37 12 0.00% 38 19 0.00% 39 11 0.00% 40 33 0.00% 41 23 0.00% 42 16 0.00% 43 16 0.00% 44 25 0.00% 45 31 0.00% 46 20 0.00% 47 23 0.00% 48 30 0.00% 49 46 0.00% 50 40 0.00% 51 46 0.00% 52 36 0.00% 53 64 0.00% 54 56 0.00% 55 51 0.00% 56 81 0.00% 57 91 0.00% 58 88 0.00% 59 97 0.00% 60 131 0.00% 61 151 0.00% 62 143 0.00% 63 144 0.00% 64 200 0.00% 65 180 0.00% 66 230 0.00% 67 267 0.00% 68 315 0.00% 69 305 0.00% 70 390 0.00% 71 484 0.00% 72 496 0.00% 73 578 0.00% 74 642 0.00% 75 682 0.00% 76 763 0.01% 77 933 0.01% 78 988 0.01% 79 1090 0.01% 80 1263 0.01% 81 1426 0.01% 82 1699 0.01% 83 1852 0.01% 84 2075 0.01% 85 2216 0.01% 86 2487 0.02% 87 2686 0.02% 88 2821 0.02% 89 3166 0.02% 90 3640 0.02% 91 4083 0.03% 92 4519 0.03% 93 4864 0.03% 94 5361 0.04% 95 5738 0.04% 96 6056 0.04% 97 6346 0.04% 98 6760 0.04% 99 7151 0.05% 100 7840 0.05% 101 8283 0.05% 102 9059 0.06% 103 9733 0.06% 104 10269 0.07% 105 10853 0.07% 106 11366 0.07% 107 11647 0.08% 108 12169 0.08% 109 12512 0.08% 110 12923 0.08% 111 13968 0.09% 112 14598 0.10% 113 15247 0.10% 114 16298 0.11% 115 17103 0.11% 116 17914 0.12% 117 18233 0.12% 118 18225 0.12% 119 19171 0.13% 120 19599 0.13% 121 20266 0.13% 122 21112 0.14% 123 22279 0.15% 124 23660 0.16% 125 23470 0.15% 126 24792 0.16% 127 24977 0.16% 128 25374 0.17% 129 25994 0.17% 130 26364 0.17% 131 26936 0.18% 132 27873 0.18% 133 28926 0.19% 134 29699 0.19% 135 30686 0.20% 136 31496 0.21% 137 31697 0.21% 138 32852 0.22% 139 33260 0.22% 140 33351 0.22% 141 34300 0.22% 142 34757 0.23% 143 35518 0.23% 144 37132 0.24% 145 38350 0.25% 146 38644 0.25% 147 39741 0.26% 148 40048 0.26% 149 40265 0.26% 150 41027 0.27% 151 13958509 91.49% 15256846 reads passed initial QC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=18 prefix-density=0.98 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=41.21 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.7 sequence=TCACGAAGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGTCGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATTGTAGCACTAGCTTATTATCATACTTCATAATCTGCTTCGATTCTTCACTTCACGCTTTTGCAATCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCCACATGAGATGGCAGCTTCTGC criterion=sequence-density sequence-density=1.37 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=19 prefix-density=1.37 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=37.13 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.5 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTACAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12161388 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:58:49 Started mapping on | Feb 13 20:58:50 Finished on | Feb 13 21:00:35 Mapping speed, Million of reads per hour | 523.09 Number of input reads | 15256846 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14035974 Uniquely mapped reads % | 92.00% Average mapped length | 296.74 Number of splices: Total | 13916517 Number of splices: Annotated (sjdb) | 13642673 Number of splices: GT/AG | 13619473 Number of splices: GC/AG | 246000 Number of splices: AT/AC | 9075 Number of splices: Non-canonical | 41969 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437886 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 69020 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.48% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 782986 782986 782986 N_multimapping 437886 437886 437886 N_noFeature 408316 13833607 467461 N_ambiguous 240623 853 96940 UnstrandedReadsAssigned:13387035 PositiveStrandReadsAssigned:201514 NegativeStrandReadsAssigned:13471573 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161388 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161388-trimmed-pair1.fastq SRR12161388-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,256,846 reads, 13,572,980 reads pseudoaligned [quant] estimated average fragment length: 263.824 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR12161388.ke.tsv 34699 SRR12161388.se.tsv 87100 total ==> SRR12161388.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.18 398 13.529 Potri.005G024800.1.v4.1 1035 772.176 313 24.1841 Potri.004G059700.1.v4.1 961 698.29 45 3.84484 Potri.007G009000.2.v4.1 1416 1153.18 0 0 Potri.003G141000.2.v4.1 2943 2680.18 571 12.7109 Potri.016G087400.1.v4.1 270 79.8565 749 559.595 Potri.015G069301.1.v4.1 564 315.291 0 0 Potri.010G195200.1.v4.1 1773 1510.18 19 0.750634 Potri.012G127500.1.v4.1 977 714.227 129 10.776 ==> SRR12161388.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 320 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 188 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12161388 completed mapping pipeline successfully