Starting /dee2/code/volunteer_pipeline.sh SRR12161389 current disk space = 3087641620480 free memory = 1445987932 SRR12161389 SRAfilesize e5aab8bf273f64e687e3eed97577a029 SRR12161389.sra SRR12161389.sra file validated SRR12161389 is paired end SRR12161389 is conventional basespace SRR12161389 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161389_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5085 37.0 37.0 37.0 37.0 37.0 2 36.425 37.0 37.0 37.0 37.0 37.0 3 36.559 37.0 37.0 37.0 37.0 37.0 4 36.4815 37.0 37.0 37.0 37.0 37.0 5 36.618 37.0 37.0 37.0 37.0 37.0 6 36.6565 37.0 37.0 37.0 37.0 37.0 7 36.591 37.0 37.0 37.0 37.0 37.0 8 36.6485 37.0 37.0 37.0 37.0 37.0 9 36.541 37.0 37.0 37.0 37.0 37.0 10-14 36.5693 37.0 37.0 37.0 37.0 37.0 15-19 36.585699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.517900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.479499999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.519099999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4788 37.0 37.0 37.0 37.0 37.0 40-44 36.471 37.0 37.0 37.0 37.0 37.0 45-49 36.437400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.38199999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.445 37.0 37.0 37.0 37.0 37.0 60-64 36.4036 37.0 37.0 37.0 37.0 37.0 65-69 36.32809999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.369099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3209 37.0 37.0 37.0 37.0 37.0 80-84 36.335899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.304 37.0 37.0 37.0 37.0 37.0 90-94 36.351 37.0 37.0 37.0 37.0 37.0 95-99 36.2566 37.0 37.0 37.0 37.0 37.0 100-104 36.262699999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.161 37.0 37.0 37.0 37.0 37.0 110-114 36.3019 37.0 37.0 37.0 37.0 37.0 115-119 36.2039 37.0 37.0 37.0 37.0 37.0 120-124 36.176199999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.1 37.0 37.0 37.0 37.0 37.0 130-134 36.1123 37.0 37.0 37.0 37.0 37.0 135-139 36.0793 37.0 37.0 37.0 37.0 37.0 140-144 35.997699999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.9247 37.0 37.0 37.0 37.0 37.0 150-151 35.903999999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 0.0 26 3.0 27 7.0 28 10.0 29 11.0 30 23.0 31 29.0 32 51.0 33 73.0 34 111.0 35 271.0 36 2977.0 37 432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.525 12.5 7.1 41.875 2 18.825 13.675 36.575 30.925000000000004 3 16.925 17.875 27.800000000000004 37.4 4 20.724999999999998 25.874999999999996 24.825 28.575 5 23.225 31.7 23.75 21.325 6 20.025000000000002 33.925 25.025 21.025 7 15.6 27.400000000000002 40.975 16.025 8 17.599999999999998 25.85 31.0 25.55 9 16.475 23.425 35.075 25.025 10-14 19.7 29.154999999999998 27.884999999999998 23.26 15-19 19.744999999999997 28.305000000000003 27.555000000000003 24.395 20-24 19.935 28.98 27.99 23.095 25-29 19.82 28.58 27.785 23.815 30-34 19.62 28.23 27.950000000000003 24.2 35-39 19.61 28.505000000000003 27.505000000000003 24.38 40-44 19.814999999999998 28.375 27.810000000000002 24.0 45-49 20.23 28.235 27.325 24.21 50-54 20.395 28.24 27.375 23.990000000000002 55-59 19.645000000000003 28.044999999999998 27.825 24.485 60-64 20.125 28.439999999999998 27.150000000000002 24.285 65-69 20.150000000000002 28.17 27.66 24.02 70-74 20.419999999999998 28.765 26.57 24.245 75-79 20.43 28.025 27.034999999999997 24.51 80-84 20.849999999999998 28.050000000000004 27.255000000000003 23.845 85-89 20.385 28.310000000000002 27.48 23.825 90-94 20.53 27.689999999999998 27.41 24.37 95-99 20.69 27.725 27.79 23.794999999999998 100-104 20.75 28.199999999999996 27.224999999999998 23.825 105-109 20.22 28.325 27.084999999999997 24.37 110-114 20.735 28.32 27.51 23.435 115-119 21.125 28.384999999999998 26.415 24.075 120-124 20.215 27.794999999999998 27.37 24.62 125-129 20.599999999999998 28.48 27.215 23.705000000000002 130-134 21.07 27.46 27.87 23.599999999999998 135-139 21.985 27.555000000000003 26.305 24.154999999999998 140-144 20.965 27.279999999999998 27.544999999999998 24.21 145-149 21.385 27.815 26.995 23.805 150-151 21.175 28.6125 26.450000000000003 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 0.5 23 1.5 24 2.0 25 3.0 26 5.0 27 6.0 28 8.0 29 13.0 30 16.0 31 20.5 32 35.5 33 44.5 34 50.5 35 69.0 36 88.0 37 103.0 38 116.0 39 136.5 40 177.5 41 208.0 42 218.0 43 240.0 44 256.5 45 265.0 46 267.0 47 255.5 48 235.5 49 217.5 50 198.5 51 156.0 52 125.0 53 108.0 54 83.0 55 64.5 56 54.5 57 42.5 58 27.0 59 22.0 60 20.5 61 12.0 62 9.0 63 7.0 64 3.0 65 1.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.14180672268907 90.575 2 4.70063025210084 8.95 3 0.13130252100840337 0.375 4 0.026260504201680673 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.025 0.0 0.0 0.0 0.0 138-139 3.4124999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAATT 10 0.006830828 145.0 6 TTTTTTT 40 0.0076550315 18.125 40-44 >>END_MODULE SRR12161389 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161389_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.239 37.0 37.0 37.0 37.0 37.0 2 36.0505 37.0 37.0 37.0 37.0 37.0 3 36.041 37.0 37.0 37.0 37.0 37.0 4 36.1415 37.0 37.0 37.0 37.0 37.0 5 36.272 37.0 37.0 37.0 37.0 37.0 6 36.2235 37.0 37.0 37.0 37.0 37.0 7 36.204 37.0 37.0 37.0 37.0 37.0 8 36.2215 37.0 37.0 37.0 37.0 37.0 9 36.3335 37.0 37.0 37.0 37.0 37.0 10-14 36.2813 37.0 37.0 37.0 37.0 37.0 15-19 36.2701 37.0 37.0 37.0 37.0 37.0 20-24 36.243500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1793 37.0 37.0 37.0 37.0 37.0 30-34 36.177 37.0 37.0 37.0 37.0 37.0 35-39 36.191 37.0 37.0 37.0 37.0 37.0 40-44 36.1604 37.0 37.0 37.0 37.0 37.0 45-49 36.0766 37.0 37.0 37.0 37.0 37.0 50-54 36.1423 37.0 37.0 37.0 37.0 37.0 55-59 36.0786 37.0 37.0 37.0 37.0 37.0 60-64 36.087999999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.028999999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.9079 37.0 37.0 37.0 37.0 37.0 75-79 35.9938 37.0 37.0 37.0 37.0 37.0 80-84 35.9968 37.0 37.0 37.0 37.0 37.0 85-89 35.91700000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8846 37.0 37.0 37.0 37.0 37.0 95-99 35.9317 37.0 37.0 37.0 37.0 37.0 100-104 35.890699999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9114 37.0 37.0 37.0 37.0 37.0 110-114 35.772000000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.8804 37.0 37.0 37.0 37.0 37.0 120-124 35.7992 37.0 37.0 37.0 37.0 37.0 125-129 35.6933 37.0 37.0 37.0 37.0 37.0 130-134 35.6207 37.0 37.0 37.0 37.0 37.0 135-139 35.618199999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.590500000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.6166 37.0 37.0 37.0 37.0 37.0 150-151 35.051500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 6.0 24 2.0 25 6.0 26 11.0 27 11.0 28 11.0 29 15.0 30 22.0 31 32.0 32 64.0 33 90.0 34 213.0 35 582.0 36 2692.0 37 233.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.175 24.25 9.8 26.775 2 27.375 25.974999999999998 30.0 16.650000000000002 3 20.3 27.375 32.5 19.825 4 23.599999999999998 34.75 22.650000000000002 19.0 5 25.0 37.4 21.425 16.175 6 22.0 38.625 22.525000000000002 16.85 7 21.65 23.425 36.225 18.7 8 20.125 26.200000000000003 28.249999999999996 25.424999999999997 9 23.35 23.625 29.349999999999998 23.674999999999997 10-14 23.794999999999998 29.2 26.334999999999997 20.669999999999998 15-19 23.055 27.58 27.98 21.385 20-24 22.91 27.91 27.715 21.465 25-29 23.275000000000002 28.060000000000002 27.375 21.29 30-34 23.035 28.035 27.755000000000003 21.175 35-39 22.64 28.04 27.700000000000003 21.62 40-44 23.095 28.17 27.229999999999997 21.505 45-49 23.0 27.62 27.91 21.47 50-54 23.03 27.62 27.85 21.5 55-59 22.855 28.395 27.839999999999996 20.91 60-64 23.23 28.505000000000003 27.205000000000002 21.060000000000002 65-69 23.02 27.29 27.97 21.72 70-74 22.905 27.665 27.794999999999998 21.634999999999998 75-79 23.555 27.395000000000003 27.834999999999997 21.215 80-84 22.725 28.58 26.790000000000003 21.905 85-89 23.775 28.265 27.08 20.880000000000003 90-94 23.880000000000003 27.284999999999997 27.200000000000003 21.634999999999998 95-99 23.74 27.67 27.675 20.915 100-104 24.025 28.22 26.88 20.875 105-109 23.7 27.33 28.044999999999998 20.925 110-114 23.735 26.965 28.105000000000004 21.195 115-119 24.21 27.245 27.925 20.62 120-124 24.0 27.725 27.685 20.59 125-129 24.425 27.089999999999996 27.495000000000005 20.990000000000002 130-134 24.84 27.41 27.205000000000002 20.544999999999998 135-139 24.77 27.165 27.639999999999997 20.424999999999997 140-144 24.515 27.034999999999997 27.91 20.54 145-149 24.91 27.779999999999998 27.029999999999998 20.28 150-151 24.712500000000002 28.6125 27.175 19.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.5 16 2.0 17 1.0 18 0.0 19 0.5 20 0.5 21 1.5 22 2.0 23 0.5 24 1.5 25 2.5 26 3.5 27 4.0 28 2.5 29 6.5 30 13.5 31 22.0 32 28.0 33 32.0 34 47.0 35 64.5 36 75.0 37 101.0 38 130.0 39 152.0 40 191.5 41 224.0 42 245.0 43 268.0 44 273.0 45 262.0 46 243.0 47 234.0 48 233.5 49 208.5 50 176.0 51 147.0 52 114.5 53 93.5 54 90.0 55 80.5 56 62.0 57 48.5 58 28.5 59 19.5 60 21.5 61 12.5 62 6.5 63 5.5 64 3.0 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.2832674571805 90.4 2 4.242424242424243 8.05 3 0.3425559947299078 0.975 4 0.07905138339920949 0.3 5 0.026350461133069828 0.125 6 0.026350461133069828 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.7750000000000004 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACCTC 10 0.006830828 145.0 3 TTATTTG 10 0.006830828 145.0 4 AAGCGTG 10 0.006830828 145.0 145 TACCTCT 10 0.006830828 145.0 4 AGCAAAA 10 0.006830828 145.0 2 AATGTCT 10 0.006830828 145.0 9 TTTACCT 10 0.006830828 145.0 2 >>END_MODULE Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525233 spots for SRR12161389.sra Written 525233 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra Read 525218 spots for SRR12161389.sra Written 525218 spots for SRR12161389.sra SRR ids: ['SRR12161389.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__d7vkodr SRR12161389.sra spots: 10504375 blocks: [[1, 525218], [525219, 1050436], [1050437, 1575654], [1575655, 2100872], [2100873, 2626090], [2626091, 3151308], [3151309, 3676526], [3676527, 4201744], [4201745, 4726962], [4726963, 5252180], [5252181, 5777398], [5777399, 6302616], [6302617, 6827834], [6827835, 7353052], [7353053, 7878270], [7878271, 8403488], [8403489, 8928706], [8928707, 9453924], [9453925, 9979142], [9979143, 10504375]] SRR12161389 file size 3548145 SRR12161389 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161389 SRR12161389_1.fastq SRR12161389_2.fastq Input file: SRR12161389_1.fastq Paired file: SRR12161389_2.fastq trimmed: SRR12161389-trimmed-pair1.fastq, SRR12161389-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:07:20 2025 >> started Thu Feb 13 20:07:38 2025 >> done (18.181s) 10504375 read pairs processed; of these: 7 ( 0.00%) short read pairs filtered out after trimming by size control 797 ( 0.01%) empty read pairs filtered out after trimming by size control 10503571 (99.99%) read pairs available; of these: 557944 ( 5.31%) trimmed read pairs available after processing 9945627 (94.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 2 0.00% 25 5 0.00% 26 3 0.00% 27 2 0.00% 28 2 0.00% 29 3 0.00% 30 4 0.00% 31 4 0.00% 32 5 0.00% 33 6 0.00% 34 4 0.00% 35 4 0.00% 36 3 0.00% 37 6 0.00% 38 6 0.00% 39 6 0.00% 40 8 0.00% 41 4 0.00% 42 7 0.00% 43 7 0.00% 44 4 0.00% 45 7 0.00% 46 8 0.00% 47 13 0.00% 48 12 0.00% 49 9 0.00% 50 19 0.00% 51 19 0.00% 52 21 0.00% 53 23 0.00% 54 25 0.00% 55 21 0.00% 56 23 0.00% 57 29 0.00% 58 26 0.00% 59 34 0.00% 60 33 0.00% 61 57 0.00% 62 46 0.00% 63 58 0.00% 64 57 0.00% 65 69 0.00% 66 68 0.00% 67 83 0.00% 68 117 0.00% 69 107 0.00% 70 131 0.00% 71 155 0.00% 72 168 0.00% 73 176 0.00% 74 233 0.00% 75 214 0.00% 76 253 0.00% 77 270 0.00% 78 269 0.00% 79 349 0.00% 80 380 0.00% 81 405 0.00% 82 507 0.00% 83 592 0.01% 84 643 0.01% 85 742 0.01% 86 759 0.01% 87 898 0.01% 88 1018 0.01% 89 1048 0.01% 90 1143 0.01% 91 1305 0.01% 92 1385 0.01% 93 1472 0.01% 94 1686 0.02% 95 1824 0.02% 96 1974 0.02% 97 2143 0.02% 98 2256 0.02% 99 2461 0.02% 100 2633 0.03% 101 2752 0.03% 102 3096 0.03% 103 3290 0.03% 104 3442 0.03% 105 3734 0.04% 106 3903 0.04% 107 4081 0.04% 108 4369 0.04% 109 4642 0.04% 110 4892 0.05% 111 5079 0.05% 112 5317 0.05% 113 5424 0.05% 114 5925 0.06% 115 6204 0.06% 116 6575 0.06% 117 7001 0.07% 118 7276 0.07% 119 7477 0.07% 120 7897 0.08% 121 8155 0.08% 122 8304 0.08% 123 8800 0.08% 124 9217 0.09% 125 9484 0.09% 126 9975 0.09% 127 10369 0.10% 128 10591 0.10% 129 10960 0.10% 130 11452 0.11% 131 11727 0.11% 132 12151 0.12% 133 12737 0.12% 134 13070 0.12% 135 13508 0.13% 136 14366 0.14% 137 14443 0.14% 138 15214 0.14% 139 15590 0.15% 140 15861 0.15% 141 16314 0.16% 142 17039 0.16% 143 17380 0.17% 144 18280 0.17% 145 18485 0.18% 146 19188 0.18% 147 19375 0.18% 148 20535 0.20% 149 20723 0.20% 150 21695 0.21% 151 9945627 94.69% 10503571 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.77 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=52.24 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=18 prefix-density=0.85 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=17.76 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12161389 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:08:26 Started mapping on | Feb 13 20:08:26 Finished on | Feb 13 20:09:42 Mapping speed, Million of reads per hour | 497.54 Number of input reads | 10503571 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 9913240 Uniquely mapped reads % | 94.38% Average mapped length | 298.64 Number of splices: Total | 10181395 Number of splices: Annotated (sjdb) | 9957449 Number of splices: GT/AG | 9968259 Number of splices: GC/AG | 172492 Number of splices: AT/AC | 6908 Number of splices: Non-canonical | 33736 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.35 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 227263 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 55496 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 363068 363068 363068 N_multimapping 227263 227263 227263 N_noFeature 374065 9763713 414453 N_ambiguous 169366 567 59908 UnstrandedReadsAssigned:9369809 PositiveStrandReadsAssigned:148960 NegativeStrandReadsAssigned:9438879 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161389 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161389-trimmed-pair1.fastq SRR12161389-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,503,571 reads, 9,383,876 reads pseudoaligned [quant] estimated average fragment length: 264.102 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR12161389.ke.tsv 34699 SRR12161389.se.tsv 87100 total ==> SRR12161389.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.9 322 15.2316 Potri.005G024800.1.v4.1 1035 771.898 111 11.9373 Potri.004G059700.1.v4.1 961 697.974 7 0.832533 Potri.007G009000.2.v4.1 1416 1152.9 0 0 Potri.003G141000.2.v4.1 2943 2679.9 429 13.2887 Potri.016G087400.1.v4.1 270 70.33 417.179 492.408 Potri.015G069301.1.v4.1 564 310.811 0 0 Potri.010G195200.1.v4.1 1773 1509.9 7 0.384851 Potri.012G127500.1.v4.1 977 713.944 104 12.0924 ==> SRR12161389.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 128 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 16 Potri.001G452600.v4.1 0 SRR12161389 completed mapping pipeline successfully