Starting /dee2/code/volunteer_pipeline.sh SRR12161390 current disk space = 3088938336256 free memory = 1466333740 SRR12161390 SRAfilesize 6916b26fbfaf544e132f4e6f7f3714e1 SRR12161390.sra SRR12161390.sra file validated SRR12161390 is paired end SRR12161390 is conventional basespace SRR12161390 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161390_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5315 37.0 37.0 37.0 37.0 37.0 2 36.279 37.0 37.0 37.0 37.0 37.0 3 36.55 37.0 37.0 37.0 37.0 37.0 4 36.5675 37.0 37.0 37.0 37.0 37.0 5 36.575 37.0 37.0 37.0 37.0 37.0 6 36.515 37.0 37.0 37.0 37.0 37.0 7 36.4395 37.0 37.0 37.0 37.0 37.0 8 36.5485 37.0 37.0 37.0 37.0 37.0 9 36.4535 37.0 37.0 37.0 37.0 37.0 10-14 36.53339999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4613 37.0 37.0 37.0 37.0 37.0 20-24 36.4405 37.0 37.0 37.0 37.0 37.0 25-29 36.3876 37.0 37.0 37.0 37.0 37.0 30-34 36.3985 37.0 37.0 37.0 37.0 37.0 35-39 36.3789 37.0 37.0 37.0 37.0 37.0 40-44 36.3223 37.0 37.0 37.0 37.0 37.0 45-49 36.366 37.0 37.0 37.0 37.0 37.0 50-54 36.310500000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3219 37.0 37.0 37.0 37.0 37.0 60-64 36.2457 37.0 37.0 37.0 37.0 37.0 65-69 36.2136 37.0 37.0 37.0 37.0 37.0 70-74 36.278200000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.175 37.0 37.0 37.0 37.0 37.0 80-84 36.2455 37.0 37.0 37.0 37.0 37.0 85-89 36.1154 37.0 37.0 37.0 37.0 37.0 90-94 36.15429999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.1638 37.0 37.0 37.0 37.0 37.0 100-104 36.0926 37.0 37.0 37.0 37.0 37.0 105-109 36.043899999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.0523 37.0 37.0 37.0 37.0 37.0 115-119 36.0837 37.0 37.0 37.0 37.0 37.0 120-124 36.0452 37.0 37.0 37.0 37.0 37.0 125-129 35.9875 37.0 37.0 37.0 37.0 37.0 130-134 35.9384 37.0 37.0 37.0 37.0 37.0 135-139 35.949400000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.881600000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.79880000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.80775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 2.0 25 6.0 26 7.0 27 6.0 28 14.0 29 27.0 30 40.0 31 34.0 32 53.0 33 71.0 34 119.0 35 294.0 36 2917.0 37 407.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.025 13.875000000000002 5.375 31.724999999999998 2 20.424999999999997 13.100000000000001 33.425 33.050000000000004 3 15.75 19.625 31.5 33.125 4 20.4 25.575 26.075 27.950000000000003 5 24.325 32.65 23.025000000000002 20.0 6 21.575 35.075 22.775000000000002 20.575 7 16.05 24.975 42.375 16.6 8 16.7 25.900000000000002 31.125000000000004 26.275 9 15.8 23.825 35.449999999999996 24.925 10-14 20.11 29.565 26.565 23.76 15-19 19.35 28.345 27.48 24.825 20-24 20.06 28.51 27.084999999999997 24.345 25-29 21.115000000000002 27.915 26.695 24.275 30-34 20.01 28.555000000000003 27.08 24.355 35-39 20.165 28.38 26.72 24.735 40-44 20.330000000000002 28.13 26.58 24.959999999999997 45-49 20.31 29.054999999999996 26.69 23.945 50-54 20.625 28.060000000000002 27.389999999999997 23.925 55-59 20.145 28.050000000000004 27.655 24.15 60-64 20.705000000000002 28.005000000000003 27.305 23.985 65-69 20.61 28.58 26.93 23.880000000000003 70-74 20.474999999999998 28.465 26.77 24.29 75-79 20.474999999999998 28.455000000000002 26.845000000000002 24.224999999999998 80-84 19.86 27.68 27.725 24.735 85-89 20.630000000000003 28.305000000000003 27.150000000000002 23.915 90-94 20.615 27.065 27.565 24.755 95-99 20.46 27.705000000000002 27.49 24.345 100-104 20.91 27.834999999999997 27.015 24.240000000000002 105-109 20.34 28.095 26.889999999999997 24.675 110-114 20.419999999999998 27.375 27.68 24.525 115-119 21.205 27.495000000000005 27.605 23.695 120-124 21.065 27.83 26.965 24.14 125-129 20.044999999999998 27.384999999999998 27.47 25.1 130-134 20.95 27.279999999999998 28.025 23.745 135-139 21.310000000000002 27.834999999999997 26.605 24.25 140-144 21.09 28.01 26.61 24.29 145-149 20.52 27.57 27.345000000000002 24.565 150-151 22.2 28.0625 26.474999999999998 23.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 2.5 25 4.0 26 4.0 27 9.0 28 11.0 29 13.5 30 19.0 31 23.0 32 29.0 33 48.0 34 65.5 35 65.5 36 78.5 37 93.5 38 106.5 39 138.0 40 171.5 41 175.5 42 189.5 43 225.5 44 232.5 45 230.0 46 237.0 47 245.5 48 256.5 49 234.5 50 200.0 51 180.0 52 145.0 53 114.5 54 101.0 55 85.0 56 73.0 57 57.5 58 33.5 59 26.5 60 23.5 61 16.0 62 10.5 63 5.5 64 3.0 65 2.0 66 1.5 67 2.0 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.525 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7984496124031 87.725 2 5.533279871692061 10.35 3 0.6148088746324512 1.725 4 0.05346164127238706 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.075 0.0 0.0 0.025 0.0 88-89 0.075 0.0 0.0 0.025 0.0 90-91 0.0875 0.0 0.0 0.025 0.0 92-93 0.1125 0.0 0.0 0.025 0.0 94-95 0.125 0.0 0.0 0.025 0.0 96-97 0.125 0.0 0.0 0.025 0.0 98-99 0.1375 0.0 0.0 0.025 0.0 100-101 0.2 0.0 0.0 0.025 0.0 102-103 0.2625 0.0 0.0 0.025 0.0 104-105 0.4125 0.0 0.0 0.025 0.0 106-107 0.475 0.0 0.0 0.025 0.0 108-109 0.575 0.0 0.0 0.025 0.0 110-111 0.675 0.0 0.0 0.025 0.0 112-113 0.775 0.0 0.0 0.025 0.0 114-115 0.9125000000000001 0.0 0.0 0.025 0.0 116-117 0.95 0.0 0.0 0.025 0.0 118-119 1.0 0.0 0.0 0.025 0.0 120-121 1.1749999999999998 0.0 0.0 0.025 0.0 122-123 1.35 0.0 0.0 0.025 0.0 124-125 1.375 0.0 0.0 0.025 0.0 126-127 1.4125 0.0 0.0 0.025 0.0 128-129 1.575 0.0 0.0 0.025 0.0 130-131 1.725 0.0 0.0 0.025 0.0 132-133 1.8875000000000002 0.0 0.0 0.025 0.0 134-135 2.2125 0.0 0.0 0.025 0.0 136-137 2.4375 0.0 0.0 0.025 0.0 138-139 2.7125000000000004 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGCTA 10 0.006830828 145.0 2 ACGACCT 10 0.006830828 145.0 1 GACCTTC 10 0.006830828 145.0 3 CGACCTT 10 0.006830828 145.0 2 >>END_MODULE SRR12161390 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161390_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.149 37.0 37.0 37.0 37.0 37.0 2 35.8255 37.0 37.0 37.0 37.0 37.0 3 35.756 37.0 37.0 37.0 37.0 37.0 4 35.948 37.0 37.0 37.0 37.0 37.0 5 36.0555 37.0 37.0 37.0 37.0 37.0 6 36.178 37.0 37.0 37.0 37.0 37.0 7 36.084 37.0 37.0 37.0 37.0 37.0 8 36.105 37.0 37.0 37.0 37.0 37.0 9 36.168 37.0 37.0 37.0 37.0 37.0 10-14 36.0482 37.0 37.0 37.0 37.0 37.0 15-19 36.0595 37.0 37.0 37.0 37.0 37.0 20-24 35.9979 37.0 37.0 37.0 37.0 37.0 25-29 35.9804 37.0 37.0 37.0 37.0 37.0 30-34 35.975 37.0 37.0 37.0 37.0 37.0 35-39 35.939099999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.8875 37.0 37.0 37.0 37.0 37.0 45-49 35.8476 37.0 37.0 37.0 37.0 37.0 50-54 35.7959 37.0 37.0 37.0 37.0 37.0 55-59 35.7489 37.0 37.0 37.0 37.0 37.0 60-64 35.7762 37.0 37.0 37.0 37.0 37.0 65-69 35.752 37.0 37.0 37.0 37.0 37.0 70-74 35.654700000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.647800000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.6918 37.0 37.0 37.0 37.0 37.0 85-89 35.6667 37.0 37.0 37.0 37.0 37.0 90-94 35.599900000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.586400000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.5828 37.0 37.0 37.0 37.0 37.0 105-109 35.563399999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.5713 37.0 37.0 37.0 37.0 37.0 115-119 35.561699999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.5245 37.0 37.0 37.0 37.0 37.0 125-129 35.4221 37.0 37.0 37.0 37.0 37.0 130-134 35.2937 37.0 37.0 37.0 34.6 37.0 135-139 35.3995 37.0 37.0 37.0 37.0 37.0 140-144 35.329 37.0 37.0 37.0 34.6 37.0 145-149 35.3446 37.0 37.0 37.0 34.6 37.0 150-151 34.85625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 8.0 14 9.0 15 4.0 16 2.0 17 3.0 18 5.0 19 6.0 20 4.0 21 5.0 22 4.0 23 5.0 24 9.0 25 5.0 26 8.0 27 18.0 28 9.0 29 26.0 30 23.0 31 59.0 32 68.0 33 116.0 34 187.0 35 523.0 36 2645.0 37 248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.05 26.05 6.225 20.674999999999997 2 30.325000000000003 25.45 27.750000000000004 16.475 3 22.175 28.175 31.3 18.35 4 22.975 36.625 21.45 18.95 5 25.424999999999997 37.974999999999994 19.3 17.299999999999997 6 23.075000000000003 39.1 18.875 18.95 7 21.25 23.875 35.4 19.475 8 21.3 27.0 26.875 24.825 9 23.075000000000003 24.3 28.249999999999996 24.375 10-14 24.560000000000002 29.45 25.455 20.535 15-19 24.13 27.405 27.665 20.8 20-24 23.724999999999998 28.515 26.52 21.240000000000002 25-29 23.525 28.785 26.71 20.979999999999997 30-34 23.505000000000003 28.555000000000003 26.895000000000003 21.044999999999998 35-39 23.380000000000003 27.750000000000004 27.474999999999998 21.395 40-44 24.3 27.894999999999996 26.935 20.87 45-49 23.855 27.860000000000003 27.084999999999997 21.2 50-54 23.615 28.125 26.740000000000002 21.52 55-59 23.965 27.49 27.51 21.035 60-64 23.645 27.54 27.105 21.709999999999997 65-69 24.315 27.425 27.325 20.935000000000002 70-74 24.705 26.915 26.82 21.560000000000002 75-79 24.22 28.15 26.305 21.325 80-84 23.625 28.23 26.584999999999997 21.560000000000002 85-89 23.974999999999998 27.189999999999998 27.205000000000002 21.63 90-94 24.044999999999998 27.85 26.47 21.634999999999998 95-99 24.015 27.694999999999997 26.71 21.58 100-104 24.18 27.79 26.865 21.165 105-109 24.08 27.295 27.275 21.349999999999998 110-114 24.03 27.555000000000003 27.08 21.335 115-119 23.9 27.205000000000002 27.68 21.215 120-124 24.27 27.27 27.560000000000002 20.9 125-129 24.625 27.894999999999996 26.02 21.46 130-134 24.34 27.77 26.93 20.96 135-139 24.73 27.27 26.790000000000003 21.21 140-144 24.310000000000002 27.689999999999998 27.125 20.875 145-149 24.69 27.77 26.405 21.135 150-151 25.687500000000004 27.725 25.924999999999997 20.6625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.0 21 3.0 22 3.0 23 2.0 24 3.5 25 4.5 26 2.5 27 4.0 28 7.0 29 8.5 30 9.0 31 10.5 32 17.5 33 33.0 34 42.0 35 58.5 36 74.0 37 79.0 38 99.0 39 132.5 40 162.0 41 195.5 42 225.5 43 245.0 44 256.0 45 265.0 46 261.5 47 252.0 48 238.0 49 230.0 50 226.0 51 169.0 52 132.0 53 115.5 54 100.0 55 86.5 56 57.0 57 44.0 58 33.5 59 25.5 60 21.5 61 11.0 62 6.5 63 7.5 64 5.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 1.0 71 1.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 1.0 86 1.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 1.0 96 0.5 97 0.5 98 1.0 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.92072844134975 87.675 2 5.463310123192287 10.2 3 0.45527584359935724 1.275 4 0.08034279592929834 0.3 5 0.02678093197643278 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02678093197643278 0.2 9 0.02678093197643278 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1749999999999998 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.8875000000000002 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.4125 0.0 0.0 0.0 0.0 138-139 2.6624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTCAA 10 0.006830828 145.0 4 CCGTTCA 10 0.006830828 145.0 3 TCCGTTC 10 0.006830828 145.0 2 AAGGACT 10 0.006830828 145.0 9 ATCCGTT 10 0.006830828 145.0 1 >>END_MODULE Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757466 spots for SRR12161390.sra Written 757466 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra Read 757457 spots for SRR12161390.sra Written 757457 spots for SRR12161390.sra SRR ids: ['SRR12161390.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v_jajnum SRR12161390.sra spots: 15149149 blocks: [[1, 757457], [757458, 1514914], [1514915, 2272371], [2272372, 3029828], [3029829, 3787285], [3787286, 4544742], [4544743, 5302199], [5302200, 6059656], [6059657, 6817113], [6817114, 7574570], [7574571, 8332027], [8332028, 9089484], [9089485, 9846941], [9846942, 10604398], [10604399, 11361855], [11361856, 12119312], [12119313, 12876769], [12876770, 13634226], [13634227, 14391683], [14391684, 15149149]] SRR12161390 file size 5126643 SRR12161390 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161390 SRR12161390_1.fastq SRR12161390_2.fastq Input file: SRR12161390_1.fastq Paired file: SRR12161390_2.fastq trimmed: SRR12161390-trimmed-pair1.fastq, SRR12161390-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:12:46 2025 >> started Thu Feb 13 16:13:02 2025 >> done (15.739s) 15149149 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 3147 ( 0.02%) empty read pairs filtered out after trimming by size control 15145967 (99.98%) read pairs available; of these: 737231 ( 4.87%) trimmed read pairs available after processing 14408736 (95.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 1 0.00% 21 3 0.00% 22 7 0.00% 23 11 0.00% 24 10 0.00% 25 15 0.00% 26 17 0.00% 27 18 0.00% 28 16 0.00% 29 15 0.00% 30 10 0.00% 31 26 0.00% 32 13 0.00% 33 12 0.00% 34 18 0.00% 35 20 0.00% 36 11 0.00% 37 18 0.00% 38 18 0.00% 39 22 0.00% 40 14 0.00% 41 25 0.00% 42 26 0.00% 43 18 0.00% 44 23 0.00% 45 25 0.00% 46 27 0.00% 47 33 0.00% 48 32 0.00% 49 25 0.00% 50 38 0.00% 51 25 0.00% 52 29 0.00% 53 29 0.00% 54 37 0.00% 55 49 0.00% 56 40 0.00% 57 46 0.00% 58 53 0.00% 59 60 0.00% 60 60 0.00% 61 83 0.00% 62 86 0.00% 63 107 0.00% 64 118 0.00% 65 109 0.00% 66 105 0.00% 67 131 0.00% 68 139 0.00% 69 154 0.00% 70 182 0.00% 71 204 0.00% 72 223 0.00% 73 268 0.00% 74 272 0.00% 75 322 0.00% 76 355 0.00% 77 391 0.00% 78 390 0.00% 79 471 0.00% 80 534 0.00% 81 624 0.00% 82 684 0.00% 83 741 0.00% 84 854 0.01% 85 906 0.01% 86 1006 0.01% 87 1067 0.01% 88 1234 0.01% 89 1348 0.01% 90 1453 0.01% 91 1674 0.01% 92 1941 0.01% 93 2004 0.01% 94 2102 0.01% 95 2418 0.02% 96 2481 0.02% 97 2625 0.02% 98 2888 0.02% 99 2915 0.02% 100 3337 0.02% 101 3440 0.02% 102 4018 0.03% 103 4189 0.03% 104 4581 0.03% 105 4890 0.03% 106 5061 0.03% 107 5216 0.03% 108 5433 0.04% 109 5742 0.04% 110 5924 0.04% 111 6348 0.04% 112 6951 0.05% 113 7398 0.05% 114 7777 0.05% 115 8217 0.05% 116 8499 0.06% 117 8744 0.06% 118 9185 0.06% 119 9399 0.06% 120 9862 0.07% 121 10552 0.07% 122 10917 0.07% 123 11572 0.08% 124 12110 0.08% 125 12788 0.08% 126 13452 0.09% 127 13453 0.09% 128 13981 0.09% 129 14448 0.10% 130 14728 0.10% 131 15381 0.10% 132 16320 0.11% 133 17219 0.11% 134 17874 0.12% 135 18595 0.12% 136 19189 0.13% 137 19549 0.13% 138 20014 0.13% 139 20282 0.13% 140 20632 0.14% 141 21115 0.14% 142 22293 0.15% 143 23194 0.15% 144 24416 0.16% 145 25413 0.17% 146 26200 0.17% 147 26638 0.18% 148 27358 0.18% 149 27848 0.18% 150 28880 0.19% 151 14408736 95.13% 15145967 reads passed initial QC criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=22 prefix-density=1.05 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.21 sequence-density-rank=20 fanout-score=8.81 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=5.6 sequence=TCGTTCTTGTCTTCCTTCTCCAC criterion=sequence-density sequence-density=1.22 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=27 prefix-density=1.21 prefix-fanout=1.9 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=33.53 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATTGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12161390 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:13:43 Started mapping on | Feb 13 16:13:44 Finished on | Feb 13 16:15:08 Mapping speed, Million of reads per hour | 649.11 Number of input reads | 15145967 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13924985 Uniquely mapped reads % | 91.94% Average mapped length | 298.73 Number of splices: Total | 12899463 Number of splices: Annotated (sjdb) | 12616665 Number of splices: GT/AG | 12634887 Number of splices: GC/AG | 215792 Number of splices: AT/AC | 12081 Number of splices: Non-canonical | 36703 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412571 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 110442 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 808411 808411 808411 N_multimapping 412571 412571 412571 N_noFeature 372270 13712522 424975 N_ambiguous 251277 868 91004 UnstrandedReadsAssigned:13301438 PositiveStrandReadsAssigned:211595 NegativeStrandReadsAssigned:13409006 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161390 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161390-trimmed-pair1.fastq SRR12161390-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,145,967 reads, 13,515,090 reads pseudoaligned [quant] estimated average fragment length: 277.588 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR12161390.ke.tsv 34699 SRR12161390.se.tsv 87100 total ==> SRR12161390.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.41 373 11.6406 Potri.005G024800.1.v4.1 1035 758.412 129 9.24385 Potri.004G059700.1.v4.1 961 684.557 24 1.90533 Potri.007G009000.2.v4.1 1416 1139.41 0 0 Potri.003G141000.2.v4.1 2943 2666.41 362.341 7.38514 Potri.016G087400.1.v4.1 270 71.1934 940 717.558 Potri.015G069301.1.v4.1 564 302.913 0 0 Potri.010G195200.1.v4.1 1773 1496.41 0 0 Potri.012G127500.1.v4.1 977 700.478 518 40.1887 ==> SRR12161390.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 51 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 127 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR12161390 completed mapping pipeline successfully