Starting /dee2/code/volunteer_pipeline.sh SRR12161391 current disk space = 3088902766592 free memory = 1434280032 SRR12161391 SRAfilesize 288c4234d3a70825adf760cad24317b9 SRR12161391.sra SRR12161391.sra file validated SRR12161391 is paired end SRR12161391 is conventional basespace SRR12161391 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161391_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.53775 37.0 37.0 37.0 37.0 37.0 2 36.4955 37.0 37.0 37.0 37.0 37.0 3 36.545 37.0 37.0 37.0 37.0 37.0 4 36.648 37.0 37.0 37.0 37.0 37.0 5 36.606 37.0 37.0 37.0 37.0 37.0 6 36.557 37.0 37.0 37.0 37.0 37.0 7 36.53 37.0 37.0 37.0 37.0 37.0 8 36.65 37.0 37.0 37.0 37.0 37.0 9 36.5345 37.0 37.0 37.0 37.0 37.0 10-14 36.600100000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5595 37.0 37.0 37.0 37.0 37.0 20-24 36.4998 37.0 37.0 37.0 37.0 37.0 25-29 36.445100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.472899999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4548 37.0 37.0 37.0 37.0 37.0 40-44 36.4259 37.0 37.0 37.0 37.0 37.0 45-49 36.4205 37.0 37.0 37.0 37.0 37.0 50-54 36.383500000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3649 37.0 37.0 37.0 37.0 37.0 60-64 36.38029999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3435 37.0 37.0 37.0 37.0 37.0 70-74 36.3244 37.0 37.0 37.0 37.0 37.0 75-79 36.2679 37.0 37.0 37.0 37.0 37.0 80-84 36.290499999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.310300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.313700000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2919 37.0 37.0 37.0 37.0 37.0 100-104 36.24490000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.1857 37.0 37.0 37.0 37.0 37.0 110-114 36.21079999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.1865 37.0 37.0 37.0 37.0 37.0 120-124 36.0769 37.0 37.0 37.0 37.0 37.0 125-129 36.0601 37.0 37.0 37.0 37.0 37.0 130-134 36.1078 37.0 37.0 37.0 37.0 37.0 135-139 35.976600000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.91519999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.9248 37.0 37.0 37.0 37.0 37.0 150-151 35.806250000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 0.0 25 4.0 26 3.0 27 3.0 28 11.0 29 13.0 30 11.0 31 48.0 32 33.0 33 81.0 34 126.0 35 305.0 36 2966.0 37 393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.81020255063766 12.253063265816454 6.351587896974244 40.58514628657164 2 20.45 11.725 36.425000000000004 31.4 3 16.05 16.5 29.099999999999998 38.35 4 21.6 24.325 24.725 29.349999999999998 5 22.425 30.075000000000003 24.875 22.625 6 20.849999999999998 33.15 23.849999999999998 22.15 7 14.7 26.075 42.475 16.75 8 16.900000000000002 25.85 31.874999999999996 25.374999999999996 9 16.2 23.974999999999998 35.25 24.575 10-14 19.825 29.74 27.49 22.945 15-19 20.005 28.1 27.6 24.295 20-24 19.470000000000002 28.29 28.16 24.08 25-29 19.705000000000002 27.889999999999997 28.34 24.065 30-34 20.195 28.235 27.474999999999998 24.095 35-39 19.48 28.139999999999997 27.794999999999998 24.585 40-44 19.99 28.439999999999998 27.49 24.08 45-49 19.66 28.33 27.24 24.77 50-54 20.04 27.825 28.634999999999998 23.5 55-59 20.294999999999998 27.46 28.23 24.015 60-64 19.59 27.925 28.16 24.325 65-69 19.939999999999998 27.675 28.189999999999998 24.195 70-74 20.39 28.15 27.6 23.86 75-79 19.945 27.505000000000003 28.13 24.42 80-84 20.215 27.865000000000002 27.565 24.355 85-89 20.165 27.62 28.165000000000003 24.05 90-94 20.59 27.815 27.365000000000002 24.23 95-99 20.355 28.485 27.334999999999997 23.825 100-104 20.89 27.83 27.575 23.705000000000002 105-109 20.7 27.6 27.87 23.830000000000002 110-114 20.715 27.915 27.67 23.7 115-119 20.555 28.22 27.405 23.82 120-124 20.995 28.244999999999997 26.945000000000004 23.815 125-129 20.645 28.055000000000003 27.66 23.64 130-134 20.7 27.935 27.589999999999996 23.775 135-139 21.345 27.02 27.644999999999996 23.990000000000002 140-144 21.27 27.474999999999998 27.634999999999998 23.62 145-149 20.919999999999998 28.025 27.384999999999998 23.669999999999998 150-151 21.025 27.4125 27.3125 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 2.0 21 3.0 22 4.0 23 3.0 24 2.5 25 2.5 26 3.5 27 5.5 28 10.5 29 15.5 30 15.5 31 23.0 32 36.0 33 41.5 34 45.0 35 51.5 36 73.0 37 99.0 38 118.5 39 139.0 40 164.0 41 193.5 42 228.0 43 245.0 44 256.5 45 278.5 46 277.5 47 265.0 48 266.0 49 229.0 50 179.5 51 146.0 52 124.5 53 123.0 54 94.0 55 66.5 56 53.0 57 35.0 58 20.0 59 18.5 60 18.5 61 11.0 62 5.0 63 3.0 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 95.66013071895425 91.475 2 4.156862745098039 7.95 3 0.1568627450980392 0.44999999999999996 4 0.0 0.0 5 0.026143790849673207 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 2.025 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.5250000000000004 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.2750000000000004 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATCAT 25 8.7132835E-4 87.0 1 >>END_MODULE SRR12161391 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161391_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.283 37.0 37.0 37.0 37.0 37.0 2 36.108 37.0 37.0 37.0 37.0 37.0 3 36.106 37.0 37.0 37.0 37.0 37.0 4 36.1845 37.0 37.0 37.0 37.0 37.0 5 36.301 37.0 37.0 37.0 37.0 37.0 6 36.347 37.0 37.0 37.0 37.0 37.0 7 36.267 37.0 37.0 37.0 37.0 37.0 8 36.414 37.0 37.0 37.0 37.0 37.0 9 36.2675 37.0 37.0 37.0 37.0 37.0 10-14 36.327 37.0 37.0 37.0 37.0 37.0 15-19 36.3027 37.0 37.0 37.0 37.0 37.0 20-24 36.278099999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.1831 37.0 37.0 37.0 37.0 37.0 30-34 36.227199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1408 37.0 37.0 37.0 37.0 37.0 40-44 36.1307 37.0 37.0 37.0 37.0 37.0 45-49 36.112 37.0 37.0 37.0 37.0 37.0 50-54 36.1021 37.0 37.0 37.0 37.0 37.0 55-59 36.056200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.048500000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.986200000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.979200000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.9005 37.0 37.0 37.0 37.0 37.0 80-84 36.0179 37.0 37.0 37.0 37.0 37.0 85-89 35.9432 37.0 37.0 37.0 37.0 37.0 90-94 35.9025 37.0 37.0 37.0 37.0 37.0 95-99 35.8468 37.0 37.0 37.0 37.0 37.0 100-104 35.8649 37.0 37.0 37.0 37.0 37.0 105-109 35.7854 37.0 37.0 37.0 37.0 37.0 110-114 35.7751 37.0 37.0 37.0 37.0 37.0 115-119 35.7676 37.0 37.0 37.0 37.0 37.0 120-124 35.7585 37.0 37.0 37.0 37.0 37.0 125-129 35.5828 37.0 37.0 37.0 37.0 37.0 130-134 35.5865 37.0 37.0 37.0 37.0 37.0 135-139 35.611000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.5197 37.0 37.0 37.0 37.0 37.0 145-149 35.6314 37.0 37.0 37.0 37.0 37.0 150-151 35.0025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 3.0 16 0.0 17 1.0 18 0.0 19 0.0 20 4.0 21 5.0 22 1.0 23 6.0 24 9.0 25 2.0 26 6.0 27 6.0 28 17.0 29 22.0 30 16.0 31 50.0 32 43.0 33 89.0 34 197.0 35 548.0 36 2688.0 37 283.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.925 24.325 9.125 25.624999999999996 2 27.375 26.825 30.375000000000004 15.425 3 19.475 29.099999999999998 32.75 18.675 4 22.625 35.25 22.925 19.2 5 25.224999999999998 38.35 20.275000000000002 16.150000000000002 6 20.525 41.225 21.099999999999998 17.150000000000002 7 20.549999999999997 22.7 37.125 19.625 8 21.825 25.575 28.025 24.575 9 22.650000000000002 25.6 30.175 21.575 10-14 23.45 29.49 25.564999999999998 21.495 15-19 23.11 29.115000000000002 27.13 20.645 20-24 22.36 29.580000000000002 27.310000000000002 20.75 25-29 22.384999999999998 29.035 27.534999999999997 21.044999999999998 30-34 22.81 28.27 27.82 21.099999999999998 35-39 22.88 29.060000000000002 26.56 21.5 40-44 23.73 27.605 27.639999999999997 21.025 45-49 23.36 27.884999999999998 27.93 20.825 50-54 23.56 28.075 27.54 20.825 55-59 22.884999999999998 27.37 28.494999999999997 21.25 60-64 23.075000000000003 27.694999999999997 27.785 21.445 65-69 23.25 27.97 27.810000000000002 20.97 70-74 23.43 27.534999999999997 27.465 21.57 75-79 23.52 27.200000000000003 27.615000000000002 21.665 80-84 22.935 28.425 27.295 21.345 85-89 23.345 27.884999999999998 27.48 21.29 90-94 22.869999999999997 28.12 27.189999999999998 21.82 95-99 23.189999999999998 27.500000000000004 27.845 21.465 100-104 23.275000000000002 28.395 27.3 21.029999999999998 105-109 23.815 27.805000000000003 27.13 21.25 110-114 23.34 28.09 27.49 21.08 115-119 23.91 28.095 27.534999999999997 20.46 120-124 24.52 27.975 26.85 20.655 125-129 24.335 28.595 27.175 19.895 130-134 25.014999999999997 27.925 26.41 20.65 135-139 24.490000000000002 28.499999999999996 27.139999999999997 19.869999999999997 140-144 24.29 28.08 27.11 20.52 145-149 25.25 28.000000000000004 26.540000000000003 20.21 150-151 24.075 28.8375 27.425 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.0 24 3.0 25 3.0 26 3.5 27 7.5 28 7.5 29 7.0 30 10.5 31 17.5 32 25.5 33 33.5 34 43.5 35 73.5 36 92.5 37 111.0 38 143.5 39 164.5 40 189.5 41 217.5 42 239.0 43 255.0 44 269.5 45 271.0 46 260.5 47 258.0 48 241.5 49 207.5 50 173.0 51 129.0 52 111.5 53 101.5 54 85.0 55 62.5 56 43.5 57 33.0 58 22.0 59 22.5 60 16.5 61 7.5 62 4.5 63 5.0 64 3.5 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 1.5 87 1.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.37085744345082 90.64999999999999 2 4.208311415044713 8.0 3 0.289321409784324 0.8250000000000001 4 0.10520778537611783 0.4 5 0.026301946344029457 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.3625 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651582 spots for SRR12161391.sra Written 651582 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra Read 651564 spots for SRR12161391.sra Written 651564 spots for SRR12161391.sra SRR ids: ['SRR12161391.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__ynbephk SRR12161391.sra spots: 13031298 blocks: [[1, 651564], [651565, 1303128], [1303129, 1954692], [1954693, 2606256], [2606257, 3257820], [3257821, 3909384], [3909385, 4560948], [4560949, 5212512], [5212513, 5864076], [5864077, 6515640], [6515641, 7167204], [7167205, 7818768], [7818769, 8470332], [8470333, 9121896], [9121897, 9773460], [9773461, 10425024], [10425025, 11076588], [11076589, 11728152], [11728153, 12379716], [12379717, 13031298]] SRR12161391 file size 4406904 SRR12161391 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161391 SRR12161391_1.fastq SRR12161391_2.fastq Input file: SRR12161391_1.fastq Paired file: SRR12161391_2.fastq trimmed: SRR12161391-trimmed-pair1.fastq, SRR12161391-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:14:24 2025 >> started Thu Feb 13 16:14:38 2025 >> done (14.474s) 13031298 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 987 ( 0.01%) empty read pairs filtered out after trimming by size control 13030291 (99.99%) read pairs available; of these: 861303 ( 6.61%) trimmed read pairs available after processing 12168988 (93.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 1 0.00% 24 1 0.00% 25 5 0.00% 26 5 0.00% 27 3 0.00% 28 8 0.00% 29 6 0.00% 30 10 0.00% 31 9 0.00% 32 5 0.00% 33 8 0.00% 34 4 0.00% 35 9 0.00% 36 4 0.00% 37 6 0.00% 38 19 0.00% 39 17 0.00% 40 6 0.00% 41 11 0.00% 42 20 0.00% 43 12 0.00% 44 21 0.00% 45 13 0.00% 46 12 0.00% 47 26 0.00% 48 14 0.00% 49 16 0.00% 50 20 0.00% 51 21 0.00% 52 32 0.00% 53 34 0.00% 54 42 0.00% 55 31 0.00% 56 31 0.00% 57 59 0.00% 58 54 0.00% 59 56 0.00% 60 69 0.00% 61 73 0.00% 62 85 0.00% 63 99 0.00% 64 113 0.00% 65 104 0.00% 66 120 0.00% 67 123 0.00% 68 154 0.00% 69 173 0.00% 70 193 0.00% 71 216 0.00% 72 249 0.00% 73 274 0.00% 74 322 0.00% 75 360 0.00% 76 438 0.00% 77 505 0.00% 78 492 0.00% 79 586 0.00% 80 632 0.00% 81 731 0.01% 82 843 0.01% 83 924 0.01% 84 1012 0.01% 85 1137 0.01% 86 1300 0.01% 87 1493 0.01% 88 1596 0.01% 89 1703 0.01% 90 1914 0.01% 91 2218 0.02% 92 2357 0.02% 93 2657 0.02% 94 2914 0.02% 95 3124 0.02% 96 3351 0.03% 97 3652 0.03% 98 3864 0.03% 99 4135 0.03% 100 4555 0.03% 101 4760 0.04% 102 5145 0.04% 103 5506 0.04% 104 5963 0.05% 105 6298 0.05% 106 6902 0.05% 107 6996 0.05% 108 7441 0.06% 109 7945 0.06% 110 8160 0.06% 111 8511 0.07% 112 9004 0.07% 113 9533 0.07% 114 10044 0.08% 115 10700 0.08% 116 10867 0.08% 117 11555 0.09% 118 11919 0.09% 119 12240 0.09% 120 12925 0.10% 121 13320 0.10% 122 13774 0.11% 123 14334 0.11% 124 14932 0.11% 125 15246 0.12% 126 16214 0.12% 127 16563 0.13% 128 17255 0.13% 129 17423 0.13% 130 17794 0.14% 131 18307 0.14% 132 19177 0.15% 133 19482 0.15% 134 20517 0.16% 135 20757 0.16% 136 21448 0.16% 137 21857 0.17% 138 22415 0.17% 139 23102 0.18% 140 23495 0.18% 141 24418 0.19% 142 24756 0.19% 143 25202 0.19% 144 25651 0.20% 145 26977 0.21% 146 27309 0.21% 147 27800 0.21% 148 28672 0.22% 149 29063 0.22% 150 30106 0.23% 151 12168988 93.39% 13030291 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=32 prefix-density=0.57 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.26 sequence-density-rank=12 fanout-score=25.01 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=7.3 sequence=TCATCTTCAATCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=32 prefix-density=0.41 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=378.09 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=18.2 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTC SRR12161391 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:15:18 Started mapping on | Feb 13 16:15:19 Finished on | Feb 13 16:16:32 Mapping speed, Million of reads per hour | 642.59 Number of input reads | 13030291 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12236417 Uniquely mapped reads % | 93.91% Average mapped length | 297.95 Number of splices: Total | 11305663 Number of splices: Annotated (sjdb) | 11007901 Number of splices: GT/AG | 11091467 Number of splices: GC/AG | 173161 Number of splices: AT/AC | 10171 Number of splices: Non-canonical | 30864 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.03% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364139 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 106618 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.27% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 429735 429735 429735 N_multimapping 364139 364139 364139 N_noFeature 475404 12096368 528713 N_ambiguous 161913 700 74707 UnstrandedReadsAssigned:11599100 PositiveStrandReadsAssigned:139349 NegativeStrandReadsAssigned:11632997 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161391 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161391-trimmed-pair1.fastq SRR12161391-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,030,291 reads, 11,722,447 reads pseudoaligned [quant] estimated average fragment length: 268.754 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR12161391.ke.tsv 34699 SRR12161391.se.tsv 87100 total ==> SRR12161391.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.25 366 16.251 Potri.005G024800.1.v4.1 1035 767.246 119 12.0534 Potri.004G059700.1.v4.1 961 693.392 48 5.37972 Potri.007G009000.2.v4.1 1416 1148.25 0 0 Potri.003G141000.2.v4.1 2943 2675.25 441.557 12.8269 Potri.016G087400.1.v4.1 270 74.4731 973 1015.34 Potri.015G069301.1.v4.1 564 308.563 0 0 Potri.010G195200.1.v4.1 1773 1505.25 2 0.103257 Potri.012G127500.1.v4.1 977 709.325 703 77.0207 ==> SRR12161391.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 152 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 129 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR12161391 completed mapping pipeline successfully