Starting /dee2/code/volunteer_pipeline.sh SRR12161392 current disk space = 3087575977984 free memory = 1471766240 SRR12161392 SRAfilesize aad22a27a3d06be654c9d57ae481d6bf SRR12161392.sra SRR12161392.sra file validated SRR12161392 is paired end SRR12161392 is conventional basespace SRR12161392 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161392_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4405 37.0 37.0 37.0 37.0 37.0 2 36.4035 37.0 37.0 37.0 37.0 37.0 3 36.457 37.0 37.0 37.0 37.0 37.0 4 36.522 37.0 37.0 37.0 37.0 37.0 5 36.599 37.0 37.0 37.0 37.0 37.0 6 36.6155 37.0 37.0 37.0 37.0 37.0 7 36.455 37.0 37.0 37.0 37.0 37.0 8 36.5125 37.0 37.0 37.0 37.0 37.0 9 36.532 37.0 37.0 37.0 37.0 37.0 10-14 36.559000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5741 37.0 37.0 37.0 37.0 37.0 20-24 36.5192 37.0 37.0 37.0 37.0 37.0 25-29 36.485 37.0 37.0 37.0 37.0 37.0 30-34 36.467 37.0 37.0 37.0 37.0 37.0 35-39 36.467200000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.461 37.0 37.0 37.0 37.0 37.0 45-49 36.4059 37.0 37.0 37.0 37.0 37.0 50-54 36.397800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3711 37.0 37.0 37.0 37.0 37.0 60-64 36.332499999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3139 37.0 37.0 37.0 37.0 37.0 70-74 36.3563 37.0 37.0 37.0 37.0 37.0 75-79 36.2965 37.0 37.0 37.0 37.0 37.0 80-84 36.3052 37.0 37.0 37.0 37.0 37.0 85-89 36.2504 37.0 37.0 37.0 37.0 37.0 90-94 36.255700000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2019 37.0 37.0 37.0 37.0 37.0 100-104 36.2065 37.0 37.0 37.0 37.0 37.0 105-109 36.128699999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1462 37.0 37.0 37.0 37.0 37.0 115-119 36.1327 37.0 37.0 37.0 37.0 37.0 120-124 36.0794 37.0 37.0 37.0 37.0 37.0 125-129 36.031099999999995 37.0 37.0 37.0 37.0 37.0 130-134 36.0289 37.0 37.0 37.0 37.0 37.0 135-139 35.950300000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.9159 37.0 37.0 37.0 37.0 37.0 145-149 35.8882 37.0 37.0 37.0 37.0 37.0 150-151 35.768249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 4.0 25 2.0 26 5.0 27 5.0 28 13.0 29 21.0 30 13.0 31 31.0 32 43.0 33 75.0 34 142.0 35 289.0 36 2951.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.19659829914958 12.681340670335167 6.228114057028514 37.89394697348674 2 19.6 13.325000000000001 35.975 31.1 3 15.9 18.0 27.875 38.224999999999994 4 22.625 24.925 23.825 28.625 5 23.45 31.3 23.3 21.95 6 21.25 33.975 23.35 21.425 7 15.375 26.375 40.949999999999996 17.299999999999997 8 16.925 27.400000000000002 31.85 23.825 9 16.825000000000003 24.575 35.199999999999996 23.400000000000002 10-14 19.580000000000002 30.125 27.405 22.89 15-19 20.05 28.005000000000003 27.975 23.97 20-24 19.905 28.87 27.785 23.44 25-29 19.34 28.82 27.839999999999996 24.0 30-34 19.68 28.985 27.425 23.91 35-39 19.939999999999998 28.88 27.229999999999997 23.95 40-44 19.91 28.65 27.450000000000003 23.990000000000002 45-49 19.665 28.665000000000003 27.665 24.005000000000003 50-54 19.485 28.67 27.425 24.42 55-59 19.835 28.505000000000003 27.555000000000003 24.104999999999997 60-64 19.88 28.299999999999997 27.389999999999997 24.43 65-69 20.345 27.93 28.139999999999997 23.585 70-74 19.845 28.43 27.67 24.055 75-79 19.895 28.065 27.93 24.11 80-84 20.21 28.935 26.795 24.060000000000002 85-89 19.985 28.59 27.584999999999997 23.84 90-94 20.544999999999998 28.09 27.605 23.76 95-99 20.305 28.925 27.21 23.56 100-104 20.419999999999998 28.79 27.065 23.724999999999998 105-109 20.505000000000003 28.055000000000003 27.565 23.875 110-114 20.68 27.96 27.445000000000004 23.915 115-119 20.25 28.37 27.639999999999997 23.74 120-124 20.544999999999998 28.305000000000003 27.500000000000004 23.65 125-129 20.895 28.235 27.05 23.82 130-134 20.305 28.555000000000003 27.029999999999998 24.11 135-139 20.68 28.17 27.29 23.86 140-144 21.15 28.249999999999996 27.13 23.47 145-149 20.405 28.16 27.650000000000002 23.785 150-151 20.4375 27.287499999999998 27.975 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 1.0 24 3.0 25 4.5 26 4.0 27 6.5 28 12.0 29 15.5 30 15.0 31 16.0 32 28.5 33 38.0 34 44.5 35 71.5 36 92.5 37 116.0 38 139.0 39 153.5 40 181.5 41 200.5 42 228.5 43 249.0 44 261.0 45 269.5 46 255.0 47 256.0 48 248.5 49 213.5 50 186.5 51 148.0 52 115.0 53 98.0 54 73.0 55 64.0 56 56.5 57 37.5 58 23.5 59 20.0 60 17.5 61 10.5 62 7.0 63 3.5 64 0.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.375 #Duplication Level Percentage of deduplicated Percentage of total 1 94.43708609271523 89.125 2 5.245033112582782 9.9 3 0.2913907284768212 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.026490066225165563 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6499999999999999 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.2 0.0 0.0 0.0 0.0 134-135 1.45 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138-139 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161392 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161392_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.222 37.0 37.0 37.0 37.0 37.0 2 35.87 37.0 37.0 37.0 37.0 37.0 3 35.9435 37.0 37.0 37.0 37.0 37.0 4 36.126 37.0 37.0 37.0 37.0 37.0 5 36.1025 37.0 37.0 37.0 37.0 37.0 6 36.096 37.0 37.0 37.0 37.0 37.0 7 36.139 37.0 37.0 37.0 37.0 37.0 8 36.097 37.0 37.0 37.0 37.0 37.0 9 36.226 37.0 37.0 37.0 37.0 37.0 10-14 36.1531 37.0 37.0 37.0 37.0 37.0 15-19 36.132999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0364 37.0 37.0 37.0 37.0 37.0 25-29 36.006 37.0 37.0 37.0 37.0 37.0 30-34 36.0044 37.0 37.0 37.0 37.0 37.0 35-39 36.037400000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.9987 37.0 37.0 37.0 37.0 37.0 45-49 35.9504 37.0 37.0 37.0 37.0 37.0 50-54 36.002300000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.9099 37.0 37.0 37.0 37.0 37.0 60-64 35.863800000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.873799999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.7404 37.0 37.0 37.0 37.0 37.0 75-79 35.7432 37.0 37.0 37.0 37.0 37.0 80-84 35.842 37.0 37.0 37.0 37.0 37.0 85-89 35.7656 37.0 37.0 37.0 37.0 37.0 90-94 35.719100000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.761300000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.74229999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.6627 37.0 37.0 37.0 37.0 37.0 110-114 35.6306 37.0 37.0 37.0 37.0 37.0 115-119 35.7095 37.0 37.0 37.0 37.0 37.0 120-124 35.65220000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.5653 37.0 37.0 37.0 37.0 37.0 130-134 35.3605 37.0 37.0 37.0 32.2 37.0 135-139 35.449799999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.3981 37.0 37.0 37.0 37.0 37.0 145-149 35.480599999999995 37.0 37.0 37.0 37.0 37.0 150-151 34.851 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 2.0 15 3.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 3.0 22 4.0 23 8.0 24 9.0 25 10.0 26 3.0 27 11.0 28 19.0 29 26.0 30 28.0 31 41.0 32 60.0 33 99.0 34 221.0 35 655.0 36 2566.0 37 224.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.400000000000006 26.25 8.6 24.75 2 28.275 26.375 30.325000000000003 15.024999999999999 3 20.25 28.775000000000002 30.85 20.125 4 22.95 34.775 23.125 19.15 5 23.549999999999997 38.05 21.4 17.0 6 20.775 39.875 22.125 17.224999999999998 7 19.900000000000002 21.75 39.074999999999996 19.275000000000002 8 19.925 26.650000000000002 28.15 25.275 9 21.625 25.074999999999996 30.325000000000003 22.975 10-14 22.73 29.555 26.375 21.34 15-19 22.884999999999998 27.66 28.29 21.165 20-24 22.8 28.065 28.055000000000003 21.08 25-29 23.474999999999998 27.785 27.744999999999997 20.995 30-34 22.935 27.985 28.33 20.75 35-39 22.82 28.34 27.725 21.115000000000002 40-44 22.93 27.785 27.655 21.63 45-49 22.2 29.515 27.045 21.240000000000002 50-54 22.73 27.55 28.144999999999996 21.575 55-59 23.369999999999997 27.615000000000002 27.935 21.08 60-64 23.244999999999997 27.675 28.335 20.745 65-69 23.1 27.415 28.01 21.475 70-74 23.845 27.779999999999998 27.62 20.755000000000003 75-79 22.515 28.215 27.57 21.7 80-84 23.655 27.415 27.49 21.44 85-89 23.805 27.425 27.52 21.25 90-94 24.035 27.565 27.57 20.830000000000002 95-99 23.705000000000002 27.815 27.35 21.13 100-104 23.41 27.939999999999998 27.544999999999998 21.105 105-109 23.57 27.49 27.694999999999997 21.245 110-114 23.24 28.03 28.225 20.505000000000003 115-119 23.52 27.839999999999996 28.065 20.575 120-124 24.18 28.285 27.66 19.875 125-129 24.435000000000002 28.050000000000004 27.375 20.14 130-134 25.119999999999997 27.55 27.055 20.275000000000002 135-139 23.585 27.96 27.939999999999998 20.515 140-144 24.495 28.075 27.115000000000002 20.315 145-149 24.115000000000002 27.975 27.235 20.674999999999997 150-151 24.5 27.825 27.05 20.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.5 18 1.5 19 0.5 20 1.0 21 2.0 22 2.5 23 2.5 24 1.5 25 4.0 26 6.5 27 9.5 28 13.5 29 13.0 30 13.5 31 16.5 32 24.0 33 38.5 34 43.5 35 51.0 36 77.0 37 108.5 38 139.0 39 163.5 40 194.5 41 219.5 42 239.5 43 253.5 44 268.5 45 283.5 46 266.5 47 242.0 48 238.5 49 213.0 50 178.0 51 144.0 52 106.0 53 86.0 54 67.0 55 57.5 56 53.5 57 39.0 58 24.0 59 20.0 60 18.0 61 15.0 62 9.5 63 6.0 64 3.5 65 1.0 66 0.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.5 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 1.5 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.3957503320053 88.85 2 5.126162018592297 9.65 3 0.37184594953519257 1.05 4 0.0796812749003984 0.3 5 0.0 0.0 6 0.02656042496679947 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6499999999999999 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.4 0.0 0.0 0.0 0.0 136-137 1.5625 0.0 0.0 0.0 0.0 138-139 1.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706819 spots for SRR12161392.sra Written 706819 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra Read 706807 spots for SRR12161392.sra Written 706807 spots for SRR12161392.sra SRR ids: ['SRR12161392.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ym7_y8f9 SRR12161392.sra spots: 14136152 blocks: [[1, 706807], [706808, 1413614], [1413615, 2120421], [2120422, 2827228], [2827229, 3534035], [3534036, 4240842], [4240843, 4947649], [4947650, 5654456], [5654457, 6361263], [6361264, 7068070], [7068071, 7774877], [7774878, 8481684], [8481685, 9188491], [9188492, 9895298], [9895299, 10602105], [10602106, 11308912], [11308913, 12015719], [12015720, 12722526], [12722527, 13429333], [13429334, 14136152]] SRR12161392 file size 4782382 SRR12161392 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161392 SRR12161392_1.fastq SRR12161392_2.fastq Input file: SRR12161392_1.fastq Paired file: SRR12161392_2.fastq trimmed: SRR12161392-trimmed-pair1.fastq, SRR12161392-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:22:01 2025 >> started Thu Feb 13 20:22:19 2025 >> done (17.448s) 14136152 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 1055 ( 0.01%) empty read pairs filtered out after trimming by size control 14135088 (99.99%) read pairs available; of these: 437222 ( 3.09%) trimmed read pairs available after processing 13697866 (96.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 5 0.00% 27 6 0.00% 28 5 0.00% 29 7 0.00% 30 5 0.00% 31 8 0.00% 32 4 0.00% 33 7 0.00% 34 7 0.00% 35 7 0.00% 36 10 0.00% 37 5 0.00% 38 10 0.00% 39 7 0.00% 40 11 0.00% 41 7 0.00% 42 12 0.00% 43 13 0.00% 44 9 0.00% 45 11 0.00% 46 12 0.00% 47 13 0.00% 48 13 0.00% 49 20 0.00% 50 20 0.00% 51 21 0.00% 52 17 0.00% 53 24 0.00% 54 23 0.00% 55 23 0.00% 56 28 0.00% 57 26 0.00% 58 35 0.00% 59 33 0.00% 60 60 0.00% 61 39 0.00% 62 57 0.00% 63 54 0.00% 64 46 0.00% 65 72 0.00% 66 45 0.00% 67 83 0.00% 68 76 0.00% 69 116 0.00% 70 102 0.00% 71 125 0.00% 72 128 0.00% 73 163 0.00% 74 167 0.00% 75 191 0.00% 76 213 0.00% 77 236 0.00% 78 264 0.00% 79 332 0.00% 80 309 0.00% 81 352 0.00% 82 426 0.00% 83 450 0.00% 84 540 0.00% 85 566 0.00% 86 625 0.00% 87 697 0.00% 88 783 0.01% 89 773 0.01% 90 893 0.01% 91 1007 0.01% 92 1133 0.01% 93 1219 0.01% 94 1367 0.01% 95 1449 0.01% 96 1605 0.01% 97 1638 0.01% 98 1700 0.01% 99 1917 0.01% 100 2061 0.01% 101 2199 0.02% 102 2352 0.02% 103 2594 0.02% 104 2756 0.02% 105 2865 0.02% 106 3024 0.02% 107 3133 0.02% 108 3292 0.02% 109 3562 0.03% 110 3586 0.03% 111 3902 0.03% 112 4077 0.03% 113 4234 0.03% 114 4478 0.03% 115 4701 0.03% 116 5037 0.04% 117 5114 0.04% 118 5446 0.04% 119 5726 0.04% 120 5897 0.04% 121 6219 0.04% 122 6425 0.05% 123 6789 0.05% 124 7016 0.05% 125 7408 0.05% 126 7801 0.06% 127 7955 0.06% 128 8360 0.06% 129 8456 0.06% 130 8775 0.06% 131 9085 0.06% 132 9416 0.07% 133 9810 0.07% 134 10346 0.07% 135 10507 0.07% 136 11087 0.08% 137 11382 0.08% 138 11507 0.08% 139 12133 0.09% 140 12472 0.09% 141 13160 0.09% 142 13463 0.10% 143 13865 0.10% 144 14424 0.10% 145 15066 0.11% 146 15363 0.11% 147 15611 0.11% 148 16465 0.12% 149 16841 0.12% 150 17482 0.12% 151 13697866 96.91% 14135088 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.78 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=34.06 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.5 sequence=AATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.15 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=1.15 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=69.24 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.0 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA SRR12161392 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:23:06 Started mapping on | Feb 13 20:23:07 Finished on | Feb 13 20:24:45 Mapping speed, Million of reads per hour | 519.25 Number of input reads | 14135088 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13280775 Uniquely mapped reads % | 93.96% Average mapped length | 299.47 Number of splices: Total | 13170493 Number of splices: Annotated (sjdb) | 12884272 Number of splices: GT/AG | 12912800 Number of splices: GC/AG | 211209 Number of splices: AT/AC | 10858 Number of splices: Non-canonical | 35626 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.62 Insertion rate per base | 0.03% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373991 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 87657 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 480322 480322 480322 N_multimapping 373991 373991 373991 N_noFeature 429186 13128002 476521 N_ambiguous 189880 787 84007 UnstrandedReadsAssigned:12661709 PositiveStrandReadsAssigned:151986 NegativeStrandReadsAssigned:12720247 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161392 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161392-trimmed-pair1.fastq SRR12161392-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,135,088 reads, 12,762,158 reads pseudoaligned [quant] estimated average fragment length: 292.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR12161392.ke.tsv 34699 SRR12161392.se.tsv 87100 total ==> SRR12161392.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.84 323 12.3187 Potri.005G024800.1.v4.1 1035 743.842 102 9.03098 Potri.004G059700.1.v4.1 961 669.996 32 3.14552 Potri.007G009000.2.v4.1 1416 1124.84 0 0 Potri.003G141000.2.v4.1 2943 2651.84 473.033 11.7479 Potri.016G087400.1.v4.1 270 63.1368 728.196 759.593 Potri.015G069301.1.v4.1 564 288.626 0 0 Potri.010G195200.1.v4.1 1773 1481.84 7 0.311108 Potri.012G127500.1.v4.1 977 685.941 2765 265.475 ==> SRR12161392.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 77 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12161392 completed mapping pipeline successfully