Starting /dee2/code/volunteer_pipeline.sh SRR12161393 current disk space = 3087562891264 free memory = 1460545688 SRR12161393 SRAfilesize 730e4a4187f798a58aff325c4b866ffc SRR12161393.sra SRR12161393.sra file validated SRR12161393 is paired end SRR12161393 is conventional basespace SRR12161393 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161393_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.58875 37.0 37.0 37.0 37.0 37.0 2 36.436 37.0 37.0 37.0 37.0 37.0 3 36.553 37.0 37.0 37.0 37.0 37.0 4 36.6525 37.0 37.0 37.0 37.0 37.0 5 36.6125 37.0 37.0 37.0 37.0 37.0 6 36.548 37.0 37.0 37.0 37.0 37.0 7 36.4505 37.0 37.0 37.0 37.0 37.0 8 36.5725 37.0 37.0 37.0 37.0 37.0 9 36.55 37.0 37.0 37.0 37.0 37.0 10-14 36.5929 37.0 37.0 37.0 37.0 37.0 15-19 36.5673 37.0 37.0 37.0 37.0 37.0 20-24 36.516 37.0 37.0 37.0 37.0 37.0 25-29 36.5407 37.0 37.0 37.0 37.0 37.0 30-34 36.4685 37.0 37.0 37.0 37.0 37.0 35-39 36.4732 37.0 37.0 37.0 37.0 37.0 40-44 36.455200000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.445 37.0 37.0 37.0 37.0 37.0 50-54 36.3978 37.0 37.0 37.0 37.0 37.0 55-59 36.3344 37.0 37.0 37.0 37.0 37.0 60-64 36.3433 37.0 37.0 37.0 37.0 37.0 65-69 36.359899999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3359 37.0 37.0 37.0 37.0 37.0 75-79 36.3483 37.0 37.0 37.0 37.0 37.0 80-84 36.3026 37.0 37.0 37.0 37.0 37.0 85-89 36.308299999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2494 37.0 37.0 37.0 37.0 37.0 95-99 36.237700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2312 37.0 37.0 37.0 37.0 37.0 105-109 36.1701 37.0 37.0 37.0 37.0 37.0 110-114 36.1622 37.0 37.0 37.0 37.0 37.0 115-119 36.1682 37.0 37.0 37.0 37.0 37.0 120-124 36.1693 37.0 37.0 37.0 37.0 37.0 125-129 36.11469999999999 37.0 37.0 37.0 37.0 37.0 130-134 36.1232 37.0 37.0 37.0 37.0 37.0 135-139 36.058299999999996 37.0 37.0 37.0 37.0 37.0 140-144 36.0257 37.0 37.0 37.0 37.0 37.0 145-149 35.9377 37.0 37.0 37.0 37.0 37.0 150-151 35.83425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 2.0 26 3.0 27 5.0 28 14.0 29 15.0 30 20.0 31 37.0 32 43.0 33 67.0 34 125.0 35 273.0 36 2983.0 37 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.18554638659665 12.528132033008252 4.951237809452363 40.33508377094274 2 19.2 12.575 36.0 32.225 3 16.150000000000002 16.5 28.625 38.725 4 20.95 24.625 23.724999999999998 30.7 5 21.85 32.15 24.175 21.825 6 21.825 33.550000000000004 23.325000000000003 21.3 7 16.325 25.55 40.1 18.025 8 18.725 25.75 30.675 24.85 9 17.875 24.925 32.65 24.55 10-14 19.765 29.65 26.995 23.59 15-19 20.330000000000002 27.334999999999997 27.92 24.415 20-24 20.755000000000003 28.485 27.169999999999998 23.59 25-29 20.665 27.955000000000002 27.334999999999997 24.044999999999998 30-34 19.835 28.005000000000003 27.195000000000004 24.965 35-39 20.0 28.48 27.33 24.19 40-44 20.13 29.29 26.840000000000003 23.74 45-49 20.630000000000003 28.175 27.060000000000002 24.135 50-54 20.525 27.834999999999997 27.155 24.485 55-59 20.395 28.294999999999998 27.565 23.745 60-64 21.175 27.85 27.115000000000002 23.86 65-69 20.715 28.050000000000004 27.175 24.060000000000002 70-74 20.285 28.225 27.150000000000002 24.34 75-79 20.044999999999998 27.74 27.455000000000002 24.759999999999998 80-84 20.095 28.12 27.544999999999998 24.240000000000002 85-89 20.94 28.244999999999997 27.11 23.705000000000002 90-94 20.155 28.189999999999998 26.889999999999997 24.765 95-99 20.345 27.515 27.715 24.425 100-104 20.76 28.455000000000002 26.669999999999998 24.115000000000002 105-109 20.990000000000002 27.794999999999998 27.084999999999997 24.13 110-114 21.305 27.555000000000003 27.115000000000002 24.025 115-119 21.490000000000002 27.810000000000002 26.765 23.935000000000002 120-124 21.529999999999998 26.83 27.644999999999996 23.995 125-129 20.54 27.800000000000004 27.26 24.4 130-134 20.794999999999998 27.62 27.265 24.32 135-139 20.580000000000002 28.139999999999997 27.605 23.674999999999997 140-144 21.365000000000002 28.34 26.484999999999996 23.810000000000002 145-149 20.65 28.084999999999997 26.375 24.89 150-151 21.099999999999998 27.375 26.75 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 0.5 25 2.0 26 6.0 27 7.0 28 9.0 29 11.5 30 16.0 31 24.5 32 32.0 33 33.5 34 42.0 35 57.5 36 78.5 37 98.5 38 109.5 39 132.5 40 168.0 41 197.0 42 215.0 43 227.5 44 242.0 45 253.0 46 247.5 47 236.5 48 250.0 49 246.5 50 209.0 51 164.5 52 131.5 53 124.0 54 111.0 55 81.0 56 57.5 57 46.5 58 34.5 59 30.0 60 24.5 61 13.0 62 6.5 63 4.5 64 3.0 65 2.5 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.69466058492085 87.3 2 5.527233700026831 10.299999999999999 3 0.6171183257311511 1.725 4 0.10732492621411323 0.4 5 0.026831231553528307 0.125 6 0.026831231553528307 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCTTCTGGAGTCTGTAGGAAAGGCTTCCAGACTAGGAGGAGGAGGAGG 6 0.15 No Hit GTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTAGACCCAACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.175 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 1.725 0.0 0.0 0.0 0.0 134-135 2.025 0.0 0.0 0.0 0.0 136-137 2.2249999999999996 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACTTG 10 0.006830828 145.0 5 >>END_MODULE SRR12161393 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161393_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1615 37.0 37.0 37.0 37.0 37.0 2 35.9405 37.0 37.0 37.0 37.0 37.0 3 35.978 37.0 37.0 37.0 37.0 37.0 4 36.1475 37.0 37.0 37.0 37.0 37.0 5 36.267 37.0 37.0 37.0 37.0 37.0 6 36.0495 37.0 37.0 37.0 37.0 37.0 7 36.1715 37.0 37.0 37.0 37.0 37.0 8 36.228 37.0 37.0 37.0 37.0 37.0 9 36.229 37.0 37.0 37.0 37.0 37.0 10-14 36.2439 37.0 37.0 37.0 37.0 37.0 15-19 36.25840000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.172900000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.158899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.120999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.107000000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.057500000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.0664 37.0 37.0 37.0 37.0 37.0 50-54 36.0773 37.0 37.0 37.0 37.0 37.0 55-59 35.969800000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.002599999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.986799999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9289 37.0 37.0 37.0 37.0 37.0 75-79 35.9092 37.0 37.0 37.0 37.0 37.0 80-84 35.9563 37.0 37.0 37.0 37.0 37.0 85-89 35.89150000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8312 37.0 37.0 37.0 37.0 37.0 95-99 35.885000000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.865300000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.772499999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.7629 37.0 37.0 37.0 37.0 37.0 115-119 35.7231 37.0 37.0 37.0 37.0 37.0 120-124 35.6904 37.0 37.0 37.0 37.0 37.0 125-129 35.69590000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.579499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.655300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.54260000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.555499999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.05875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 1.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 6.0 22 5.0 23 7.0 24 8.0 25 10.0 26 6.0 27 10.0 28 23.0 29 19.0 30 23.0 31 34.0 32 56.0 33 91.0 34 191.0 35 526.0 36 2703.0 37 275.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.95 24.474999999999998 8.4 27.175 2 26.924999999999997 26.700000000000003 30.125 16.25 3 19.575 27.250000000000004 33.650000000000006 19.525000000000002 4 23.825 33.425 23.5 19.25 5 24.2 37.3 21.6 16.900000000000002 6 21.525 38.375 22.45 17.65 7 20.325 22.325 37.574999999999996 19.775000000000002 8 21.7 26.150000000000002 27.650000000000002 24.5 9 21.224999999999998 24.474999999999998 31.474999999999998 22.825 10-14 23.849999999999998 29.38 25.759999999999998 21.01 15-19 23.285 27.700000000000003 27.229999999999997 21.785 20-24 23.71 27.634999999999998 27.235 21.42 25-29 23.385 28.249999999999996 26.88 21.485000000000003 30-34 23.025000000000002 28.48 26.974999999999998 21.52 35-39 22.900000000000002 28.065 27.595 21.44 40-44 22.74 28.115000000000002 27.435 21.709999999999997 45-49 23.205000000000002 27.994999999999997 27.57 21.23 50-54 23.380000000000003 27.495000000000005 27.875 21.25 55-59 23.47 27.495000000000005 27.58 21.455 60-64 23.0 27.644999999999996 27.685 21.67 65-69 23.44 28.02 26.945000000000004 21.595 70-74 23.9 27.87 27.355 20.875 75-79 23.01 27.860000000000003 27.355 21.775 80-84 22.955000000000002 28.04 26.729999999999997 22.275 85-89 23.46 27.905 27.575 21.060000000000002 90-94 23.724999999999998 27.779999999999998 27.075 21.42 95-99 24.135 27.045 27.025 21.795 100-104 23.945 27.384999999999998 27.305 21.365000000000002 105-109 23.91 26.784999999999997 27.589999999999996 21.715 110-114 23.94 28.055000000000003 26.995 21.01 115-119 23.53 28.07 27.279999999999998 21.12 120-124 24.255 27.105 27.685 20.955 125-129 24.279999999999998 27.224999999999998 27.07 21.425 130-134 24.465 27.07 26.775 21.69 135-139 24.21 27.16 27.35 21.279999999999998 140-144 23.53 27.305 27.650000000000002 21.515 145-149 24.445 27.1 26.815 21.64 150-151 25.1875 26.85 27.4125 20.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 1.0 14 1.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.5 20 1.0 21 0.0 22 1.0 23 1.5 24 2.0 25 3.5 26 4.0 27 4.0 28 5.0 29 7.0 30 13.5 31 19.5 32 27.0 33 35.0 34 42.5 35 58.5 36 70.5 37 88.5 38 110.0 39 138.0 40 171.0 41 196.5 42 221.0 43 253.0 44 260.5 45 273.0 46 283.5 47 267.0 48 261.5 49 226.5 50 186.0 51 151.0 52 125.0 53 109.0 54 89.5 55 74.0 56 53.5 57 40.5 58 35.0 59 27.5 60 18.5 61 11.0 62 7.5 63 5.0 64 3.0 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12706887346502 88.14999999999999 2 5.152162306460224 9.65 3 0.587293112653497 1.6500000000000001 4 0.08008542445274959 0.3 5 0.05339028296849973 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit GAGAAGAGAAGAGCGGAGCAGAGAAGAGAAGAGTGGATCAAGAAAAAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.175 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 1.725 0.0 0.0 0.0 0.0 134-135 2.025 0.0 0.0 0.0 0.0 136-137 2.2249999999999996 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra Read 777467 spots for SRR12161393.sra Written 777467 spots for SRR12161393.sra Read 777460 spots for SRR12161393.sra Written 777460 spots for SRR12161393.sra SRR ids: ['SRR12161393.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dvg5ltqh SRR12161393.sra spots: 15549207 blocks: [[1, 777460], [777461, 1554920], [1554921, 2332380], [2332381, 3109840], [3109841, 3887300], [3887301, 4664760], [4664761, 5442220], [5442221, 6219680], [6219681, 6997140], [6997141, 7774600], [7774601, 8552060], [8552061, 9329520], [9329521, 10106980], [10106981, 10884440], [10884441, 11661900], [11661901, 12439360], [12439361, 13216820], [13216821, 13994280], [13994281, 14771740], [14771741, 15549207]] SRR12161393 file size 5262600 SRR12161393 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161393 SRR12161393_1.fastq SRR12161393_2.fastq Input file: SRR12161393_1.fastq Paired file: SRR12161393_2.fastq trimmed: SRR12161393-trimmed-pair1.fastq, SRR12161393-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:22:09 2025 >> started Thu Feb 13 20:22:26 2025 >> done (17.093s) 15549207 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 651 ( 0.00%) empty read pairs filtered out after trimming by size control 15548539 (100.00%) read pairs available; of these: 767747 ( 4.94%) trimmed read pairs available after processing 14780792 (95.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 4 0.00% 21 0 0.00% 22 1 0.00% 23 3 0.00% 24 6 0.00% 25 10 0.00% 26 5 0.00% 27 1 0.00% 28 2 0.00% 29 6 0.00% 30 1 0.00% 31 1 0.00% 32 7 0.00% 33 5 0.00% 34 2 0.00% 35 4 0.00% 36 5 0.00% 37 4 0.00% 38 6 0.00% 39 10 0.00% 40 6 0.00% 41 8 0.00% 42 13 0.00% 43 21 0.00% 44 13 0.00% 45 19 0.00% 46 12 0.00% 47 9 0.00% 48 14 0.00% 49 20 0.00% 50 16 0.00% 51 18 0.00% 52 24 0.00% 53 25 0.00% 54 25 0.00% 55 20 0.00% 56 37 0.00% 57 38 0.00% 58 37 0.00% 59 50 0.00% 60 52 0.00% 61 48 0.00% 62 68 0.00% 63 68 0.00% 64 80 0.00% 65 63 0.00% 66 102 0.00% 67 117 0.00% 68 101 0.00% 69 144 0.00% 70 168 0.00% 71 216 0.00% 72 174 0.00% 73 228 0.00% 74 283 0.00% 75 318 0.00% 76 299 0.00% 77 329 0.00% 78 390 0.00% 79 423 0.00% 80 511 0.00% 81 519 0.00% 82 666 0.00% 83 706 0.00% 84 861 0.01% 85 983 0.01% 86 1063 0.01% 87 1188 0.01% 88 1246 0.01% 89 1393 0.01% 90 1485 0.01% 91 1702 0.01% 92 1846 0.01% 93 2058 0.01% 94 2254 0.01% 95 2466 0.02% 96 2655 0.02% 97 2929 0.02% 98 3009 0.02% 99 3177 0.02% 100 3528 0.02% 101 3756 0.02% 102 4100 0.03% 103 4347 0.03% 104 4780 0.03% 105 5101 0.03% 106 5382 0.03% 107 5721 0.04% 108 5933 0.04% 109 6358 0.04% 110 6453 0.04% 111 6719 0.04% 112 7451 0.05% 113 7572 0.05% 114 8182 0.05% 115 8673 0.06% 116 8937 0.06% 117 9569 0.06% 118 9907 0.06% 119 10215 0.07% 120 10556 0.07% 121 11092 0.07% 122 11739 0.08% 123 11912 0.08% 124 12819 0.08% 125 13191 0.08% 126 13862 0.09% 127 14586 0.09% 128 15069 0.10% 129 15483 0.10% 130 16002 0.10% 131 16409 0.11% 132 17023 0.11% 133 17758 0.11% 134 18225 0.12% 135 18650 0.12% 136 19242 0.12% 137 20212 0.13% 138 20519 0.13% 139 21625 0.14% 140 21979 0.14% 141 22762 0.15% 142 23505 0.15% 143 24139 0.16% 144 24802 0.16% 145 25705 0.17% 146 26169 0.17% 147 27155 0.17% 148 28105 0.18% 149 28375 0.18% 150 29496 0.19% 151 14780792 95.06% 15548539 reads passed initial QC criterion=sequence-density sequence-density=1.14 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=1.15 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=96.35 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.6 sequence=AGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGTCGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATTCTAGCACTAGCTTATTATCATACTTCATAATCTGCTTCGATTCTTCACTTCACGCTTTTGCAATCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCCACATGAGATGGCAGCTTCTGCTAGTGG criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.82 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=42.05 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12161393 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:23:08 Started mapping on | Feb 13 20:23:09 Finished on | Feb 13 20:24:48 Mapping speed, Million of reads per hour | 565.40 Number of input reads | 15548539 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14600049 Uniquely mapped reads % | 93.90% Average mapped length | 298.88 Number of splices: Total | 14747105 Number of splices: Annotated (sjdb) | 14452071 Number of splices: GT/AG | 14438669 Number of splices: GC/AG | 260803 Number of splices: AT/AC | 13442 Number of splices: Non-canonical | 34191 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403700 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 115546 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 544790 544790 544790 N_multimapping 403700 403700 403700 N_noFeature 432517 14432558 485618 N_ambiguous 208592 927 93582 UnstrandedReadsAssigned:13958940 PositiveStrandReadsAssigned:166564 NegativeStrandReadsAssigned:14020849 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161393 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161393-trimmed-pair1.fastq SRR12161393-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,548,539 reads, 14,113,000 reads pseudoaligned [quant] estimated average fragment length: 276.214 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,001 rounds 52401 SRR12161393.ke.tsv 34699 SRR12161393.se.tsv 87100 total ==> SRR12161393.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.79 310 10.5684 Potri.005G024800.1.v4.1 1035 759.786 79 6.17772 Potri.004G059700.1.v4.1 961 685.907 49 4.24447 Potri.007G009000.2.v4.1 1416 1140.79 0 0 Potri.003G141000.2.v4.1 2943 2667.79 218 4.8551 Potri.016G087400.1.v4.1 270 70.1625 889 752.817 Potri.015G069301.1.v4.1 564 302.128 0 0 Potri.010G195200.1.v4.1 1773 1497.79 6 0.238009 Potri.012G127500.1.v4.1 977 701.834 1706 144.423 ==> SRR12161393.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 146 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 53 Potri.001G452600.v4.1 4 SRR12161393 completed mapping pipeline successfully