Starting /dee2/code/volunteer_pipeline.sh SRR12161394 current disk space = 3087577817088 free memory = 1482599104 SRR12161394 SRAfilesize 37a252d55e572d21dfe9e7827d8f811c SRR12161394.sra SRR12161394.sra file validated SRR12161394 is paired end SRR12161394 is conventional basespace SRR12161394 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161394_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.49825 37.0 37.0 37.0 37.0 37.0 2 36.373 37.0 37.0 37.0 37.0 37.0 3 36.49 37.0 37.0 37.0 37.0 37.0 4 36.5215 37.0 37.0 37.0 37.0 37.0 5 36.5755 37.0 37.0 37.0 37.0 37.0 6 36.561 37.0 37.0 37.0 37.0 37.0 7 36.456 37.0 37.0 37.0 37.0 37.0 8 36.5035 37.0 37.0 37.0 37.0 37.0 9 36.535 37.0 37.0 37.0 37.0 37.0 10-14 36.563300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.537600000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.475100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.483799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4475 37.0 37.0 37.0 37.0 37.0 35-39 36.3712 37.0 37.0 37.0 37.0 37.0 40-44 36.3942 37.0 37.0 37.0 37.0 37.0 45-49 36.3873 37.0 37.0 37.0 37.0 37.0 50-54 36.3498 37.0 37.0 37.0 37.0 37.0 55-59 36.2997 37.0 37.0 37.0 37.0 37.0 60-64 36.2799 37.0 37.0 37.0 37.0 37.0 65-69 36.3073 37.0 37.0 37.0 37.0 37.0 70-74 36.2831 37.0 37.0 37.0 37.0 37.0 75-79 36.2539 37.0 37.0 37.0 37.0 37.0 80-84 36.27570000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1995 37.0 37.0 37.0 37.0 37.0 90-94 36.1794 37.0 37.0 37.0 37.0 37.0 95-99 36.1527 37.0 37.0 37.0 37.0 37.0 100-104 36.1391 37.0 37.0 37.0 37.0 37.0 105-109 36.0869 37.0 37.0 37.0 37.0 37.0 110-114 36.096700000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.1029 37.0 37.0 37.0 37.0 37.0 120-124 36.085699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9747 37.0 37.0 37.0 37.0 37.0 130-134 35.9911 37.0 37.0 37.0 37.0 37.0 135-139 35.916 37.0 37.0 37.0 37.0 37.0 140-144 35.8574 37.0 37.0 37.0 37.0 37.0 145-149 35.80179999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.68875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 0.0 26 4.0 27 7.0 28 11.0 29 22.0 30 33.0 31 38.0 32 67.0 33 78.0 34 130.0 35 298.0 36 2900.0 37 411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.15136352264198 11.658744058043533 9.281961471103326 43.90793094821116 2 19.475 13.625000000000002 34.475 32.425 3 17.849999999999998 17.75 26.950000000000003 37.45 4 20.525 26.974999999999998 23.150000000000002 29.349999999999998 5 23.325000000000003 32.125 23.425 21.125 6 19.925 35.8 23.1 21.175 7 13.875000000000002 25.924999999999997 42.9 17.299999999999997 8 18.9 24.9 32.225 23.974999999999998 9 16.5 25.3 33.975 24.224999999999998 10-14 18.975 30.435000000000002 27.544999999999998 23.044999999999998 15-19 19.62 28.49 27.66 24.23 20-24 19.509999999999998 28.305000000000003 28.07 24.115000000000002 25-29 20.4 28.37 27.495000000000005 23.735 30-34 19.744999999999997 28.985 27.16 24.11 35-39 19.470000000000002 29.255 27.43 23.845 40-44 19.98 29.054999999999996 27.534999999999997 23.43 45-49 20.150000000000002 28.375 27.425 24.05 50-54 20.355 28.815 27.13 23.7 55-59 20.26 28.645 27.284999999999997 23.810000000000002 60-64 19.49 28.15 27.935 24.425 65-69 20.54 28.24 27.165 24.055 70-74 20.0 28.565 27.46 23.974999999999998 75-79 20.544999999999998 28.025 27.92 23.51 80-84 19.8 28.435 27.43 24.335 85-89 19.63 29.34 27.11 23.919999999999998 90-94 20.01 28.035 28.060000000000002 23.895 95-99 19.845 28.405 27.875 23.875 100-104 19.900000000000002 28.689999999999998 27.79 23.62 105-109 20.415 28.29 27.705000000000002 23.59 110-114 20.349999999999998 28.555000000000003 27.195000000000004 23.9 115-119 20.315 28.585 27.755000000000003 23.345 120-124 20.21 28.88 27.315 23.595 125-129 20.715 27.93 27.134999999999998 24.22 130-134 20.24 28.17 27.384999999999998 24.205 135-139 20.61 28.175 27.02 24.195 140-144 20.52 28.375 27.189999999999998 23.915 145-149 20.785 28.365000000000002 27.105 23.745 150-151 19.5875 29.325000000000003 25.874999999999996 25.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 3.0 25 2.0 26 4.5 27 9.0 28 12.5 29 13.0 30 16.0 31 25.0 32 39.0 33 47.5 34 59.5 35 72.5 36 81.0 37 105.0 38 128.5 39 144.5 40 180.0 41 212.5 42 233.0 43 252.0 44 256.0 45 251.5 46 253.0 47 271.5 48 255.5 49 207.5 50 175.5 51 149.5 52 124.0 53 107.5 54 83.5 55 56.0 56 37.5 57 29.5 58 26.0 59 17.0 60 11.5 61 9.5 62 7.5 63 7.5 64 5.5 65 4.0 66 2.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.16298633017875 90.5 2 4.52155625657203 8.6 3 0.31545741324921134 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.9000000000000004 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.699999999999999 0.0 0.0 0.0 0.0 128-129 5.2375 0.0 0.0 0.0 0.0 130-131 5.487500000000001 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.275 0.0 0.0 0.0 0.0 136-137 6.7375 0.0 0.0 0.0 0.0 138-139 7.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATTTA 10 0.006830828 145.0 4 >>END_MODULE SRR12161394 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161394_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.334 37.0 37.0 37.0 37.0 37.0 2 36.147 37.0 37.0 37.0 37.0 37.0 3 36.0155 37.0 37.0 37.0 37.0 37.0 4 36.1025 37.0 37.0 37.0 37.0 37.0 5 36.289 37.0 37.0 37.0 37.0 37.0 6 36.202 37.0 37.0 37.0 37.0 37.0 7 36.1215 37.0 37.0 37.0 37.0 37.0 8 36.345 37.0 37.0 37.0 37.0 37.0 9 36.2925 37.0 37.0 37.0 37.0 37.0 10-14 36.318799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.322 37.0 37.0 37.0 37.0 37.0 20-24 36.300200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.2282 37.0 37.0 37.0 37.0 37.0 30-34 36.2322 37.0 37.0 37.0 37.0 37.0 35-39 36.172700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.1209 37.0 37.0 37.0 37.0 37.0 45-49 36.0958 37.0 37.0 37.0 37.0 37.0 50-54 36.1204 37.0 37.0 37.0 37.0 37.0 55-59 36.1112 37.0 37.0 37.0 37.0 37.0 60-64 36.0529 37.0 37.0 37.0 37.0 37.0 65-69 35.991299999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9685 37.0 37.0 37.0 37.0 37.0 75-79 35.894600000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1062 37.0 37.0 37.0 37.0 37.0 85-89 35.9799 37.0 37.0 37.0 37.0 37.0 90-94 35.8977 37.0 37.0 37.0 37.0 37.0 95-99 35.952099999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.8904 37.0 37.0 37.0 37.0 37.0 105-109 35.8722 37.0 37.0 37.0 37.0 37.0 110-114 35.808299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.831100000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.76349999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.744899999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.5926 37.0 37.0 37.0 37.0 37.0 135-139 35.6161 37.0 37.0 37.0 37.0 37.0 140-144 35.431 37.0 37.0 37.0 37.0 37.0 145-149 35.535399999999996 37.0 37.0 37.0 37.0 37.0 150-151 34.948499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 2.0 16 0.0 17 0.0 18 4.0 19 2.0 20 0.0 21 2.0 22 1.0 23 8.0 24 7.0 25 5.0 26 15.0 27 8.0 28 13.0 29 18.0 30 23.0 31 28.0 32 45.0 33 123.0 34 179.0 35 495.0 36 2718.0 37 300.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.800000000000004 21.15 13.425 26.625 2 28.575 24.725 30.099999999999998 16.6 3 21.075 27.750000000000004 31.624999999999996 19.55 4 24.925 32.5 23.400000000000002 19.175 5 25.874999999999996 36.425000000000004 21.275 16.425 6 20.724999999999998 40.150000000000006 22.625 16.5 7 21.8 21.925 36.675000000000004 19.6 8 22.1 26.375 27.125 24.4 9 20.4 25.4 30.4 23.799999999999997 10-14 23.53 29.054999999999996 27.16 20.255000000000003 15-19 23.615 28.144999999999996 27.51 20.73 20-24 23.51 28.24 27.505000000000003 20.745 25-29 22.685 28.12 27.96 21.235 30-34 22.919999999999998 28.51 27.860000000000003 20.71 35-39 22.595000000000002 28.43 28.01 20.965 40-44 23.674999999999997 27.49 28.115000000000002 20.72 45-49 22.865 28.415000000000003 27.839999999999996 20.880000000000003 50-54 23.474999999999998 27.77 27.98 20.775 55-59 23.974999999999998 28.24 26.96 20.825 60-64 22.715 27.860000000000003 28.615000000000002 20.810000000000002 65-69 23.565 27.67 27.85 20.915 70-74 23.599999999999998 27.589999999999996 27.91 20.9 75-79 23.585 27.925 27.785 20.705000000000002 80-84 23.875 27.845 27.55 20.73 85-89 23.52 27.975 27.735 20.77 90-94 23.515 28.37 27.815 20.3 95-99 23.985 27.54 27.834999999999997 20.64 100-104 24.03 28.439999999999998 27.025 20.505000000000003 105-109 24.310000000000002 27.950000000000003 27.66 20.080000000000002 110-114 23.849999999999998 28.54 27.935 19.675 115-119 24.805 27.705000000000002 27.77 19.72 120-124 23.78 28.355000000000004 27.425 20.44 125-129 24.48 28.105000000000004 27.61 19.805 130-134 24.48 28.38 27.235 19.905 135-139 25.09 27.405 28.285 19.220000000000002 140-144 25.130000000000003 27.87 27.169999999999998 19.830000000000002 145-149 26.009999999999998 27.735 26.784999999999997 19.470000000000002 150-151 25.8 27.712500000000002 27.037499999999998 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 1.0 11 1.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.5 25 3.5 26 4.0 27 6.0 28 7.5 29 10.0 30 15.5 31 22.5 32 30.5 33 31.0 34 42.0 35 65.5 36 79.0 37 107.5 38 129.0 39 157.5 40 202.0 41 247.0 42 266.5 43 267.0 44 263.5 45 260.5 46 276.0 47 259.5 48 222.5 49 187.5 50 162.0 51 138.0 52 116.0 53 98.0 54 76.0 55 58.0 56 47.0 57 34.5 58 18.0 59 13.0 60 14.5 61 9.0 62 8.0 63 9.0 64 4.0 65 2.0 66 2.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.025 #Duplication Level Percentage of deduplicated Percentage of total 1 95.3696395685346 90.625 2 4.23572744014733 8.05 3 0.2893975269665877 0.8250000000000001 4 0.052617732175743226 0.2 5 0.026308866087871613 0.125 6 0.0 0.0 7 0.026308866087871613 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CCTAAGCAAAGAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.275 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.7625 0.0 0.0 0.0 0.0 134-135 6.199999999999999 0.0 0.0 0.0 0.0 136-137 6.675000000000001 0.0 0.0 0.0 0.0 138-139 7.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACAAC 10 0.006830828 145.0 1 >>END_MODULE Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542949 spots for SRR12161394.sra Written 542949 spots for SRR12161394.sra Read 542966 spots for SRR12161394.sra Written 542966 spots for SRR12161394.sra SRR ids: ['SRR12161394.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0nn43w8u SRR12161394.sra spots: 10858997 blocks: [[1, 542949], [542950, 1085898], [1085899, 1628847], [1628848, 2171796], [2171797, 2714745], [2714746, 3257694], [3257695, 3800643], [3800644, 4343592], [4343593, 4886541], [4886542, 5429490], [5429491, 5972439], [5972440, 6515388], [6515389, 7058337], [7058338, 7601286], [7601287, 8144235], [8144236, 8687184], [8687185, 9230133], [9230134, 9773082], [9773083, 10316031], [10316032, 10858997]] SRR12161394 file size 3668661 SRR12161394 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161394 SRR12161394_1.fastq SRR12161394_2.fastq Input file: SRR12161394_1.fastq Paired file: SRR12161394_2.fastq trimmed: SRR12161394-trimmed-pair1.fastq, SRR12161394-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:21:31 2025 >> started Thu Feb 13 20:21:42 2025 >> done (11.152s) 10858997 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 2605 ( 0.02%) empty read pairs filtered out after trimming by size control 10856382 (99.98%) read pairs available; of these: 1164635 (10.73%) trimmed read pairs available after processing 9691747 (89.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 2 0.00% 23 0 0.00% 24 1 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 3 0.00% 29 3 0.00% 30 4 0.00% 31 5 0.00% 32 8 0.00% 33 4 0.00% 34 9 0.00% 35 6 0.00% 36 6 0.00% 37 8 0.00% 38 13 0.00% 39 11 0.00% 40 9 0.00% 41 29 0.00% 42 22 0.00% 43 18 0.00% 44 15 0.00% 45 20 0.00% 46 23 0.00% 47 33 0.00% 48 30 0.00% 49 51 0.00% 50 42 0.00% 51 51 0.00% 52 64 0.00% 53 47 0.00% 54 71 0.00% 55 49 0.00% 56 71 0.00% 57 86 0.00% 58 89 0.00% 59 110 0.00% 60 154 0.00% 61 163 0.00% 62 188 0.00% 63 165 0.00% 64 251 0.00% 65 244 0.00% 66 268 0.00% 67 286 0.00% 68 296 0.00% 69 394 0.00% 70 467 0.00% 71 536 0.00% 72 650 0.01% 73 605 0.01% 74 802 0.01% 75 792 0.01% 76 916 0.01% 77 953 0.01% 78 1064 0.01% 79 1211 0.01% 80 1415 0.01% 81 1574 0.01% 82 1796 0.02% 83 1956 0.02% 84 2261 0.02% 85 2558 0.02% 86 2680 0.02% 87 2895 0.03% 88 3273 0.03% 89 3454 0.03% 90 3836 0.04% 91 4179 0.04% 92 4416 0.04% 93 5200 0.05% 94 5689 0.05% 95 6107 0.06% 96 6333 0.06% 97 7038 0.06% 98 7288 0.07% 99 7840 0.07% 100 8157 0.08% 101 8629 0.08% 102 9295 0.09% 103 9937 0.09% 104 10672 0.10% 105 11339 0.10% 106 11650 0.11% 107 12223 0.11% 108 12453 0.11% 109 12988 0.12% 110 13629 0.13% 111 14027 0.13% 112 14788 0.14% 113 15256 0.14% 114 15947 0.15% 115 16728 0.15% 116 17268 0.16% 117 17701 0.16% 118 17792 0.16% 119 18322 0.17% 120 18836 0.17% 121 19147 0.18% 122 19888 0.18% 123 20498 0.19% 124 21365 0.20% 125 21524 0.20% 126 22271 0.21% 127 22542 0.21% 128 22886 0.21% 129 23275 0.21% 130 23740 0.22% 131 24105 0.22% 132 24520 0.23% 133 24759 0.23% 134 25320 0.23% 135 26207 0.24% 136 26370 0.24% 137 27159 0.25% 138 27198 0.25% 139 28114 0.26% 140 27885 0.26% 141 28033 0.26% 142 28851 0.27% 143 29147 0.27% 144 30212 0.28% 145 30413 0.28% 146 31270 0.29% 147 31315 0.29% 148 32016 0.29% 149 31703 0.29% 150 32052 0.30% 151 9691747 89.27% 10856382 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=19 prefix-density=0.84 prefix-fanout=2.3 sequence=ACCTCCATGACT criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=27.78 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=8.7 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=1.08 prefix-fanout=2.0 sequence=CATGTCTAGCACCTGCGACAACTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=24.94 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12161394 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:22:25 Started mapping on | Feb 13 20:22:25 Finished on | Feb 13 20:23:33 Mapping speed, Million of reads per hour | 574.75 Number of input reads | 10856382 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 9988894 Uniquely mapped reads % | 92.01% Average mapped length | 295.53 Number of splices: Total | 10334557 Number of splices: Annotated (sjdb) | 10088927 Number of splices: GT/AG | 10132103 Number of splices: GC/AG | 152893 Number of splices: AT/AC | 10333 Number of splices: Non-canonical | 39228 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248242 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 109208 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.47% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 619246 619246 619246 N_multimapping 248242 248242 248242 N_noFeature 375718 9834606 427789 N_ambiguous 161937 739 59290 UnstrandedReadsAssigned:9451239 PositiveStrandReadsAssigned:153549 NegativeStrandReadsAssigned:9501815 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161394 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161394-trimmed-pair1.fastq SRR12161394-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,856,382 reads, 9,584,748 reads pseudoaligned [quant] estimated average fragment length: 258.622 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12161394.ke.tsv 34699 SRR12161394.se.tsv 87100 total ==> SRR12161394.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.38 291 13.3765 Potri.005G024800.1.v4.1 1035 777.378 290 30.1871 Potri.004G059700.1.v4.1 961 703.504 0 0 Potri.007G009000.2.v4.1 1416 1158.38 0 0 Potri.003G141000.2.v4.1 2943 2685.38 510.259 15.3759 Potri.016G087400.1.v4.1 270 84.0591 1048 1008.86 Potri.015G069301.1.v4.1 564 319.762 0 0 Potri.010G195200.1.v4.1 1773 1515.38 14 0.747588 Potri.012G127500.1.v4.1 977 719.457 113 12.7095 ==> SRR12161394.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 156 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR12161394 completed mapping pipeline successfully