Starting /dee2/code/volunteer_pipeline.sh SRR12161395 current disk space = 3088125517824 free memory = 1577099164 SRR12161395 SRAfilesize 4477ac1dfccc26c3d35a94597a913c82 SRR12161395.sra SRR12161395.sra file validated SRR12161395 is paired end SRR12161395 is conventional basespace SRR12161395 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161395_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57525 37.0 37.0 37.0 37.0 37.0 2 36.5205 37.0 37.0 37.0 37.0 37.0 3 36.556 37.0 37.0 37.0 37.0 37.0 4 36.576 37.0 37.0 37.0 37.0 37.0 5 36.6735 37.0 37.0 37.0 37.0 37.0 6 36.544 37.0 37.0 37.0 37.0 37.0 7 36.5365 37.0 37.0 37.0 37.0 37.0 8 36.559 37.0 37.0 37.0 37.0 37.0 9 36.514 37.0 37.0 37.0 37.0 37.0 10-14 36.5814 37.0 37.0 37.0 37.0 37.0 15-19 36.5304 37.0 37.0 37.0 37.0 37.0 20-24 36.5589 37.0 37.0 37.0 37.0 37.0 25-29 36.514300000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.500699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4363 37.0 37.0 37.0 37.0 37.0 40-44 36.44539999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.4143 37.0 37.0 37.0 37.0 37.0 50-54 36.3716 37.0 37.0 37.0 37.0 37.0 55-59 36.4252 37.0 37.0 37.0 37.0 37.0 60-64 36.3917 37.0 37.0 37.0 37.0 37.0 65-69 36.307300000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3239 37.0 37.0 37.0 37.0 37.0 75-79 36.294000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.304 37.0 37.0 37.0 37.0 37.0 85-89 36.2896 37.0 37.0 37.0 37.0 37.0 90-94 36.2902 37.0 37.0 37.0 37.0 37.0 95-99 36.21 37.0 37.0 37.0 37.0 37.0 100-104 36.2547 37.0 37.0 37.0 37.0 37.0 105-109 36.2487 37.0 37.0 37.0 37.0 37.0 110-114 36.2062 37.0 37.0 37.0 37.0 37.0 115-119 36.176 37.0 37.0 37.0 37.0 37.0 120-124 36.1526 37.0 37.0 37.0 37.0 37.0 125-129 36.0831 37.0 37.0 37.0 37.0 37.0 130-134 36.0393 37.0 37.0 37.0 37.0 37.0 135-139 36.0129 37.0 37.0 37.0 37.0 37.0 140-144 35.8856 37.0 37.0 37.0 37.0 37.0 145-149 35.8787 37.0 37.0 37.0 37.0 37.0 150-151 35.72 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 1.0 25 5.0 26 4.0 27 9.0 28 7.0 29 14.0 30 20.0 31 37.0 32 47.0 33 77.0 34 110.0 35 283.0 36 2913.0 37 470.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.98499624906226 11.327831957989497 6.301575393848462 42.385596399099775 2 18.35 13.8 36.7 31.15 3 16.1 16.35 27.625 39.925 4 21.95 24.0 23.9 30.15 5 23.200000000000003 29.7 25.275 21.825 6 20.0 34.25 23.65 22.1 7 15.25 26.924999999999997 40.1 17.724999999999998 8 18.125 25.85 32.2 23.825 9 17.7 22.95 34.5 24.85 10-14 19.84 29.99 27.200000000000003 22.97 15-19 20.005 28.025 27.71 24.26 20-24 19.915 28.845 27.57 23.669999999999998 25-29 20.09 28.854999999999997 27.389999999999997 23.665 30-34 20.54 28.075 26.919999999999998 24.465 35-39 19.73 28.139999999999997 27.839999999999996 24.29 40-44 19.975 28.63 27.54 23.855 45-49 19.89 28.185 27.474999999999998 24.45 50-54 20.630000000000003 27.805000000000003 27.495000000000005 24.07 55-59 19.465 28.93 27.750000000000004 23.855 60-64 20.035 27.67 28.050000000000004 24.245 65-69 20.27 28.09 27.474999999999998 24.165 70-74 20.175 28.275 27.255000000000003 24.295 75-79 20.075000000000003 27.950000000000003 27.42 24.555 80-84 20.200000000000003 27.905 27.55 24.345 85-89 20.51 28.395 26.905 24.19 90-94 19.759999999999998 28.12 27.900000000000002 24.22 95-99 21.115000000000002 28.09 27.139999999999997 23.655 100-104 21.075 28.134999999999998 26.895000000000003 23.895 105-109 20.68 27.98 27.01 24.33 110-114 21.115000000000002 28.18 27.66 23.044999999999998 115-119 20.794999999999998 28.360000000000003 27.185 23.66 120-124 20.115 28.660000000000004 26.76 24.465 125-129 20.61 28.1 27.27 24.02 130-134 21.02 28.68 26.595000000000002 23.705000000000002 135-139 21.47 27.705000000000002 26.945000000000004 23.880000000000003 140-144 21.535 27.279999999999998 26.85 24.335 145-149 21.015 27.48 27.38 24.125 150-151 20.2875 27.8875 26.8 25.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 2.0 25 8.0 26 8.5 27 10.5 28 15.5 29 13.5 30 16.5 31 23.5 32 26.5 33 34.0 34 49.0 35 65.5 36 80.0 37 95.0 38 115.0 39 145.5 40 166.0 41 184.5 42 227.5 43 258.0 44 252.0 45 240.5 46 262.5 47 252.5 48 248.5 49 261.0 50 209.5 51 144.5 52 102.5 53 95.5 54 89.5 55 70.5 56 54.5 57 40.0 58 33.5 59 31.0 60 25.0 61 13.0 62 6.0 63 5.5 64 2.5 65 2.0 66 4.0 67 3.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.29102496016995 88.775 2 5.284121083377589 9.950000000000001 3 0.34519383961763145 0.975 4 0.07966011683483802 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.0750000000000002 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.7374999999999998 0.0 0.0 0.0 0.0 122-123 2.0374999999999996 0.0 0.0 0.0 0.0 124-125 2.2750000000000004 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.6500000000000004 0.0 0.0 0.0 0.0 136-137 3.9625000000000004 0.0 0.0 0.0 0.0 138-139 4.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGTA 10 0.006830828 145.0 2 GTCTTTT 10 0.006830828 145.0 1 GTCCACC 10 0.006830828 145.0 1 TCTTTTT 10 0.006830828 145.0 2 >>END_MODULE SRR12161395 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161395_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3175 37.0 37.0 37.0 37.0 37.0 2 35.878 37.0 37.0 37.0 37.0 37.0 3 35.9505 37.0 37.0 37.0 37.0 37.0 4 36.063 37.0 37.0 37.0 37.0 37.0 5 36.0865 37.0 37.0 37.0 37.0 37.0 6 36.2395 37.0 37.0 37.0 37.0 37.0 7 36.052 37.0 37.0 37.0 37.0 37.0 8 36.1735 37.0 37.0 37.0 37.0 37.0 9 36.177 37.0 37.0 37.0 37.0 37.0 10-14 36.2216 37.0 37.0 37.0 37.0 37.0 15-19 36.2034 37.0 37.0 37.0 37.0 37.0 20-24 36.157799999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.11619999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.11880000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.1169 37.0 37.0 37.0 37.0 37.0 40-44 36.0366 37.0 37.0 37.0 37.0 37.0 45-49 36.0484 37.0 37.0 37.0 37.0 37.0 50-54 36.047000000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.034400000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.958200000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.018100000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.896100000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8874 37.0 37.0 37.0 37.0 37.0 80-84 35.9099 37.0 37.0 37.0 37.0 37.0 85-89 35.8077 37.0 37.0 37.0 37.0 37.0 90-94 35.82190000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.8103 37.0 37.0 37.0 37.0 37.0 100-104 35.8098 37.0 37.0 37.0 37.0 37.0 105-109 35.7557 37.0 37.0 37.0 37.0 37.0 110-114 35.722300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7139 37.0 37.0 37.0 37.0 37.0 120-124 35.7417 37.0 37.0 37.0 37.0 37.0 125-129 35.558 37.0 37.0 37.0 37.0 37.0 130-134 35.512899999999995 37.0 37.0 37.0 34.6 37.0 135-139 35.5473 37.0 37.0 37.0 37.0 37.0 140-144 35.4744 37.0 37.0 37.0 37.0 37.0 145-149 35.4433 37.0 37.0 37.0 37.0 37.0 150-151 34.89125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 3.0 16 2.0 17 1.0 18 1.0 19 0.0 20 1.0 21 0.0 22 4.0 23 1.0 24 6.0 25 6.0 26 10.0 27 14.0 28 14.0 29 18.0 30 35.0 31 40.0 32 68.0 33 110.0 34 193.0 35 547.0 36 2706.0 37 214.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.475 25.324999999999996 8.975 27.224999999999998 2 27.275 26.6 30.049999999999997 16.075 3 18.975 27.800000000000004 32.4 20.825 4 24.099999999999998 33.625 23.200000000000003 19.075 5 25.025 37.075 21.425 16.475 6 21.575 38.975 22.15 17.299999999999997 7 21.275 23.175 38.375 17.175 8 21.6 25.575 27.900000000000002 24.925 9 22.85 23.7 29.625 23.825 10-14 23.905 29.580000000000002 25.615 20.9 15-19 23.405 28.07 27.295 21.23 20-24 23.325000000000003 28.9 27.07 20.705000000000002 25-29 23.115 27.615000000000002 28.060000000000002 21.21 30-34 23.555 28.03 27.1 21.315 35-39 23.52 27.425 27.485 21.57 40-44 23.055 27.994999999999997 27.365000000000002 21.584999999999997 45-49 23.150000000000002 27.97 27.52 21.36 50-54 23.49 27.85 27.310000000000002 21.349999999999998 55-59 23.165 27.250000000000004 27.779999999999998 21.805 60-64 23.11 27.955000000000002 27.810000000000002 21.125 65-69 23.765 27.18 27.495000000000005 21.560000000000002 70-74 23.74 28.27 26.345000000000002 21.645 75-79 23.375 27.92 27.41 21.295 80-84 24.035 27.305 27.74 20.919999999999998 85-89 24.165 27.860000000000003 26.640000000000004 21.335 90-94 24.215 27.495000000000005 27.255000000000003 21.035 95-99 23.75 27.794999999999998 27.415 21.04 100-104 23.86 27.139999999999997 27.82 21.18 105-109 23.825 27.950000000000003 27.150000000000002 21.075 110-114 24.19 27.045 28.17 20.595 115-119 24.62 27.58 27.02 20.78 120-124 24.185000000000002 27.155 27.58 21.08 125-129 24.09 27.775 27.505000000000003 20.630000000000003 130-134 24.89 27.68 27.250000000000004 20.18 135-139 24.895 27.345000000000002 27.025 20.735 140-144 25.355 27.405 26.915 20.325 145-149 25.35 27.639999999999997 26.77 20.24 150-151 25.45 27.750000000000004 27.0875 19.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 4.0 26 5.0 27 4.5 28 7.5 29 10.0 30 14.0 31 19.0 32 23.5 33 31.0 34 41.0 35 55.0 36 70.0 37 85.5 38 114.5 39 155.0 40 185.0 41 211.5 42 226.5 43 230.0 44 257.0 45 268.5 46 291.0 47 294.5 48 249.0 49 212.0 50 168.5 51 146.5 52 136.5 53 110.0 54 90.5 55 73.0 56 53.5 57 43.0 58 30.0 59 18.5 60 16.5 61 10.5 62 5.0 63 5.0 64 4.0 65 2.0 66 1.0 67 1.0 68 2.0 69 2.5 70 2.0 71 1.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.28950863213812 88.75 2 5.3120849933598935 10.0 3 0.3187250996015936 0.8999999999999999 4 0.05312084993359894 0.2 5 0.0 0.0 6 0.02656042496679947 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.7374999999999998 0.0 0.0 0.0 0.0 122-123 2.0374999999999996 0.0 0.0 0.0 0.0 124-125 2.25 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATGAG 10 0.006830828 145.0 7 >>END_MODULE Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719027 spots for SRR12161395.sra Written 719027 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra Read 719008 spots for SRR12161395.sra Written 719008 spots for SRR12161395.sra SRR ids: ['SRR12161395.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5q1p73wr SRR12161395.sra spots: 14380179 blocks: [[1, 719008], [719009, 1438016], [1438017, 2157024], [2157025, 2876032], [2876033, 3595040], [3595041, 4314048], [4314049, 5033056], [5033057, 5752064], [5752065, 6471072], [6471073, 7190080], [7190081, 7909088], [7909089, 8628096], [8628097, 9347104], [9347105, 10066112], [10066113, 10785120], [10785121, 11504128], [11504129, 12223136], [12223137, 12942144], [12942145, 13661152], [13661153, 14380179]] SRR12161395 file size 4865313 SRR12161395 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161395 SRR12161395_1.fastq SRR12161395_2.fastq Input file: SRR12161395_1.fastq Paired file: SRR12161395_2.fastq trimmed: SRR12161395-trimmed-pair1.fastq, SRR12161395-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:03:59 2025 >> started Thu Feb 13 21:04:14 2025 >> done (14.929s) 14380179 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1458 ( 0.01%) empty read pairs filtered out after trimming by size control 14378701 (99.99%) read pairs available; of these: 1034163 ( 7.19%) trimmed read pairs available after processing 13344538 (92.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 5 0.00% 24 1 0.00% 25 2 0.00% 26 9 0.00% 27 2 0.00% 28 6 0.00% 29 2 0.00% 30 4 0.00% 31 9 0.00% 32 8 0.00% 33 9 0.00% 34 11 0.00% 35 9 0.00% 36 7 0.00% 37 8 0.00% 38 7 0.00% 39 14 0.00% 40 9 0.00% 41 20 0.00% 42 12 0.00% 43 11 0.00% 44 21 0.00% 45 17 0.00% 46 14 0.00% 47 19 0.00% 48 15 0.00% 49 24 0.00% 50 23 0.00% 51 25 0.00% 52 32 0.00% 53 34 0.00% 54 33 0.00% 55 32 0.00% 56 33 0.00% 57 56 0.00% 58 44 0.00% 59 53 0.00% 60 70 0.00% 61 79 0.00% 62 87 0.00% 63 85 0.00% 64 96 0.00% 65 98 0.00% 66 122 0.00% 67 151 0.00% 68 123 0.00% 69 197 0.00% 70 192 0.00% 71 208 0.00% 72 289 0.00% 73 274 0.00% 74 337 0.00% 75 361 0.00% 76 366 0.00% 77 458 0.00% 78 554 0.00% 79 620 0.00% 80 637 0.00% 81 783 0.01% 82 899 0.01% 83 1025 0.01% 84 1148 0.01% 85 1242 0.01% 86 1433 0.01% 87 1531 0.01% 88 1669 0.01% 89 1821 0.01% 90 1965 0.01% 91 2248 0.02% 92 2528 0.02% 93 2824 0.02% 94 3053 0.02% 95 3408 0.02% 96 3703 0.03% 97 4066 0.03% 98 4332 0.03% 99 4517 0.03% 100 4958 0.03% 101 5420 0.04% 102 5902 0.04% 103 6471 0.05% 104 6849 0.05% 105 7196 0.05% 106 7718 0.05% 107 8319 0.06% 108 8597 0.06% 109 9187 0.06% 110 9485 0.07% 111 10038 0.07% 112 10641 0.07% 113 11190 0.08% 114 11653 0.08% 115 12490 0.09% 116 12940 0.09% 117 13703 0.10% 118 14230 0.10% 119 14645 0.10% 120 15571 0.11% 121 15643 0.11% 122 16482 0.11% 123 17318 0.12% 124 17917 0.12% 125 18620 0.13% 126 19276 0.13% 127 19872 0.14% 128 20712 0.14% 129 21019 0.15% 130 21934 0.15% 131 22757 0.16% 132 23130 0.16% 133 24070 0.17% 134 25008 0.17% 135 25292 0.18% 136 26176 0.18% 137 26470 0.18% 138 27465 0.19% 139 28544 0.20% 140 29079 0.20% 141 29538 0.21% 142 30455 0.21% 143 31063 0.22% 144 31916 0.22% 145 33040 0.23% 146 33050 0.23% 147 34052 0.24% 148 35250 0.25% 149 35373 0.25% 150 36187 0.25% 151 13344538 92.81% 14378701 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=17 prefix-density=0.89 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.21 sequence-density-rank=19 fanout-score=7.64 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=3.5 sequence=AAGCATGGCACAGGCCAGCTTCAAGCTCATTGAAGAAGCCATTATATGCTAGCAGAATATTACAACTGGAATTATAAGAAGATTTTAGAGTATGGTTTAAGACTACTGCCCTTGAAG criterion=sequence-density sequence-density=1.33 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=20 prefix-density=1.34 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=30.07 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=9.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12161395 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:04:57 Started mapping on | Feb 13 21:04:57 Finished on | Feb 13 21:06:23 Mapping speed, Million of reads per hour | 601.90 Number of input reads | 14378701 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13414061 Uniquely mapped reads % | 93.29% Average mapped length | 297.76 Number of splices: Total | 12731733 Number of splices: Annotated (sjdb) | 12448391 Number of splices: GT/AG | 12481701 Number of splices: GC/AG | 203321 Number of splices: AT/AC | 14670 Number of splices: Non-canonical | 32041 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.55 Insertion rate per base | 0.03% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454034 % of reads mapped to multiple loci | 3.16% Number of reads mapped to too many loci | 171084 % of reads mapped to too many loci | 1.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.09% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 510606 510606 510606 N_multimapping 454034 454034 454034 N_noFeature 432916 13268952 482404 N_ambiguous 179453 884 83246 UnstrandedReadsAssigned:12801692 PositiveStrandReadsAssigned:144225 NegativeStrandReadsAssigned:12848411 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161395 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161395-trimmed-pair1.fastq SRR12161395-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,378,701 reads, 12,961,248 reads pseudoaligned [quant] estimated average fragment length: 260.993 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR12161395.ke.tsv 34699 SRR12161395.se.tsv 87100 total ==> SRR12161395.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.01 338 12.9869 Potri.005G024800.1.v4.1 1035 775.007 67 5.83953 Potri.004G059700.1.v4.1 961 701.096 25 2.40864 Potri.007G009000.2.v4.1 1416 1156.01 0 0 Potri.003G141000.2.v4.1 2943 2683.01 324 8.15703 Potri.016G087400.1.v4.1 270 75.5913 978.98 874.804 Potri.015G069301.1.v4.1 564 314.471 0 0 Potri.010G195200.1.v4.1 1773 1513.01 2 0.089289 Potri.012G127500.1.v4.1 977 717.067 1524 143.56 ==> SRR12161395.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 144 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12161395 completed mapping pipeline successfully