Starting /dee2/code/volunteer_pipeline.sh SRR12161396 current disk space = 3088255074304 free memory = 1582338548 SRR12161396 SRAfilesize df8e3913ddcfd77ed5afd1981939b394 SRR12161396.sra SRR12161396.sra file validated SRR12161396 is paired end SRR12161396 is conventional basespace SRR12161396 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161396_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5795 37.0 37.0 37.0 37.0 37.0 2 36.505 37.0 37.0 37.0 37.0 37.0 3 36.5805 37.0 37.0 37.0 37.0 37.0 4 36.5525 37.0 37.0 37.0 37.0 37.0 5 36.581 37.0 37.0 37.0 37.0 37.0 6 36.491 37.0 37.0 37.0 37.0 37.0 7 36.489 37.0 37.0 37.0 37.0 37.0 8 36.532 37.0 37.0 37.0 37.0 37.0 9 36.5585 37.0 37.0 37.0 37.0 37.0 10-14 36.5721 37.0 37.0 37.0 37.0 37.0 15-19 36.54280000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5013 37.0 37.0 37.0 37.0 37.0 25-29 36.4705 37.0 37.0 37.0 37.0 37.0 30-34 36.4184 37.0 37.0 37.0 37.0 37.0 35-39 36.39020000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.386100000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3895 37.0 37.0 37.0 37.0 37.0 50-54 36.3524 37.0 37.0 37.0 37.0 37.0 55-59 36.3531 37.0 37.0 37.0 37.0 37.0 60-64 36.3474 37.0 37.0 37.0 37.0 37.0 65-69 36.311600000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.2666 37.0 37.0 37.0 37.0 37.0 75-79 36.2664 37.0 37.0 37.0 37.0 37.0 80-84 36.2679 37.0 37.0 37.0 37.0 37.0 85-89 36.2205 37.0 37.0 37.0 37.0 37.0 90-94 36.2211 37.0 37.0 37.0 37.0 37.0 95-99 36.206100000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.1997 37.0 37.0 37.0 37.0 37.0 105-109 36.1379 37.0 37.0 37.0 37.0 37.0 110-114 36.107299999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.07940000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.061099999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0535 37.0 37.0 37.0 37.0 37.0 130-134 36.0368 37.0 37.0 37.0 37.0 37.0 135-139 35.922900000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.9348 37.0 37.0 37.0 37.0 37.0 145-149 35.846500000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.75075 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 2.0 23 1.0 24 3.0 25 4.0 26 4.0 27 11.0 28 16.0 29 17.0 30 31.0 31 33.0 32 47.0 33 75.0 34 116.0 35 258.0 36 2925.0 37 455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.24662331165583 12.906453226613307 6.378189094547274 37.46873436718359 2 20.65 11.774999999999999 34.2 33.375 3 16.675 17.05 27.400000000000002 38.875 4 21.75 24.474999999999998 24.349999999999998 29.425 5 23.0 30.225 24.525 22.25 6 21.2 33.25 24.0 21.55 7 14.95 27.675 40.849999999999994 16.525000000000002 8 19.0 27.224999999999998 30.2 23.575 9 17.675 25.0 35.05 22.275 10-14 20.0 30.214999999999996 27.045 22.74 15-19 19.77 27.889999999999997 28.205000000000002 24.135 20-24 19.61 28.860000000000003 27.415 24.115000000000002 25-29 19.52 29.015 27.67 23.794999999999998 30-34 20.044999999999998 29.07 27.11 23.775 35-39 20.595 27.755000000000003 27.439999999999998 24.21 40-44 20.54 28.835 26.950000000000003 23.674999999999997 45-49 20.095 28.425 27.134999999999998 24.345 50-54 20.150000000000002 28.275 27.450000000000003 24.125 55-59 19.975 29.28 26.950000000000003 23.794999999999998 60-64 20.32 28.76 26.605 24.315 65-69 20.385 28.405 27.6 23.61 70-74 20.64 28.425 26.955000000000002 23.98 75-79 20.215 27.915 27.905 23.965 80-84 20.395 28.134999999999998 27.72 23.75 85-89 20.765 28.1 27.61 23.525 90-94 20.565 28.12 27.11 24.205 95-99 21.035 27.57 27.22 24.175 100-104 20.695 28.189999999999998 27.67 23.445 105-109 21.275 27.889999999999997 27.055 23.78 110-114 20.435 28.03 27.425 24.11 115-119 21.575 27.92 27.3 23.205000000000002 120-124 20.695 27.965 27.389999999999997 23.95 125-129 20.585 27.79 27.750000000000004 23.875 130-134 20.62 27.965 27.685 23.73 135-139 21.385 27.750000000000004 26.875 23.990000000000002 140-144 21.6 27.815 26.99 23.595 145-149 21.215 27.925 26.775 24.085 150-151 20.7 27.987499999999997 26.575 24.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 2.5 23 4.5 24 6.0 25 4.5 26 3.0 27 4.5 28 9.5 29 13.0 30 16.5 31 21.5 32 27.5 33 36.0 34 53.5 35 67.0 36 75.5 37 101.0 38 132.0 39 156.5 40 180.0 41 203.0 42 218.0 43 237.0 44 242.0 45 225.0 46 238.5 47 252.5 48 233.0 49 228.0 50 209.0 51 162.5 52 135.5 53 110.0 54 79.5 55 65.5 56 52.5 57 41.5 58 36.0 59 31.5 60 25.0 61 20.0 62 14.0 63 5.5 64 3.5 65 2.0 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.13170472650026 88.625 2 5.523101433882103 10.4 3 0.34519383961763145 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.5125 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 3.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCGAAG 10 0.006830828 145.0 2 GTGCGAA 10 0.006830828 145.0 1 >>END_MODULE SRR12161396 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161396_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3835 37.0 37.0 37.0 37.0 37.0 2 36.084 37.0 37.0 37.0 37.0 37.0 3 36.0735 37.0 37.0 37.0 37.0 37.0 4 36.2465 37.0 37.0 37.0 37.0 37.0 5 36.288 37.0 37.0 37.0 37.0 37.0 6 36.2975 37.0 37.0 37.0 37.0 37.0 7 36.379 37.0 37.0 37.0 37.0 37.0 8 36.382 37.0 37.0 37.0 37.0 37.0 9 36.3155 37.0 37.0 37.0 37.0 37.0 10-14 36.3043 37.0 37.0 37.0 37.0 37.0 15-19 36.28150000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.282 37.0 37.0 37.0 37.0 37.0 25-29 36.206100000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.17530000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.2374 37.0 37.0 37.0 37.0 37.0 40-44 36.153800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.1614 37.0 37.0 37.0 37.0 37.0 50-54 36.1133 37.0 37.0 37.0 37.0 37.0 55-59 36.067499999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.9934 37.0 37.0 37.0 37.0 37.0 65-69 35.987100000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.97539999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.9287 37.0 37.0 37.0 37.0 37.0 80-84 36.00790000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9514 37.0 37.0 37.0 37.0 37.0 90-94 35.963800000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.930600000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.9655 37.0 37.0 37.0 37.0 37.0 105-109 35.8728 37.0 37.0 37.0 37.0 37.0 110-114 35.8855 37.0 37.0 37.0 37.0 37.0 115-119 35.8193 37.0 37.0 37.0 37.0 37.0 120-124 35.8433 37.0 37.0 37.0 37.0 37.0 125-129 35.7125 37.0 37.0 37.0 37.0 37.0 130-134 35.6629 37.0 37.0 37.0 37.0 37.0 135-139 35.7201 37.0 37.0 37.0 37.0 37.0 140-144 35.6397 37.0 37.0 37.0 37.0 37.0 145-149 35.6815 37.0 37.0 37.0 37.0 37.0 150-151 35.110749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 5.0 16 3.0 17 1.0 18 2.0 19 1.0 20 1.0 21 4.0 22 1.0 23 4.0 24 10.0 25 7.0 26 8.0 27 12.0 28 9.0 29 19.0 30 22.0 31 30.0 32 50.0 33 92.0 34 167.0 35 426.0 36 2811.0 37 311.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.949999999999996 24.675 8.450000000000001 24.925 2 28.549999999999997 25.5 28.175 17.775 3 20.349999999999998 29.025000000000002 31.525 19.1 4 22.575 33.050000000000004 25.75 18.625 5 25.924999999999997 36.375 20.625 17.075000000000003 6 20.599999999999998 39.45 22.650000000000002 17.299999999999997 7 19.425 23.1 38.7 18.775 8 21.325 25.974999999999998 28.7 24.0 9 22.5 24.8 30.125 22.575 10-14 23.735 29.165000000000003 26.125 20.974999999999998 15-19 23.0 28.9 26.889999999999997 21.21 20-24 23.01 28.845 26.8 21.345 25-29 23.09 28.32 27.265 21.325 30-34 22.875 28.694999999999997 27.16 21.27 35-39 23.34 28.62 27.275 20.765 40-44 22.895 27.735 27.825 21.545 45-49 22.84 27.22 28.000000000000004 21.94 50-54 23.325000000000003 28.125 26.845000000000002 21.705 55-59 23.405 27.915 27.560000000000002 21.12 60-64 23.375 27.900000000000002 27.089999999999996 21.634999999999998 65-69 23.235 27.834999999999997 27.115000000000002 21.815 70-74 23.810000000000002 27.529999999999998 27.27 21.39 75-79 23.425 27.575 27.485 21.515 80-84 23.064999999999998 27.775 27.150000000000002 22.009999999999998 85-89 23.78 27.445000000000004 27.544999999999998 21.23 90-94 23.755000000000003 27.355 27.455000000000002 21.435000000000002 95-99 23.945 27.644999999999996 27.445000000000004 20.965 100-104 24.365000000000002 27.224999999999998 27.339999999999996 21.07 105-109 23.325000000000003 28.035 27.500000000000004 21.14 110-114 23.400000000000002 27.96 27.384999999999998 21.255 115-119 24.05 27.455000000000002 27.57 20.925 120-124 23.7 27.96 27.22 21.12 125-129 24.055 27.98 27.08 20.885 130-134 24.19 27.215 27.755000000000003 20.84 135-139 24.45 27.500000000000004 27.6 20.45 140-144 24.725 27.205000000000002 27.345000000000002 20.724999999999998 145-149 24.709999999999997 27.150000000000002 27.125 21.015 150-151 24.0375 28.212500000000002 27.175 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.5 15 1.5 16 1.5 17 0.5 18 1.5 19 3.0 20 1.5 21 0.0 22 0.5 23 1.5 24 2.0 25 4.5 26 5.5 27 5.5 28 7.0 29 7.5 30 13.5 31 19.0 32 27.0 33 39.0 34 44.5 35 52.0 36 75.0 37 93.0 38 119.5 39 157.5 40 183.5 41 198.5 42 219.5 43 256.5 44 262.5 45 246.5 46 264.5 47 268.5 48 239.5 49 214.0 50 200.5 51 160.5 52 109.0 53 100.5 54 83.5 55 62.0 56 56.0 57 43.5 58 34.0 59 32.5 60 24.0 61 16.5 62 10.0 63 5.5 64 5.5 65 2.0 66 0.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.62536404553879 89.35 2 4.898067249139529 9.25 3 0.4500926661371459 1.275 4 0.0 0.0 5 0.026476039184537992 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.8999999999999999 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.2625 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719943 spots for SRR12161396.sra Written 719943 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra Read 719938 spots for SRR12161396.sra Written 719938 spots for SRR12161396.sra SRR ids: ['SRR12161396.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c6ud3oq6 SRR12161396.sra spots: 14398765 blocks: [[1, 719938], [719939, 1439876], [1439877, 2159814], [2159815, 2879752], [2879753, 3599690], [3599691, 4319628], [4319629, 5039566], [5039567, 5759504], [5759505, 6479442], [6479443, 7199380], [7199381, 7919318], [7919319, 8639256], [8639257, 9359194], [9359195, 10079132], [10079133, 10799070], [10799071, 11519008], [11519009, 12238946], [12238947, 12958884], [12958885, 13678822], [13678823, 14398765]] SRR12161396 file size 4871629 SRR12161396 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161396 SRR12161396_1.fastq SRR12161396_2.fastq Input file: SRR12161396_1.fastq Paired file: SRR12161396_2.fastq trimmed: SRR12161396-trimmed-pair1.fastq, SRR12161396-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:14:32 2025 >> started Thu Feb 13 21:14:47 2025 >> done (15.089s) 14398765 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 2753 ( 0.02%) empty read pairs filtered out after trimming by size control 14395998 (99.98%) read pairs available; of these: 795881 ( 5.53%) trimmed read pairs available after processing 13600117 (94.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 3 0.00% 23 3 0.00% 24 5 0.00% 25 6 0.00% 26 9 0.00% 27 4 0.00% 28 8 0.00% 29 9 0.00% 30 3 0.00% 31 8 0.00% 32 10 0.00% 33 10 0.00% 34 5 0.00% 35 5 0.00% 36 5 0.00% 37 6 0.00% 38 12 0.00% 39 10 0.00% 40 10 0.00% 41 15 0.00% 42 14 0.00% 43 13 0.00% 44 12 0.00% 45 12 0.00% 46 8 0.00% 47 9 0.00% 48 10 0.00% 49 17 0.00% 50 24 0.00% 51 25 0.00% 52 31 0.00% 53 17 0.00% 54 24 0.00% 55 32 0.00% 56 27 0.00% 57 22 0.00% 58 39 0.00% 59 51 0.00% 60 42 0.00% 61 48 0.00% 62 73 0.00% 63 55 0.00% 64 73 0.00% 65 76 0.00% 66 78 0.00% 67 85 0.00% 68 86 0.00% 69 116 0.00% 70 141 0.00% 71 177 0.00% 72 204 0.00% 73 194 0.00% 74 216 0.00% 75 256 0.00% 76 294 0.00% 77 310 0.00% 78 337 0.00% 79 404 0.00% 80 443 0.00% 81 512 0.00% 82 612 0.00% 83 706 0.00% 84 696 0.00% 85 886 0.01% 86 971 0.01% 87 1095 0.01% 88 1239 0.01% 89 1290 0.01% 90 1487 0.01% 91 1490 0.01% 92 1687 0.01% 93 2000 0.01% 94 2188 0.02% 95 2465 0.02% 96 2541 0.02% 97 2731 0.02% 98 3012 0.02% 99 3247 0.02% 100 3423 0.02% 101 3743 0.03% 102 4121 0.03% 103 4340 0.03% 104 4692 0.03% 105 4943 0.03% 106 5515 0.04% 107 5614 0.04% 108 5967 0.04% 109 6404 0.04% 110 6671 0.05% 111 7081 0.05% 112 7325 0.05% 113 7872 0.05% 114 8419 0.06% 115 8972 0.06% 116 9544 0.07% 117 9964 0.07% 118 10487 0.07% 119 10738 0.07% 120 11312 0.08% 121 11642 0.08% 122 12133 0.08% 123 12502 0.09% 124 13284 0.09% 125 13823 0.10% 126 14434 0.10% 127 15102 0.10% 128 15258 0.11% 129 16189 0.11% 130 16736 0.12% 131 17248 0.12% 132 17889 0.12% 133 18545 0.13% 134 19311 0.13% 135 19565 0.14% 136 20432 0.14% 137 20814 0.14% 138 21823 0.15% 139 22507 0.16% 140 23041 0.16% 141 23853 0.17% 142 24621 0.17% 143 25410 0.18% 144 26367 0.18% 145 26635 0.19% 146 27372 0.19% 147 28145 0.20% 148 28981 0.20% 149 29452 0.20% 150 30521 0.21% 151 13600117 94.47% 14395998 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=13 prefix-density=0.70 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=10.11 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=3.6 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=26 prefix-density=0.54 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=88.93 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.0 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12161396 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:15:28 Started mapping on | Feb 13 21:15:28 Finished on | Feb 13 21:17:13 Mapping speed, Million of reads per hour | 493.58 Number of input reads | 14395998 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13400543 Uniquely mapped reads % | 93.09% Average mapped length | 298.63 Number of splices: Total | 12889573 Number of splices: Annotated (sjdb) | 12627939 Number of splices: GT/AG | 12628568 Number of splices: GC/AG | 215960 Number of splices: AT/AC | 9883 Number of splices: Non-canonical | 35162 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386206 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 98096 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 609249 609249 609249 N_multimapping 386206 386206 386206 N_noFeature 421151 13226453 470301 N_ambiguous 219466 918 93908 UnstrandedReadsAssigned:12759926 PositiveStrandReadsAssigned:173172 NegativeStrandReadsAssigned:12836334 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161396 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161396-trimmed-pair1.fastq SRR12161396-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,395,998 reads, 12,916,096 reads pseudoaligned [quant] estimated average fragment length: 270.72 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR12161396.ke.tsv 34699 SRR12161396.se.tsv 87100 total ==> SRR12161396.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.28 308 10.9602 Potri.005G024800.1.v4.1 1035 765.28 177 14.389 Potri.004G059700.1.v4.1 961 691.424 69 6.20842 Potri.007G009000.2.v4.1 1416 1146.28 0 0 Potri.003G141000.2.v4.1 2943 2673.28 420 9.77421 Potri.016G087400.1.v4.1 270 72.1058 946 816.203 Potri.015G069301.1.v4.1 564 307.24 0 0 Potri.010G195200.1.v4.1 1773 1503.28 4 0.165538 Potri.012G127500.1.v4.1 977 707.336 617 54.2671 ==> SRR12161396.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 130 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 227 Potri.001G212900.v4.1 73 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 52 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR12161396 completed mapping pipeline successfully