Starting /dee2/code/volunteer_pipeline.sh SRR12161397 current disk space = 3088215388160 free memory = 1578936520 SRR12161397 SRAfilesize a79656243fa09dca03db3e8754e6f68d SRR12161397.sra SRR12161397.sra file validated SRR12161397 is paired end SRR12161397 is conventional basespace SRR12161397 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161397_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59975 37.0 37.0 37.0 37.0 37.0 2 36.4955 37.0 37.0 37.0 37.0 37.0 3 36.593 37.0 37.0 37.0 37.0 37.0 4 36.6245 37.0 37.0 37.0 37.0 37.0 5 36.633 37.0 37.0 37.0 37.0 37.0 6 36.59 37.0 37.0 37.0 37.0 37.0 7 36.5455 37.0 37.0 37.0 37.0 37.0 8 36.58 37.0 37.0 37.0 37.0 37.0 9 36.5445 37.0 37.0 37.0 37.0 37.0 10-14 36.5691 37.0 37.0 37.0 37.0 37.0 15-19 36.5363 37.0 37.0 37.0 37.0 37.0 20-24 36.5419 37.0 37.0 37.0 37.0 37.0 25-29 36.513799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4418 37.0 37.0 37.0 37.0 37.0 35-39 36.4561 37.0 37.0 37.0 37.0 37.0 40-44 36.417199999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.4168 37.0 37.0 37.0 37.0 37.0 50-54 36.3632 37.0 37.0 37.0 37.0 37.0 55-59 36.3457 37.0 37.0 37.0 37.0 37.0 60-64 36.3583 37.0 37.0 37.0 37.0 37.0 65-69 36.35510000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3472 37.0 37.0 37.0 37.0 37.0 75-79 36.2792 37.0 37.0 37.0 37.0 37.0 80-84 36.336200000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.294399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.291399999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2307 37.0 37.0 37.0 37.0 37.0 100-104 36.2746 37.0 37.0 37.0 37.0 37.0 105-109 36.168 37.0 37.0 37.0 37.0 37.0 110-114 36.21079999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.1697 37.0 37.0 37.0 37.0 37.0 120-124 36.16709999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.0925 37.0 37.0 37.0 37.0 37.0 130-134 36.0364 37.0 37.0 37.0 37.0 37.0 135-139 36.003499999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.958600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.9583 37.0 37.0 37.0 37.0 37.0 150-151 35.765249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 1.0 23 1.0 24 1.0 25 0.0 26 3.0 27 7.0 28 13.0 29 20.0 30 22.0 31 38.0 32 48.0 33 71.0 34 102.0 35 262.0 36 2961.0 37 448.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.38684671167792 12.80320080020005 5.376344086021505 34.433608402100525 2 20.3 12.725 32.875 34.1 3 16.425 18.05 30.55 34.975 4 22.175 27.025 24.099999999999998 26.700000000000003 5 22.75 32.725 24.075 20.45 6 20.150000000000002 34.9 23.45 21.5 7 14.45 25.224999999999998 42.4 17.925 8 18.275 25.7 30.65 25.374999999999996 9 17.525 23.825 34.55 24.099999999999998 10-14 19.885 29.535 27.37 23.21 15-19 20.155 28.64 27.439999999999998 23.765 20-24 19.845 28.455000000000002 27.255000000000003 24.445 25-29 20.535 28.395 27.35 23.72 30-34 19.975 27.915 27.77 24.34 35-39 20.335 28.035 26.834999999999997 24.795 40-44 20.225 28.26 27.55 23.965 45-49 20.495 28.389999999999997 27.05 24.065 50-54 20.075000000000003 27.975 27.79 24.16 55-59 20.255000000000003 27.6 27.810000000000002 24.335 60-64 20.455000000000002 28.165000000000003 27.334999999999997 24.044999999999998 65-69 19.91 27.994999999999997 27.334999999999997 24.759999999999998 70-74 20.36 28.1 27.11 24.43 75-79 20.345 27.860000000000003 26.950000000000003 24.845 80-84 20.74 28.54 27.02 23.7 85-89 20.46 27.625 27.644999999999996 24.27 90-94 20.78 28.29 26.875 24.055 95-99 20.935000000000002 27.529999999999998 27.334999999999997 24.2 100-104 20.905 27.500000000000004 27.41 24.185000000000002 105-109 21.055 27.400000000000002 27.42 24.125 110-114 21.240000000000002 27.750000000000004 27.265 23.745 115-119 21.09 27.815 26.939999999999998 24.154999999999998 120-124 20.755000000000003 27.71 27.295 24.240000000000002 125-129 21.185000000000002 27.284999999999997 27.43 24.099999999999998 130-134 20.669999999999998 28.050000000000004 27.48 23.799999999999997 135-139 20.835 27.87 26.93 24.365000000000002 140-144 21.12 27.560000000000002 27.165 24.154999999999998 145-149 21.12 27.515 27.055 24.310000000000002 150-151 21.775 27.3875 26.25 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 2.5 22 1.5 23 0.0 24 3.0 25 7.0 26 6.0 27 8.5 28 10.0 29 9.0 30 14.5 31 23.0 32 31.5 33 39.0 34 49.5 35 64.5 36 76.0 37 82.5 38 108.0 39 141.5 40 159.0 41 181.5 42 215.0 43 233.5 44 239.0 45 257.0 46 269.0 47 267.5 48 252.0 49 222.5 50 189.0 51 160.0 52 147.0 53 116.5 54 91.5 55 84.5 56 66.5 57 50.0 58 39.0 59 28.5 60 18.0 61 11.0 62 5.0 63 3.5 64 4.0 65 1.5 66 1.5 67 1.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 94.66173361522199 89.55 2 5.021141649048626 9.5 3 0.2642706131078224 0.75 4 0.052854122621564484 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8500000000000001 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.6124999999999998 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.0 0.0 0.0 0.0 0.0 136-137 3.2874999999999996 0.0 0.0 0.0 0.0 138-139 3.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAATC 10 0.006830828 145.0 2 >>END_MODULE SRR12161397 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161397_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3 37.0 37.0 37.0 37.0 37.0 2 35.964 37.0 37.0 37.0 37.0 37.0 3 36.1895 37.0 37.0 37.0 37.0 37.0 4 36.198 37.0 37.0 37.0 37.0 37.0 5 36.2675 37.0 37.0 37.0 37.0 37.0 6 36.1465 37.0 37.0 37.0 37.0 37.0 7 36.1475 37.0 37.0 37.0 37.0 37.0 8 36.3585 37.0 37.0 37.0 37.0 37.0 9 36.2265 37.0 37.0 37.0 37.0 37.0 10-14 36.2113 37.0 37.0 37.0 37.0 37.0 15-19 36.229400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.178399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1633 37.0 37.0 37.0 37.0 37.0 30-34 36.0841 37.0 37.0 37.0 37.0 37.0 35-39 36.12 37.0 37.0 37.0 37.0 37.0 40-44 36.080499999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.0766 37.0 37.0 37.0 37.0 37.0 50-54 36.0767 37.0 37.0 37.0 37.0 37.0 55-59 36.040200000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.9551 37.0 37.0 37.0 37.0 37.0 65-69 36.0181 37.0 37.0 37.0 37.0 37.0 70-74 35.89919999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.8837 37.0 37.0 37.0 37.0 37.0 80-84 35.98440000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9046 37.0 37.0 37.0 37.0 37.0 90-94 35.8836 37.0 37.0 37.0 37.0 37.0 95-99 35.8373 37.0 37.0 37.0 37.0 37.0 100-104 35.892399999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.828199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.8276 37.0 37.0 37.0 37.0 37.0 115-119 35.799299999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.7273 37.0 37.0 37.0 37.0 37.0 125-129 35.6514 37.0 37.0 37.0 37.0 37.0 130-134 35.5608 37.0 37.0 37.0 37.0 37.0 135-139 35.60010000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.470699999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.5472 37.0 37.0 37.0 37.0 37.0 150-151 35.0515 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 6.0 15 2.0 16 3.0 17 2.0 18 3.0 19 1.0 20 1.0 21 3.0 22 2.0 23 5.0 24 2.0 25 8.0 26 11.0 27 8.0 28 16.0 29 23.0 30 11.0 31 37.0 32 51.0 33 97.0 34 184.0 35 476.0 36 2761.0 37 280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.525 24.975 6.950000000000001 20.549999999999997 2 27.675 26.474999999999998 27.175 18.675 3 22.075 28.299999999999997 31.5 18.125 4 24.85 35.175 23.0 16.975 5 25.275 36.475 20.549999999999997 17.7 6 22.375 38.324999999999996 21.375 17.925 7 21.25 23.200000000000003 37.0 18.55 8 22.400000000000002 27.0 26.450000000000003 24.15 9 22.25 23.849999999999998 29.5 24.4 10-14 24.490000000000002 29.21 25.230000000000004 21.07 15-19 23.705000000000002 28.305000000000003 26.505000000000003 21.485000000000003 20-24 23.98 29.145 26.525 20.349999999999998 25-29 23.815 28.4 26.665 21.12 30-34 23.165 27.985 27.68 21.17 35-39 23.445 27.91 27.185 21.46 40-44 23.724999999999998 28.105000000000004 27.55 20.62 45-49 23.145 27.915 27.43 21.51 50-54 23.380000000000003 28.444999999999997 27.255000000000003 20.919999999999998 55-59 23.515 27.865000000000002 27.36 21.26 60-64 23.535 28.125 27.21 21.13 65-69 23.794999999999998 27.200000000000003 27.48 21.525 70-74 23.915 28.449999999999996 26.135 21.5 75-79 23.775 27.450000000000003 27.034999999999997 21.740000000000002 80-84 23.465 27.405 27.375 21.755 85-89 23.995 27.42 27.295 21.29 90-94 24.169999999999998 27.650000000000002 26.669999999999998 21.51 95-99 23.905 27.67 27.265 21.16 100-104 23.815 27.605 27.405 21.175 105-109 24.095 27.229999999999997 27.73 20.945 110-114 23.835 28.42 26.85 20.895 115-119 24.18 27.889999999999997 27.255000000000003 20.674999999999997 120-124 24.725 27.800000000000004 27.095000000000002 20.380000000000003 125-129 25.040000000000003 27.42 26.979999999999997 20.560000000000002 130-134 24.985 27.389999999999997 26.685 20.94 135-139 24.665 27.005000000000003 27.800000000000004 20.53 140-144 25.345000000000002 27.105 27.015 20.535 145-149 24.59 28.065 26.58 20.765 150-151 24.8625 28.025 26.887499999999996 20.225 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 1.0 19 1.5 20 1.0 21 1.5 22 2.0 23 1.0 24 0.5 25 1.0 26 1.0 27 4.5 28 5.0 29 5.0 30 9.5 31 15.5 32 21.0 33 31.5 34 44.0 35 57.0 36 71.5 37 91.5 38 120.5 39 151.0 40 173.0 41 205.5 42 247.0 43 252.5 44 251.5 45 265.0 46 259.0 47 247.0 48 236.0 49 212.5 50 174.0 51 160.0 52 148.5 53 115.5 54 102.0 55 76.5 56 54.5 57 48.5 58 34.0 59 23.5 60 16.5 61 10.0 62 8.5 63 7.0 64 4.5 65 2.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 1.5 86 1.5 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 94.52127659574468 88.85 2 4.8936170212765955 9.2 3 0.45212765957446804 1.275 4 0.05319148936170213 0.2 5 0.0 0.0 6 0.05319148936170213 0.3 7 0.026595744680851064 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.175 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.8499999999999996 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCAGT 10 0.006830828 145.0 7 AAAGATA 10 0.006830828 145.0 4 >>END_MODULE Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694082 spots for SRR12161397.sra Written 694082 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra Read 694074 spots for SRR12161397.sra Written 694074 spots for SRR12161397.sra SRR ids: ['SRR12161397.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_88ch2__w SRR12161397.sra spots: 13881488 blocks: [[1, 694074], [694075, 1388148], [1388149, 2082222], [2082223, 2776296], [2776297, 3470370], [3470371, 4164444], [4164445, 4858518], [4858519, 5552592], [5552593, 6246666], [6246667, 6940740], [6940741, 7634814], [7634815, 8328888], [8328889, 9022962], [9022963, 9717036], [9717037, 10411110], [10411111, 11105184], [11105185, 11799258], [11799259, 12493332], [12493333, 13187406], [13187407, 13881488]] SRR12161397 file size 4695836 SRR12161397 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161397 SRR12161397_1.fastq SRR12161397_2.fastq Input file: SRR12161397_1.fastq Paired file: SRR12161397_2.fastq trimmed: SRR12161397-trimmed-pair1.fastq, SRR12161397-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:19:55 2025 >> started Thu Feb 13 21:20:10 2025 >> done (15.048s) 13881488 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 2740 ( 0.02%) empty read pairs filtered out after trimming by size control 13878729 (99.98%) read pairs available; of these: 905010 ( 6.52%) trimmed read pairs available after processing 12973719 (93.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 7 0.00% 23 10 0.00% 24 5 0.00% 25 10 0.00% 26 8 0.00% 27 13 0.00% 28 5 0.00% 29 4 0.00% 30 10 0.00% 31 7 0.00% 32 7 0.00% 33 12 0.00% 34 12 0.00% 35 10 0.00% 36 10 0.00% 37 8 0.00% 38 12 0.00% 39 4 0.00% 40 8 0.00% 41 9 0.00% 42 11 0.00% 43 13 0.00% 44 16 0.00% 45 19 0.00% 46 11 0.00% 47 14 0.00% 48 21 0.00% 49 30 0.00% 50 28 0.00% 51 30 0.00% 52 29 0.00% 53 26 0.00% 54 36 0.00% 55 23 0.00% 56 39 0.00% 57 34 0.00% 58 44 0.00% 59 59 0.00% 60 73 0.00% 61 65 0.00% 62 71 0.00% 63 101 0.00% 64 95 0.00% 65 90 0.00% 66 105 0.00% 67 104 0.00% 68 125 0.00% 69 162 0.00% 70 219 0.00% 71 200 0.00% 72 246 0.00% 73 241 0.00% 74 298 0.00% 75 299 0.00% 76 351 0.00% 77 393 0.00% 78 446 0.00% 79 474 0.00% 80 597 0.00% 81 683 0.00% 82 772 0.01% 83 834 0.01% 84 942 0.01% 85 1033 0.01% 86 1166 0.01% 87 1279 0.01% 88 1330 0.01% 89 1548 0.01% 90 1664 0.01% 91 1860 0.01% 92 2119 0.02% 93 2507 0.02% 94 2567 0.02% 95 2916 0.02% 96 3119 0.02% 97 3253 0.02% 98 3579 0.03% 99 3855 0.03% 100 4105 0.03% 101 4534 0.03% 102 4922 0.04% 103 5459 0.04% 104 5754 0.04% 105 6160 0.04% 106 6386 0.05% 107 6584 0.05% 108 6835 0.05% 109 7417 0.05% 110 7715 0.06% 111 8329 0.06% 112 8943 0.06% 113 9241 0.07% 114 10186 0.07% 115 10543 0.08% 116 10962 0.08% 117 11570 0.08% 118 12016 0.09% 119 12169 0.09% 120 12949 0.09% 121 13133 0.09% 122 14036 0.10% 123 15187 0.11% 124 15996 0.12% 125 16136 0.12% 126 16835 0.12% 127 17338 0.12% 128 17566 0.13% 129 18395 0.13% 130 19046 0.14% 131 19284 0.14% 132 20230 0.15% 133 21136 0.15% 134 21723 0.16% 135 22912 0.17% 136 23607 0.17% 137 23620 0.17% 138 24190 0.17% 139 24892 0.18% 140 25331 0.18% 141 25949 0.19% 142 26793 0.19% 143 27885 0.20% 144 29086 0.21% 145 30192 0.22% 146 30163 0.22% 147 31618 0.23% 148 32118 0.23% 149 32148 0.23% 150 33241 0.24% 151 12973719 93.48% 13878729 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.62 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=45.71 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=26 prefix-density=0.70 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.24 sequence-density-rank=25 fanout-score=9.04 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=4.2 sequence=GTGCCAAGGTCT SRR12161397 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:20:52 Started mapping on | Feb 13 21:20:52 Finished on | Feb 13 21:22:19 Mapping speed, Million of reads per hour | 574.29 Number of input reads | 13878729 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12970207 Uniquely mapped reads % | 93.45% Average mapped length | 298.16 Number of splices: Total | 13451134 Number of splices: Annotated (sjdb) | 13196587 Number of splices: GT/AG | 13183888 Number of splices: GC/AG | 222282 Number of splices: AT/AC | 8973 Number of splices: Non-canonical | 35991 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286098 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 75887 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 622424 622424 622424 N_multimapping 286098 286098 286098 N_noFeature 413506 12785220 465957 N_ambiguous 204239 735 71260 UnstrandedReadsAssigned:12352462 PositiveStrandReadsAssigned:184252 NegativeStrandReadsAssigned:12432990 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161397 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161397-trimmed-pair1.fastq SRR12161397-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,878,729 reads, 12,463,085 reads pseudoaligned [quant] estimated average fragment length: 260.831 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR12161397.ke.tsv 34699 SRR12161397.se.tsv 87100 total ==> SRR12161397.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.17 382 13.9002 Potri.005G024800.1.v4.1 1035 775.169 142 11.7195 Potri.004G059700.1.v4.1 961 701.251 14 1.27724 Potri.007G009000.2.v4.1 1416 1156.17 0 0 Potri.003G141000.2.v4.1 2943 2683.17 654.593 15.6078 Potri.016G087400.1.v4.1 270 73.7229 542 470.344 Potri.015G069301.1.v4.1 564 314.817 0 0 Potri.010G195200.1.v4.1 1773 1513.17 14 0.591915 Potri.012G127500.1.v4.1 977 717.219 88 7.84964 ==> SRR12161397.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 163 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12161397 completed mapping pipeline successfully