Starting /dee2/code/volunteer_pipeline.sh SRR12161398 current disk space = 3088249729024 free memory = 1580365632 SRR12161398 SRAfilesize 41239b6330e0f8a17325f7dcb0d835af SRR12161398.sra SRR12161398.sra file validated SRR12161398 is paired end SRR12161398 is conventional basespace SRR12161398 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161398_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.56075 37.0 37.0 37.0 37.0 37.0 2 36.522 37.0 37.0 37.0 37.0 37.0 3 36.55 37.0 37.0 37.0 37.0 37.0 4 36.5975 37.0 37.0 37.0 37.0 37.0 5 36.5685 37.0 37.0 37.0 37.0 37.0 6 36.6275 37.0 37.0 37.0 37.0 37.0 7 36.4985 37.0 37.0 37.0 37.0 37.0 8 36.5725 37.0 37.0 37.0 37.0 37.0 9 36.64 37.0 37.0 37.0 37.0 37.0 10-14 36.590900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5992 37.0 37.0 37.0 37.0 37.0 20-24 36.5121 37.0 37.0 37.0 37.0 37.0 25-29 36.5242 37.0 37.0 37.0 37.0 37.0 30-34 36.4833 37.0 37.0 37.0 37.0 37.0 35-39 36.4779 37.0 37.0 37.0 37.0 37.0 40-44 36.4367 37.0 37.0 37.0 37.0 37.0 45-49 36.4174 37.0 37.0 37.0 37.0 37.0 50-54 36.3966 37.0 37.0 37.0 37.0 37.0 55-59 36.368199999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3935 37.0 37.0 37.0 37.0 37.0 65-69 36.3136 37.0 37.0 37.0 37.0 37.0 70-74 36.3264 37.0 37.0 37.0 37.0 37.0 75-79 36.317600000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.323 37.0 37.0 37.0 37.0 37.0 85-89 36.2509 37.0 37.0 37.0 37.0 37.0 90-94 36.2303 37.0 37.0 37.0 37.0 37.0 95-99 36.183400000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.1425 37.0 37.0 37.0 37.0 37.0 105-109 36.17229999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1802 37.0 37.0 37.0 37.0 37.0 115-119 36.12689999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.1282 37.0 37.0 37.0 37.0 37.0 125-129 36.04299999999999 37.0 37.0 37.0 37.0 37.0 130-134 36.0597 37.0 37.0 37.0 37.0 37.0 135-139 35.961299999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.9345 37.0 37.0 37.0 37.0 37.0 145-149 35.9354 37.0 37.0 37.0 37.0 37.0 150-151 35.770250000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 2.0 24 3.0 25 2.0 26 6.0 27 3.0 28 7.0 29 15.0 30 25.0 31 32.0 32 39.0 33 75.0 34 127.0 35 296.0 36 2951.0 37 415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.25906476619154 11.552888222055515 9.077269317329332 43.11077769442361 2 19.875 13.125 35.125 31.874999999999996 3 17.375 17.5 28.175 36.95 4 21.275 25.424999999999997 23.375 29.925 5 23.5 30.8 24.125 21.575 6 20.025000000000002 35.525 22.45 22.0 7 15.775 26.6 40.575 17.05 8 18.099999999999998 25.775 29.9 26.224999999999998 9 16.775000000000002 25.75 33.875 23.599999999999998 10-14 20.0 29.78 26.834999999999997 23.385 15-19 19.36 28.265 27.245 25.130000000000003 20-24 19.855 28.410000000000004 27.455000000000002 24.279999999999998 25-29 19.31 28.625 27.675 24.39 30-34 19.54 28.165000000000003 27.689999999999998 24.605 35-39 20.505000000000003 28.645 26.775 24.075 40-44 20.025000000000002 28.22 27.13 24.625 45-49 19.445 28.58 27.365000000000002 24.610000000000003 50-54 19.685 27.939999999999998 27.565 24.81 55-59 20.24 28.294999999999998 27.26 24.205 60-64 19.755 28.62 27.37 24.255 65-69 20.09 27.91 27.589999999999996 24.41 70-74 19.935 28.27 27.310000000000002 24.485 75-79 20.005 28.32 26.919999999999998 24.755 80-84 20.369999999999997 28.444999999999997 27.279999999999998 23.905 85-89 20.585 28.555000000000003 26.865 23.995 90-94 20.495 27.575 27.750000000000004 24.18 95-99 20.505000000000003 27.74 27.544999999999998 24.21 100-104 20.585 28.38 27.115000000000002 23.919999999999998 105-109 20.715 27.99 27.73 23.565 110-114 20.225 27.905 27.6 24.27 115-119 20.560000000000002 28.18 27.400000000000002 23.86 120-124 20.53 27.985 27.235 24.25 125-129 20.77 27.529999999999998 26.935 24.765 130-134 20.630000000000003 27.61 27.57 24.19 135-139 20.9 26.834999999999997 27.755000000000003 24.51 140-144 21.125 27.685 26.729999999999997 24.46 145-149 21.095 27.775 27.015 24.115000000000002 150-151 19.8875 28.3125 27.0875 24.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 0.5 22 1.5 23 2.0 24 0.5 25 1.0 26 3.0 27 7.0 28 8.0 29 13.5 30 21.5 31 27.0 32 30.5 33 30.5 34 45.0 35 61.5 36 76.0 37 95.5 38 111.5 39 142.5 40 175.5 41 196.5 42 207.5 43 223.0 44 246.0 45 254.0 46 272.5 47 285.0 48 240.0 49 218.5 50 213.0 51 180.5 52 147.5 53 109.5 54 86.0 55 69.0 56 54.5 57 34.5 58 29.5 59 24.5 60 12.5 61 10.5 62 8.0 63 5.5 64 3.5 65 3.5 66 2.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.97764922429661 90.3 2 4.864580594267683 9.25 3 0.15777018143570865 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.3875 0.0 0.0 0.0 0.0 134-135 4.862500000000001 0.0 0.0 0.0 0.0 136-137 5.262499999999999 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGCT 10 0.006830828 145.0 9 >>END_MODULE SRR12161398 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161398_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.251 37.0 37.0 37.0 37.0 37.0 2 35.983 37.0 37.0 37.0 37.0 37.0 3 36.0805 37.0 37.0 37.0 37.0 37.0 4 36.0245 37.0 37.0 37.0 37.0 37.0 5 36.23 37.0 37.0 37.0 37.0 37.0 6 36.104 37.0 37.0 37.0 37.0 37.0 7 36.193 37.0 37.0 37.0 37.0 37.0 8 36.289 37.0 37.0 37.0 37.0 37.0 9 36.1905 37.0 37.0 37.0 37.0 37.0 10-14 36.267399999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2045 37.0 37.0 37.0 37.0 37.0 20-24 36.16590000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.1868 37.0 37.0 37.0 37.0 37.0 30-34 36.07340000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.0489 37.0 37.0 37.0 37.0 37.0 40-44 36.042100000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.057399999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.0596 37.0 37.0 37.0 37.0 37.0 55-59 35.9379 37.0 37.0 37.0 37.0 37.0 60-64 35.995 37.0 37.0 37.0 37.0 37.0 65-69 35.986599999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8686 37.0 37.0 37.0 37.0 37.0 75-79 35.839600000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.93820000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8493 37.0 37.0 37.0 37.0 37.0 90-94 35.78659999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7902 37.0 37.0 37.0 37.0 37.0 100-104 35.787600000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.814099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.6986 37.0 37.0 37.0 37.0 37.0 115-119 35.794799999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.6442 37.0 37.0 37.0 37.0 37.0 125-129 35.613200000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.536 37.0 37.0 37.0 37.0 37.0 135-139 35.522000000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.430600000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.433800000000005 37.0 37.0 37.0 37.0 37.0 150-151 34.7965 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 2.0 16 0.0 17 0.0 18 0.0 19 2.0 20 3.0 21 4.0 22 1.0 23 7.0 24 4.0 25 2.0 26 5.0 27 16.0 28 16.0 29 28.0 30 34.0 31 35.0 32 73.0 33 96.0 34 216.0 35 542.0 36 2644.0 37 264.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.925 23.05 11.625 27.400000000000002 2 28.475 28.499999999999996 27.725 15.299999999999999 3 22.7 28.1 30.4 18.8 4 25.374999999999996 34.65 22.400000000000002 17.575 5 25.8 35.699999999999996 21.75 16.75 6 20.825 39.7 20.825 18.65 7 20.8 22.45 38.375 18.375 8 20.974999999999998 26.900000000000002 27.35 24.775 9 22.400000000000002 25.374999999999996 28.475 23.75 10-14 23.305 29.7 25.869999999999997 21.125 15-19 23.11 28.71 26.8 21.38 20-24 22.15 28.605000000000004 27.82 21.425 25-29 22.830000000000002 28.305000000000003 27.74 21.125 30-34 22.765 28.395 27.779999999999998 21.060000000000002 35-39 22.61 28.335 27.860000000000003 21.195 40-44 22.98 28.025 28.455000000000002 20.54 45-49 23.49 27.625 28.189999999999998 20.695 50-54 23.064999999999998 27.79 28.105000000000004 21.04 55-59 23.400000000000002 27.38 27.74 21.48 60-64 23.75 27.765 27.925 20.560000000000002 65-69 23.605 27.77 27.805000000000003 20.82 70-74 23.685000000000002 27.98 27.025 21.310000000000002 75-79 23.419999999999998 28.46 27.12 21.0 80-84 23.380000000000003 27.965 27.435 21.22 85-89 24.215 27.785 27.325 20.674999999999997 90-94 24.255 28.244999999999997 27.355 20.145 95-99 23.235 28.02 27.439999999999998 21.305 100-104 23.805 27.66 27.05 21.485000000000003 105-109 24.275 27.415 26.83 21.48 110-114 23.57 28.235 27.07 21.125 115-119 24.555 27.93 26.985 20.53 120-124 24.585 27.915 27.189999999999998 20.31 125-129 24.915000000000003 28.24 27.045 19.8 130-134 24.610000000000003 27.43 27.589999999999996 20.369999999999997 135-139 25.085 27.810000000000002 27.400000000000002 19.705000000000002 140-144 24.545 28.49 27.67 19.295 145-149 25.855 27.51 26.985 19.650000000000002 150-151 26.437500000000004 27.8125 26.5375 19.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.5 7 0.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 2.0 20 2.5 21 1.0 22 0.5 23 1.5 24 4.0 25 6.5 26 4.5 27 5.0 28 8.5 29 10.5 30 17.0 31 20.5 32 22.5 33 30.0 34 45.5 35 57.0 36 74.5 37 114.5 38 136.5 39 153.5 40 191.0 41 234.5 42 253.5 43 243.5 44 252.5 45 277.5 46 258.5 47 233.0 48 240.5 49 223.0 50 184.5 51 147.0 52 112.5 53 90.5 54 80.0 55 66.0 56 52.0 57 34.5 58 20.0 59 19.5 60 15.5 61 11.5 62 10.0 63 6.5 64 3.0 65 1.0 66 1.0 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 1.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.73684210526315 89.55 2 4.813541391166358 9.1 3 0.3967204443268976 1.125 4 0.026448029621793177 0.1 5 0.026448029621793177 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAACATCTAATTCTACAATAACCTAGCTTTTACGGTGCAAACCTTGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.9 0.0 0.0 0.0 0.0 136-137 5.3125 0.0 0.0 0.0 0.0 138-139 5.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662357 spots for SRR12161398.sra Written 662357 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra Read 662356 spots for SRR12161398.sra Written 662356 spots for SRR12161398.sra SRR ids: ['SRR12161398.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_codzcn3w SRR12161398.sra spots: 13247121 blocks: [[1, 662356], [662357, 1324712], [1324713, 1987068], [1987069, 2649424], [2649425, 3311780], [3311781, 3974136], [3974137, 4636492], [4636493, 5298848], [5298849, 5961204], [5961205, 6623560], [6623561, 7285916], [7285917, 7948272], [7948273, 8610628], [8610629, 9272984], [9272985, 9935340], [9935341, 10597696], [10597697, 11260052], [11260053, 11922408], [11922409, 12584764], [12584765, 13247121]] SRR12161398 file size 4480250 SRR12161398 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161398 SRR12161398_1.fastq SRR12161398_2.fastq Input file: SRR12161398_1.fastq Paired file: SRR12161398_2.fastq trimmed: SRR12161398-trimmed-pair1.fastq, SRR12161398-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:14:00 2025 >> started Thu Feb 13 21:14:15 2025 >> done (14.991s) 13247121 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 3106 ( 0.02%) empty read pairs filtered out after trimming by size control 13243999 (99.98%) read pairs available; of these: 1136405 ( 8.58%) trimmed read pairs available after processing 12107594 (91.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 5 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 1 0.00% 27 7 0.00% 28 3 0.00% 29 5 0.00% 30 7 0.00% 31 4 0.00% 32 6 0.00% 33 11 0.00% 34 6 0.00% 35 9 0.00% 36 9 0.00% 37 10 0.00% 38 12 0.00% 39 9 0.00% 40 21 0.00% 41 16 0.00% 42 6 0.00% 43 17 0.00% 44 7 0.00% 45 18 0.00% 46 30 0.00% 47 18 0.00% 48 22 0.00% 49 27 0.00% 50 34 0.00% 51 39 0.00% 52 35 0.00% 53 42 0.00% 54 41 0.00% 55 52 0.00% 56 66 0.00% 57 64 0.00% 58 73 0.00% 59 106 0.00% 60 103 0.00% 61 122 0.00% 62 141 0.00% 63 138 0.00% 64 155 0.00% 65 162 0.00% 66 175 0.00% 67 234 0.00% 68 268 0.00% 69 312 0.00% 70 333 0.00% 71 409 0.00% 72 484 0.00% 73 514 0.00% 74 574 0.00% 75 610 0.00% 76 740 0.01% 77 794 0.01% 78 947 0.01% 79 979 0.01% 80 1168 0.01% 81 1296 0.01% 82 1469 0.01% 83 1698 0.01% 84 1821 0.01% 85 1987 0.02% 86 2235 0.02% 87 2319 0.02% 88 2707 0.02% 89 2817 0.02% 90 3103 0.02% 91 3521 0.03% 92 4008 0.03% 93 4371 0.03% 94 4561 0.03% 95 5167 0.04% 96 5503 0.04% 97 5786 0.04% 98 6091 0.05% 99 6635 0.05% 100 7151 0.05% 101 7274 0.05% 102 8057 0.06% 103 8661 0.07% 104 9105 0.07% 105 9659 0.07% 106 10207 0.08% 107 10621 0.08% 108 11015 0.08% 109 11480 0.09% 110 11704 0.09% 111 12340 0.09% 112 12926 0.10% 113 13572 0.10% 114 14566 0.11% 115 15169 0.11% 116 15485 0.12% 117 16020 0.12% 118 16517 0.12% 119 17133 0.13% 120 17387 0.13% 121 18077 0.14% 122 18663 0.14% 123 19332 0.15% 124 20187 0.15% 125 20818 0.16% 126 21168 0.16% 127 22377 0.17% 128 22441 0.17% 129 22826 0.17% 130 23534 0.18% 131 24026 0.18% 132 24557 0.19% 133 25355 0.19% 134 26118 0.20% 135 26349 0.20% 136 27230 0.21% 137 27510 0.21% 138 28219 0.21% 139 28703 0.22% 140 29228 0.22% 141 29732 0.22% 142 30404 0.23% 143 30801 0.23% 144 31996 0.24% 145 32830 0.25% 146 33034 0.25% 147 33665 0.25% 148 34364 0.26% 149 34313 0.26% 150 35186 0.27% 151 12107594 91.42% 13243999 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=19 prefix-density=0.67 prefix-fanout=3.5 sequence=GCATTCTCAGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=65.19 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.9 sequence=AGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGTCGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATTCTAGCACTAGCTTATTATCATACTTCATAATCTGCTTC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=34 prefix-density=0.63 prefix-fanout=2.2 sequence=GATCCTTTCTCTCTTGAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=287.22 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=15.3 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12161398 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:14:58 Started mapping on | Feb 13 21:14:58 Finished on | Feb 13 21:16:28 Mapping speed, Million of reads per hour | 529.76 Number of input reads | 13243999 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12151824 Uniquely mapped reads % | 91.75% Average mapped length | 296.85 Number of splices: Total | 11178906 Number of splices: Annotated (sjdb) | 10866411 Number of splices: GT/AG | 10971007 Number of splices: GC/AG | 156615 Number of splices: AT/AC | 15127 Number of splices: Non-canonical | 36157 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.03% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421691 % of reads mapped to multiple loci | 3.18% Number of reads mapped to too many loci | 74043 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.31% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 670484 670484 670484 N_multimapping 421691 421691 421691 N_noFeature 400559 12014830 459581 N_ambiguous 154715 660 76332 UnstrandedReadsAssigned:11596550 PositiveStrandReadsAssigned:136334 NegativeStrandReadsAssigned:11615911 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161398 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161398-trimmed-pair1.fastq SRR12161398-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,243,999 reads, 11,784,249 reads pseudoaligned [quant] estimated average fragment length: 261.374 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR12161398.ke.tsv 34699 SRR12161398.se.tsv 87100 total ==> SRR12161398.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.63 465 19.7868 Potri.005G024800.1.v4.1 1035 774.626 101 9.75168 Potri.004G059700.1.v4.1 961 700.736 19 2.02791 Potri.007G009000.2.v4.1 1416 1155.63 1 0.0647191 Potri.003G141000.2.v4.1 2943 2682.63 206.216 5.74926 Potri.016G087400.1.v4.1 270 79.7173 1163 1091.13 Potri.015G069301.1.v4.1 564 316.133 0 0 Potri.010G195200.1.v4.1 1773 1512.63 1 0.0494445 Potri.012G127500.1.v4.1 977 716.673 4557 475.562 ==> SRR12161398.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12161398 completed mapping pipeline successfully