Starting /dee2/code/volunteer_pipeline.sh SRR12161399 current disk space = 3088963026944 free memory = 1380681836 SRR12161399 SRAfilesize bd0d74290c5f88d58fd454019ae1273e SRR12161399.sra SRR12161399.sra file validated SRR12161399 is paired end SRR12161399 is conventional basespace SRR12161399 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161399_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.61475 37.0 37.0 37.0 37.0 37.0 2 36.4675 37.0 37.0 37.0 37.0 37.0 3 36.559 37.0 37.0 37.0 37.0 37.0 4 36.4485 37.0 37.0 37.0 37.0 37.0 5 36.5755 37.0 37.0 37.0 37.0 37.0 6 36.523 37.0 37.0 37.0 37.0 37.0 7 36.5265 37.0 37.0 37.0 37.0 37.0 8 36.5855 37.0 37.0 37.0 37.0 37.0 9 36.47 37.0 37.0 37.0 37.0 37.0 10-14 36.520799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.48950000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.49589999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4542 37.0 37.0 37.0 37.0 37.0 30-34 36.3885 37.0 37.0 37.0 37.0 37.0 35-39 36.3538 37.0 37.0 37.0 37.0 37.0 40-44 36.345099999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3253 37.0 37.0 37.0 37.0 37.0 50-54 36.2727 37.0 37.0 37.0 37.0 37.0 55-59 36.297399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.2892 37.0 37.0 37.0 37.0 37.0 65-69 36.2725 37.0 37.0 37.0 37.0 37.0 70-74 36.29 37.0 37.0 37.0 37.0 37.0 75-79 36.2534 37.0 37.0 37.0 37.0 37.0 80-84 36.2812 37.0 37.0 37.0 37.0 37.0 85-89 36.2175 37.0 37.0 37.0 37.0 37.0 90-94 36.2186 37.0 37.0 37.0 37.0 37.0 95-99 36.177 37.0 37.0 37.0 37.0 37.0 100-104 36.195299999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.081900000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.074400000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1194 37.0 37.0 37.0 37.0 37.0 120-124 36.109899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.995799999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.966300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9154 37.0 37.0 37.0 37.0 37.0 140-144 35.9047 37.0 37.0 37.0 37.0 37.0 145-149 35.854200000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.72475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 2.0 25 3.0 26 7.0 27 4.0 28 10.0 29 20.0 30 33.0 31 38.0 32 50.0 33 88.0 34 117.0 35 299.0 36 2909.0 37 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.63740935233808 12.503125781445362 6.051512878219555 31.807951987997 2 21.375 11.725 33.75 33.15 3 15.875 19.375 30.075000000000003 34.675 4 20.724999999999998 26.575 25.75 26.950000000000003 5 22.6 32.15 24.325 20.925 6 19.725 35.05 23.674999999999997 21.55 7 15.575 27.775 39.475 17.175 8 18.175 24.6 33.074999999999996 24.15 9 17.95 24.025 33.725 24.3 10-14 19.625 29.580000000000002 27.400000000000002 23.395 15-19 19.515 28.655 27.700000000000003 24.13 20-24 20.06 28.54 27.58 23.82 25-29 20.27 28.660000000000004 27.325 23.745 30-34 19.525000000000002 29.035 27.185 24.255 35-39 20.455000000000002 28.28 27.21 24.055 40-44 20.285 28.389999999999997 27.950000000000003 23.375 45-49 20.59 28.970000000000002 26.645000000000003 23.794999999999998 50-54 20.560000000000002 28.26 27.68 23.5 55-59 19.925 28.139999999999997 27.495000000000005 24.44 60-64 20.09 28.33 27.24 24.34 65-69 20.385 27.715 27.82 24.08 70-74 20.305 27.93 27.455000000000002 24.310000000000002 75-79 20.965 28.13 27.500000000000004 23.405 80-84 20.405 28.29 27.24 24.065 85-89 20.755000000000003 28.175 27.18 23.89 90-94 20.395 28.59 26.979999999999997 24.035 95-99 20.11 27.750000000000004 27.900000000000002 24.240000000000002 100-104 20.455000000000002 28.000000000000004 26.905 24.64 105-109 20.724999999999998 28.365000000000002 27.115000000000002 23.794999999999998 110-114 20.580000000000002 27.965 27.860000000000003 23.595 115-119 19.935 28.275 27.68 24.11 120-124 20.94 28.025 26.96 24.075 125-129 20.865000000000002 27.685 27.82 23.630000000000003 130-134 21.16 28.04 27.134999999999998 23.665 135-139 20.535 28.035 27.205000000000002 24.224999999999998 140-144 20.72 27.215 27.860000000000003 24.205 145-149 20.755000000000003 28.29 27.025 23.93 150-151 21.5625 28.1125 26.0375 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.0 23 2.5 24 2.0 25 1.5 26 5.5 27 11.0 28 13.0 29 15.5 30 19.0 31 25.5 32 33.0 33 35.5 34 47.0 35 71.5 36 91.0 37 104.0 38 126.0 39 145.5 40 169.5 41 192.5 42 219.0 43 245.0 44 252.0 45 248.0 46 249.0 47 243.5 48 243.0 49 230.0 50 185.5 51 146.0 52 123.5 53 115.0 54 92.5 55 69.0 56 52.5 57 36.5 58 30.5 59 30.0 60 24.5 61 15.5 62 7.0 63 3.5 64 4.0 65 4.5 66 2.5 67 2.5 68 2.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.71039407564137 89.525 2 4.945781539275324 9.35 3 0.21158423697434542 0.6 4 0.10579211848717271 0.4 5 0.026448029621793177 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1625 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4500000000000002 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.4124999999999996 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.0875000000000004 0.0 0.0 0.0 0.0 134-135 3.3375 0.0 0.0 0.0 0.0 136-137 3.5999999999999996 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 40 0.0076550315 18.125 100-104 >>END_MODULE SRR12161399 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161399_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2105 37.0 37.0 37.0 37.0 37.0 2 35.762 37.0 37.0 37.0 37.0 37.0 3 35.861 37.0 37.0 37.0 37.0 37.0 4 35.9155 37.0 37.0 37.0 37.0 37.0 5 36.093 37.0 37.0 37.0 37.0 37.0 6 35.9385 37.0 37.0 37.0 37.0 37.0 7 36.0305 37.0 37.0 37.0 37.0 37.0 8 36.0465 37.0 37.0 37.0 37.0 37.0 9 36.0655 37.0 37.0 37.0 37.0 37.0 10-14 35.9406 37.0 37.0 37.0 37.0 37.0 15-19 35.93300000000001 37.0 37.0 37.0 37.0 37.0 20-24 35.9492 37.0 37.0 37.0 37.0 37.0 25-29 35.87670000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.818599999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.8323 37.0 37.0 37.0 37.0 37.0 40-44 35.7549 37.0 37.0 37.0 37.0 37.0 45-49 35.7285 37.0 37.0 37.0 37.0 37.0 50-54 35.751 37.0 37.0 37.0 37.0 37.0 55-59 35.675200000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.6419 37.0 37.0 37.0 37.0 37.0 65-69 35.68150000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.5559 37.0 37.0 37.0 37.0 37.0 75-79 35.5144 37.0 37.0 37.0 37.0 37.0 80-84 35.6374 37.0 37.0 37.0 37.0 37.0 85-89 35.5749 37.0 37.0 37.0 37.0 37.0 90-94 35.5051 37.0 37.0 37.0 37.0 37.0 95-99 35.4743 37.0 37.0 37.0 37.0 37.0 100-104 35.5827 37.0 37.0 37.0 37.0 37.0 105-109 35.4647 37.0 37.0 37.0 37.0 37.0 110-114 35.416399999999996 37.0 37.0 37.0 34.6 37.0 115-119 35.392700000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.372499999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.256600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.213800000000006 37.0 37.0 37.0 29.8 37.0 135-139 35.2983 37.0 37.0 37.0 37.0 37.0 140-144 35.232299999999995 37.0 37.0 37.0 32.2 37.0 145-149 35.206399999999995 37.0 37.0 37.0 32.2 37.0 150-151 34.694500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 9.0 14 14.0 15 4.0 16 5.0 17 4.0 18 2.0 19 0.0 20 4.0 21 5.0 22 8.0 23 11.0 24 9.0 25 10.0 26 6.0 27 12.0 28 23.0 29 29.0 30 33.0 31 49.0 32 74.0 33 105.0 34 178.0 35 589.0 36 2583.0 37 231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.099999999999994 24.825 7.449999999999999 20.625 2 30.0 24.775 27.500000000000004 17.724999999999998 3 20.825 28.599999999999998 33.2 17.375 4 25.374999999999996 34.599999999999994 21.349999999999998 18.675 5 25.525 36.975 20.075000000000003 17.424999999999997 6 21.85 38.775 21.0 18.375 7 21.85 24.2 35.625 18.325 8 22.225 26.424999999999997 27.200000000000003 24.15 9 22.825 24.15 28.799999999999997 24.224999999999998 10-14 24.63 28.46 26.179999999999996 20.73 15-19 24.34 28.605000000000004 26.935 20.119999999999997 20-24 24.25 29.005 26.369999999999997 20.375 25-29 23.965 28.435 27.01 20.59 30-34 23.74 28.77 26.745 20.745 35-39 23.380000000000003 28.044999999999998 27.29 21.285 40-44 23.905 28.03 26.63 21.435000000000002 45-49 23.735 28.125 27.145000000000003 20.995 50-54 23.724999999999998 28.199999999999996 27.22 20.855 55-59 24.125 27.685 27.555000000000003 20.635 60-64 23.98 27.77 27.505000000000003 20.745 65-69 23.919999999999998 28.435 26.765 20.880000000000003 70-74 24.18 27.839999999999996 27.13 20.849999999999998 75-79 23.49 27.650000000000002 27.52 21.34 80-84 23.575 28.305000000000003 26.905 21.215 85-89 23.630000000000003 28.499999999999996 27.13 20.74 90-94 23.919999999999998 27.435 27.18 21.465 95-99 23.815 28.235 27.05 20.9 100-104 24.205 28.215 27.08 20.5 105-109 24.4 28.249999999999996 26.540000000000003 20.810000000000002 110-114 24.615000000000002 28.144999999999996 26.919999999999998 20.32 115-119 24.43 28.249999999999996 26.715 20.605 120-124 23.82 28.21 27.11 20.86 125-129 24.93 28.449999999999996 26.740000000000002 19.88 130-134 24.97 27.82 27.08 20.13 135-139 25.1 27.52 26.525 20.855 140-144 25.19 27.42 26.884999999999998 20.505000000000003 145-149 25.45 27.875 26.415 20.26 150-151 25.1875 27.8625 26.2625 20.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 2.0 15 1.5 16 2.0 17 2.0 18 2.5 19 2.5 20 1.0 21 2.0 22 5.5 23 5.0 24 2.5 25 4.5 26 6.0 27 6.0 28 9.5 29 8.5 30 10.0 31 15.0 32 21.0 33 31.5 34 39.0 35 57.5 36 79.0 37 96.0 38 121.0 39 148.5 40 179.5 41 206.0 42 233.5 43 248.5 44 242.5 45 262.0 46 275.5 47 264.5 48 251.5 49 225.5 50 184.0 51 134.5 52 109.5 53 101.5 54 89.0 55 67.5 56 50.5 57 42.5 58 32.5 59 26.0 60 19.0 61 13.0 62 8.0 63 4.5 64 3.5 65 2.0 66 0.0 67 1.0 68 1.0 69 0.5 70 2.0 71 2.5 72 1.0 73 0.0 74 1.0 75 1.5 76 0.5 77 1.0 78 1.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 1.5 91 1.5 92 0.0 93 0.0 94 1.0 95 1.0 96 0.5 97 0.5 98 0.0 99 1.5 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 94.77869069705804 89.4 2 4.9032600053008215 9.25 3 0.21203286509408956 0.6 4 0.05300821627352239 0.2 5 0.0 0.0 6 0.026504108136761195 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026504108136761195 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4249999999999998 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.4124999999999996 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.3625 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAGGT 10 0.006830828 145.0 7 >>END_MODULE Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769120 spots for SRR12161399.sra Written 769120 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra Read 769105 spots for SRR12161399.sra Written 769105 spots for SRR12161399.sra SRR ids: ['SRR12161399.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jg9jou7f SRR12161399.sra spots: 15382115 blocks: [[1, 769105], [769106, 1538210], [1538211, 2307315], [2307316, 3076420], [3076421, 3845525], [3845526, 4614630], [4614631, 5383735], [5383736, 6152840], [6152841, 6921945], [6921946, 7691050], [7691051, 8460155], [8460156, 9229260], [9229261, 9998365], [9998366, 10767470], [10767471, 11536575], [11536576, 12305680], [12305681, 13074785], [13074786, 13843890], [13843891, 14612995], [14612996, 15382115]] SRR12161399 file size 5205815 SRR12161399 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161399 SRR12161399_1.fastq SRR12161399_2.fastq Input file: SRR12161399_1.fastq Paired file: SRR12161399_2.fastq trimmed: SRR12161399-trimmed-pair1.fastq, SRR12161399-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:10:11 2025 >> started Thu Feb 13 16:10:30 2025 >> done (18.623s) 15382115 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 3100 ( 0.02%) empty read pairs filtered out after trimming by size control 15378986 (99.98%) read pairs available; of these: 1103116 ( 7.17%) trimmed read pairs available after processing 14275870 (92.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 8 0.00% 21 5 0.00% 22 10 0.00% 23 12 0.00% 24 14 0.00% 25 8 0.00% 26 15 0.00% 27 12 0.00% 28 10 0.00% 29 9 0.00% 30 7 0.00% 31 15 0.00% 32 11 0.00% 33 11 0.00% 34 13 0.00% 35 12 0.00% 36 14 0.00% 37 17 0.00% 38 14 0.00% 39 12 0.00% 40 12 0.00% 41 15 0.00% 42 22 0.00% 43 15 0.00% 44 16 0.00% 45 95 0.00% 46 17 0.00% 47 28 0.00% 48 24 0.00% 49 27 0.00% 50 38 0.00% 51 40 0.00% 52 41 0.00% 53 34 0.00% 54 37 0.00% 55 36 0.00% 56 46 0.00% 57 49 0.00% 58 72 0.00% 59 75 0.00% 60 86 0.00% 61 80 0.00% 62 91 0.00% 63 126 0.00% 64 143 0.00% 65 144 0.00% 66 167 0.00% 67 161 0.00% 68 185 0.00% 69 221 0.00% 70 235 0.00% 71 299 0.00% 72 315 0.00% 73 392 0.00% 74 371 0.00% 75 418 0.00% 76 483 0.00% 77 588 0.00% 78 613 0.00% 79 765 0.00% 80 827 0.01% 81 1004 0.01% 82 1096 0.01% 83 1210 0.01% 84 1359 0.01% 85 1538 0.01% 86 1633 0.01% 87 1786 0.01% 88 1883 0.01% 89 2172 0.01% 90 2363 0.02% 91 2698 0.02% 92 2964 0.02% 93 3415 0.02% 94 3775 0.02% 95 4034 0.03% 96 4403 0.03% 97 4503 0.03% 98 4798 0.03% 99 5172 0.03% 100 5923 0.04% 101 6092 0.04% 102 6887 0.04% 103 7123 0.05% 104 7907 0.05% 105 8255 0.05% 106 8776 0.06% 107 8907 0.06% 108 9132 0.06% 109 9714 0.06% 110 10272 0.07% 111 10882 0.07% 112 11716 0.08% 113 12457 0.08% 114 13099 0.09% 115 13728 0.09% 116 14189 0.09% 117 14760 0.10% 118 14996 0.10% 119 15322 0.10% 120 16293 0.11% 121 16819 0.11% 122 17776 0.12% 123 18497 0.12% 124 19538 0.13% 125 20056 0.13% 126 21105 0.14% 127 21262 0.14% 128 21748 0.14% 129 22199 0.14% 130 22505 0.15% 131 23428 0.15% 132 24464 0.16% 133 25339 0.16% 134 26352 0.17% 135 27377 0.18% 136 28098 0.18% 137 28710 0.19% 138 28610 0.19% 139 29313 0.19% 140 29521 0.19% 141 30610 0.20% 142 31188 0.20% 143 32283 0.21% 144 33530 0.22% 145 34600 0.22% 146 35296 0.23% 147 35973 0.23% 148 36524 0.24% 149 36623 0.24% 150 37855 0.25% 151 14275870 92.83% 15378986 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=15 prefix-density=0.68 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=21.35 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.6 sequence=CCAAGGGAGAATAAAATTACACATAGGGATTCACAAGGGGGGAGAATTTTTTGTTTCTGGACAGTGAATGGGACAGGCTATATGATACACTGCTATAAATTAGAAAAGCAGAAGTCTACTGTGCCAAAGCACTTGTGCTGTAAACAAGAAGTGCACCTCCGGCAAGAATGCCAGCTAGGGTAACAGCCCAGATTAGCAAGCCAGTCTTACCCCCAGCATAGACATCGCCAGTTGGGGACCATTCATCAGTGTTGTAGATAGGGCTGTAGCCATCCACATTAGCACCATATTTGTCGACATATTGGTACACACCCTTTCCCTTGGGCTTCCTTCCAGATGCATCTAACCCATCCCTGAGGTTCATGCCACCACCAGTTCCATAAGGCGTATCGGTCTTGATCTTCTTGACACCACTGGCTTCAATCTTGAAAGTCCTCCTTGAAAGTGTTGGGAGGCCTCTTACTGAAGATTTCTCTACTGTGAAAGGAGATGGTTTCAGGC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=27 prefix-density=0.98 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=75.33 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.3 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12161399 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:11:13 Started mapping on | Feb 13 16:11:14 Finished on | Feb 13 16:12:57 Mapping speed, Million of reads per hour | 537.52 Number of input reads | 15378986 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14144001 Uniquely mapped reads % | 91.97% Average mapped length | 297.53 Number of splices: Total | 13965577 Number of splices: Annotated (sjdb) | 13638055 Number of splices: GT/AG | 13674752 Number of splices: GC/AG | 234669 Number of splices: AT/AC | 12376 Number of splices: Non-canonical | 43780 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338374 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 128240 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.63% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 896611 896611 896611 N_multimapping 338374 338374 338374 N_noFeature 526000 13922818 603140 N_ambiguous 233162 1232 88247 UnstrandedReadsAssigned:13384839 PositiveStrandReadsAssigned:219951 NegativeStrandReadsAssigned:13452614 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161399 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161399-trimmed-pair1.fastq SRR12161399-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,378,986 reads, 13,591,773 reads pseudoaligned [quant] estimated average fragment length: 269.171 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52401 SRR12161399.ke.tsv 34699 SRR12161399.se.tsv 87100 total ==> SRR12161399.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.83 433 14.8674 Potri.005G024800.1.v4.1 1035 766.829 372 29.1466 Potri.004G059700.1.v4.1 961 693.05 76 6.58859 Potri.007G009000.2.v4.1 1416 1147.83 0 0 Potri.003G141000.2.v4.1 2943 2674.83 670.106 15.0519 Potri.016G087400.1.v4.1 270 77.0793 806.73 628.831 Potri.015G069301.1.v4.1 564 310.761 0 0 Potri.010G195200.1.v4.1 1773 1504.83 11 0.439187 Potri.012G127500.1.v4.1 977 708.951 71 6.01708 ==> SRR12161399.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 139 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12161399 completed mapping pipeline successfully