Starting /dee2/code/volunteer_pipeline.sh SRR12161400 current disk space = 3088738963456 free memory = 1582525152 SRR12161400 SRAfilesize ad26d4f45d9aeb4a7c44d99e2a0e3590 SRR12161400.sra SRR12161400.sra file validated SRR12161400 is paired end SRR12161400 is conventional basespace SRR12161400 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161400_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.56075 37.0 37.0 37.0 37.0 37.0 2 36.4 37.0 37.0 37.0 37.0 37.0 3 36.4755 37.0 37.0 37.0 37.0 37.0 4 36.56 37.0 37.0 37.0 37.0 37.0 5 36.58 37.0 37.0 37.0 37.0 37.0 6 36.5545 37.0 37.0 37.0 37.0 37.0 7 36.4915 37.0 37.0 37.0 37.0 37.0 8 36.505 37.0 37.0 37.0 37.0 37.0 9 36.541 37.0 37.0 37.0 37.0 37.0 10-14 36.552 37.0 37.0 37.0 37.0 37.0 15-19 36.528499999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4953 37.0 37.0 37.0 37.0 37.0 25-29 36.46339999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.44179999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.382600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.37670000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3919 37.0 37.0 37.0 37.0 37.0 50-54 36.2756 37.0 37.0 37.0 37.0 37.0 55-59 36.335899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3106 37.0 37.0 37.0 37.0 37.0 65-69 36.3172 37.0 37.0 37.0 37.0 37.0 70-74 36.297900000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.2538 37.0 37.0 37.0 37.0 37.0 80-84 36.3271 37.0 37.0 37.0 37.0 37.0 85-89 36.25509999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2112 37.0 37.0 37.0 37.0 37.0 95-99 36.2296 37.0 37.0 37.0 37.0 37.0 100-104 36.1669 37.0 37.0 37.0 37.0 37.0 105-109 36.113 37.0 37.0 37.0 37.0 37.0 110-114 36.1635 37.0 37.0 37.0 37.0 37.0 115-119 36.1336 37.0 37.0 37.0 37.0 37.0 120-124 36.027100000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9852 37.0 37.0 37.0 37.0 37.0 130-134 35.976699999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.9295 37.0 37.0 37.0 37.0 37.0 140-144 35.9093 37.0 37.0 37.0 37.0 37.0 145-149 35.877 37.0 37.0 37.0 37.0 37.0 150-151 35.713 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 2.0 23 0.0 24 1.0 25 4.0 26 7.0 27 8.0 28 9.0 29 17.0 30 34.0 31 41.0 32 56.0 33 73.0 34 118.0 35 265.0 36 2888.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.41110277569392 12.503125781445362 5.55138784696174 37.53438359589897 2 19.625 13.100000000000001 35.15 32.125 3 16.925 17.675 29.25 36.15 4 20.625 26.474999999999998 24.875 28.025 5 23.075000000000003 32.475 24.025 20.424999999999997 6 21.65 34.300000000000004 22.975 21.075 7 16.5 25.724999999999998 40.625 17.150000000000002 8 18.55 23.875 32.65 24.925 9 17.9 23.425 33.85 24.825 10-14 20.265 28.985 26.77 23.98 15-19 20.57 27.534999999999997 27.775 24.12 20-24 20.375 27.560000000000002 28.09 23.974999999999998 25-29 20.485 27.675 27.195000000000004 24.645 30-34 19.88 28.585 27.284999999999997 24.25 35-39 20.015 28.360000000000003 27.265 24.36 40-44 20.96 27.55 27.785 23.705000000000002 45-49 20.535 27.615000000000002 27.71 24.14 50-54 20.605 27.415 27.735 24.245 55-59 20.674999999999997 28.189999999999998 27.339999999999996 23.794999999999998 60-64 20.54 27.939999999999998 27.089999999999996 24.43 65-69 21.055 27.860000000000003 27.27 23.815 70-74 20.549999999999997 28.51 27.33 23.61 75-79 20.745 28.105000000000004 27.250000000000004 23.9 80-84 20.19 27.935 27.235 24.64 85-89 20.48 27.46 27.51 24.55 90-94 20.830000000000002 28.384999999999998 27.029999999999998 23.755000000000003 95-99 20.54 27.474999999999998 28.249999999999996 23.735 100-104 20.93 28.58 26.825 23.665 105-109 20.945 27.185 27.894999999999996 23.974999999999998 110-114 21.09 27.450000000000003 27.66 23.799999999999997 115-119 21.39 27.765 27.075 23.77 120-124 21.07 27.685 27.145000000000003 24.099999999999998 125-129 20.880000000000003 27.775 27.67 23.674999999999997 130-134 21.23 28.1 27.505000000000003 23.165 135-139 21.62 27.875 26.72 23.785 140-144 21.825 27.860000000000003 27.029999999999998 23.285 145-149 21.81 28.04 27.015 23.135 150-151 22.0625 27.474999999999998 26.5 23.962500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 4.5 27 6.0 28 7.5 29 9.5 30 14.0 31 20.5 32 25.5 33 35.5 34 43.5 35 55.5 36 82.0 37 101.0 38 117.0 39 136.5 40 162.0 41 190.0 42 213.0 43 234.0 44 236.0 45 241.0 46 258.5 47 272.5 48 276.5 49 243.0 50 193.5 51 161.0 52 144.5 53 128.5 54 106.5 55 77.5 56 51.5 57 46.0 58 36.0 59 19.5 60 12.5 61 8.0 62 5.5 63 4.5 64 4.5 65 2.5 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 93.82847982901416 87.8 2 5.55703980764093 10.4 3 0.5343307507347047 1.5 4 0.08014961261020571 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.3125 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 4.112500000000001 0.0 0.0 0.0 0.0 136-137 4.637499999999999 0.0 0.0 0.0 0.0 138-139 5.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTTAA 10 0.006830828 145.0 1 >>END_MODULE SRR12161400 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161400_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2395 37.0 37.0 37.0 37.0 37.0 2 35.837 37.0 37.0 37.0 37.0 37.0 3 35.8385 37.0 37.0 37.0 37.0 37.0 4 35.975 37.0 37.0 37.0 37.0 37.0 5 36.235 37.0 37.0 37.0 37.0 37.0 6 36.168 37.0 37.0 37.0 37.0 37.0 7 36.0755 37.0 37.0 37.0 37.0 37.0 8 36.1585 37.0 37.0 37.0 37.0 37.0 9 36.2035 37.0 37.0 37.0 37.0 37.0 10-14 36.1262 37.0 37.0 37.0 37.0 37.0 15-19 36.1794 37.0 37.0 37.0 37.0 37.0 20-24 36.093300000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.0765 37.0 37.0 37.0 37.0 37.0 30-34 36.0492 37.0 37.0 37.0 37.0 37.0 35-39 36.0043 37.0 37.0 37.0 37.0 37.0 40-44 36.0224 37.0 37.0 37.0 37.0 37.0 45-49 35.972899999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.9455 37.0 37.0 37.0 37.0 37.0 55-59 35.9599 37.0 37.0 37.0 37.0 37.0 60-64 35.8678 37.0 37.0 37.0 37.0 37.0 65-69 35.9073 37.0 37.0 37.0 37.0 37.0 70-74 35.8096 37.0 37.0 37.0 37.0 37.0 75-79 35.7518 37.0 37.0 37.0 37.0 37.0 80-84 35.8452 37.0 37.0 37.0 37.0 37.0 85-89 35.74499999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.7559 37.0 37.0 37.0 37.0 37.0 95-99 35.756099999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.720000000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.7558 37.0 37.0 37.0 37.0 37.0 110-114 35.712900000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6297 37.0 37.0 37.0 37.0 37.0 120-124 35.64450000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.444 37.0 37.0 37.0 37.0 37.0 130-134 35.364700000000006 37.0 37.0 37.0 34.6 37.0 135-139 35.4773 37.0 37.0 37.0 37.0 37.0 140-144 35.3085 37.0 37.0 37.0 37.0 37.0 145-149 35.326 37.0 37.0 37.0 34.6 37.0 150-151 34.7085 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 4.0 15 2.0 16 0.0 17 0.0 18 2.0 19 2.0 20 0.0 21 2.0 22 6.0 23 7.0 24 7.0 25 4.0 26 7.0 27 9.0 28 13.0 29 20.0 30 41.0 31 41.0 32 72.0 33 120.0 34 207.0 35 617.0 36 2570.0 37 241.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.075 24.875 8.75 24.3 2 28.349999999999998 25.825 28.825 17.0 3 20.349999999999998 26.674999999999997 31.900000000000002 21.075 4 23.674999999999997 35.9 22.85 17.575 5 25.45 37.175000000000004 21.725 15.65 6 21.125 39.225 21.825 17.825 7 21.55 22.3 36.25 19.900000000000002 8 21.875 26.450000000000003 26.525 25.15 9 22.175 24.7 29.075 24.05 10-14 22.85 29.709999999999997 25.545 21.895 15-19 22.865 27.689999999999998 27.355 22.09 20-24 22.785 28.825 27.47 20.919999999999998 25-29 23.39 28.294999999999998 27.13 21.185000000000002 30-34 22.905 27.865000000000002 27.395000000000003 21.834999999999997 35-39 22.705000000000002 28.449999999999996 27.065 21.78 40-44 22.720000000000002 28.01 27.445000000000004 21.825 45-49 22.775000000000002 27.66 27.389999999999997 22.175 50-54 23.080000000000002 27.855 27.785 21.279999999999998 55-59 23.575 27.284999999999997 27.42 21.72 60-64 22.470000000000002 27.41 28.499999999999996 21.62 65-69 23.435 26.875 27.97 21.72 70-74 22.925 27.93 27.27 21.875 75-79 23.294999999999998 27.48 27.445000000000004 21.78 80-84 23.330000000000002 27.845 27.224999999999998 21.6 85-89 23.265 28.01 26.979999999999997 21.745 90-94 23.48 28.01 26.955000000000002 21.555 95-99 24.205 27.089999999999996 27.560000000000002 21.145 100-104 23.885 27.725 27.18 21.21 105-109 24.345 27.500000000000004 27.139999999999997 21.015 110-114 24.095 27.605 27.205000000000002 21.095 115-119 23.94 28.315 26.584999999999997 21.16 120-124 24.495 26.745 27.38 21.38 125-129 23.96 27.435 27.3 21.305 130-134 24.610000000000003 27.950000000000003 26.165 21.275 135-139 24.605 27.32 26.935 21.14 140-144 25.22 27.400000000000002 26.795 20.585 145-149 24.83 27.939999999999998 26.91 20.32 150-151 25.650000000000002 28.4125 25.15 20.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 3.5 26 3.5 27 5.5 28 7.5 29 7.5 30 12.5 31 17.5 32 18.0 33 29.5 34 52.0 35 63.0 36 75.5 37 104.5 38 126.0 39 135.0 40 173.0 41 211.5 42 230.0 43 241.0 44 262.5 45 285.5 46 273.5 47 261.0 48 241.0 49 210.5 50 182.0 51 154.5 52 127.5 53 108.5 54 97.5 55 77.0 56 48.0 57 33.0 58 32.5 59 28.5 60 17.5 61 6.5 62 5.5 63 5.5 64 2.5 65 1.0 66 1.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.41397849462365 86.875 2 5.779569892473118 10.75 3 0.6989247311827957 1.95 4 0.08064516129032258 0.3 5 0.026881720430107527 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.6375 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.1875 0.0 0.0 0.0 0.0 136-137 4.7 0.0 0.0 0.0 0.0 138-139 5.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATAT 10 0.006830828 145.0 1 TTCCCGG 10 0.006830828 145.0 145 ACATATA 10 0.006830828 145.0 2 CATATAG 10 0.006830828 145.0 3 GAGGCTT 10 0.006830828 145.0 5 >>END_MODULE Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634853 spots for SRR12161400.sra Written 634853 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra Read 634844 spots for SRR12161400.sra Written 634844 spots for SRR12161400.sra SRR ids: ['SRR12161400.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p8xo8at5 SRR12161400.sra spots: 12696889 blocks: [[1, 634844], [634845, 1269688], [1269689, 1904532], [1904533, 2539376], [2539377, 3174220], [3174221, 3809064], [3809065, 4443908], [4443909, 5078752], [5078753, 5713596], [5713597, 6348440], [6348441, 6983284], [6983285, 7618128], [7618129, 8252972], [8252973, 8887816], [8887817, 9522660], [9522661, 10157504], [10157505, 10792348], [10792349, 11427192], [11427193, 12062036], [12062037, 12696889]] SRR12161400 file size 4293257 SRR12161400 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161400 SRR12161400_1.fastq SRR12161400_2.fastq Input file: SRR12161400_1.fastq Paired file: SRR12161400_2.fastq trimmed: SRR12161400-trimmed-pair1.fastq, SRR12161400-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:00:23 2025 >> started Thu Feb 13 17:00:36 2025 >> done (13.268s) 12696889 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 2690 ( 0.02%) empty read pairs filtered out after trimming by size control 12694174 (99.98%) read pairs available; of these: 1013532 ( 7.98%) trimmed read pairs available after processing 11680642 (92.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 8 0.00% 24 4 0.00% 25 6 0.00% 26 13 0.00% 27 8 0.00% 28 6 0.00% 29 5 0.00% 30 12 0.00% 31 3 0.00% 32 8 0.00% 33 7 0.00% 34 18 0.00% 35 15 0.00% 36 9 0.00% 37 7 0.00% 38 9 0.00% 39 6 0.00% 40 12 0.00% 41 7 0.00% 42 13 0.00% 43 12 0.00% 44 12 0.00% 45 14 0.00% 46 11 0.00% 47 16 0.00% 48 17 0.00% 49 22 0.00% 50 20 0.00% 51 22 0.00% 52 19 0.00% 53 20 0.00% 54 26 0.00% 55 34 0.00% 56 47 0.00% 57 41 0.00% 58 28 0.00% 59 47 0.00% 60 58 0.00% 61 75 0.00% 62 77 0.00% 63 87 0.00% 64 81 0.00% 65 86 0.00% 66 104 0.00% 67 138 0.00% 68 150 0.00% 69 153 0.00% 70 173 0.00% 71 173 0.00% 72 229 0.00% 73 259 0.00% 74 302 0.00% 75 309 0.00% 76 376 0.00% 77 378 0.00% 78 486 0.00% 79 521 0.00% 80 618 0.00% 81 693 0.01% 82 856 0.01% 83 884 0.01% 84 932 0.01% 85 1148 0.01% 86 1206 0.01% 87 1366 0.01% 88 1464 0.01% 89 1648 0.01% 90 1860 0.01% 91 2051 0.02% 92 2373 0.02% 93 2565 0.02% 94 2817 0.02% 95 3114 0.02% 96 3307 0.03% 97 3580 0.03% 98 3871 0.03% 99 4194 0.03% 100 4616 0.04% 101 4851 0.04% 102 5477 0.04% 103 5827 0.05% 104 6259 0.05% 105 6717 0.05% 106 6993 0.06% 107 7334 0.06% 108 7642 0.06% 109 8269 0.07% 110 8721 0.07% 111 9367 0.07% 112 9787 0.08% 113 10308 0.08% 114 10907 0.09% 115 11727 0.09% 116 12199 0.10% 117 13048 0.10% 118 13258 0.10% 119 13563 0.11% 120 14509 0.11% 121 14865 0.12% 122 15898 0.13% 123 16667 0.13% 124 17802 0.14% 125 18167 0.14% 126 19086 0.15% 127 19653 0.15% 128 20157 0.16% 129 20463 0.16% 130 21320 0.17% 131 21764 0.17% 132 23191 0.18% 133 23814 0.19% 134 24773 0.20% 135 25633 0.20% 136 26199 0.21% 137 26470 0.21% 138 26918 0.21% 139 28213 0.22% 140 28408 0.22% 141 29686 0.23% 142 30947 0.24% 143 31546 0.25% 144 32618 0.26% 145 33991 0.27% 146 34289 0.27% 147 34963 0.28% 148 35952 0.28% 149 36159 0.28% 150 37179 0.29% 151 11680642 92.02% 12694174 reads passed initial QC criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=11 prefix-density=1.11 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.26 sequence-density-rank=18 fanout-score=8.47 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=4.5 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGG criterion=sequence-density sequence-density=1.56 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=20 prefix-density=1.57 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=49.73 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.7 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGC SRR12161400 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:01:26 Started mapping on | Feb 13 17:01:27 Finished on | Feb 13 17:03:02 Mapping speed, Million of reads per hour | 481.04 Number of input reads | 12694174 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11819254 Uniquely mapped reads % | 93.11% Average mapped length | 297.53 Number of splices: Total | 11854227 Number of splices: Annotated (sjdb) | 11609291 Number of splices: GT/AG | 11616052 Number of splices: GC/AG | 195704 Number of splices: AT/AC | 10279 Number of splices: Non-canonical | 32192 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324679 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 83084 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 550241 550241 550241 N_multimapping 324679 324679 324679 N_noFeature 365177 11681462 411417 N_ambiguous 175053 637 83069 UnstrandedReadsAssigned:11279024 PositiveStrandReadsAssigned:137155 NegativeStrandReadsAssigned:11324768 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161400 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161400-trimmed-pair1.fastq SRR12161400-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,694,174 reads, 11,446,459 reads pseudoaligned [quant] estimated average fragment length: 255.029 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR12161400.ke.tsv 34699 SRR12161400.se.tsv 87100 total ==> SRR12161400.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.97 295 12.4434 Potri.005G024800.1.v4.1 1035 780.971 140 13.3383 Potri.004G059700.1.v4.1 961 707.126 22 2.31491 Potri.007G009000.2.v4.1 1416 1161.97 0 0 Potri.003G141000.2.v4.1 2943 2688.97 401 11.096 Potri.016G087400.1.v4.1 270 78.0599 621 591.932 Potri.015G069301.1.v4.1 564 322.135 0 0 Potri.010G195200.1.v4.1 1773 1518.97 3 0.146953 Potri.012G127500.1.v4.1 977 723.074 723 74.3984 ==> SRR12161400.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 195 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 131 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 23 SRR12161400 completed mapping pipeline successfully