Starting /dee2/code/volunteer_pipeline.sh SRR12161401 current disk space = 3087767576576 free memory = 1449841676 SRR12161401 SRAfilesize fbde29119297675cdcbd3f2eb8d827df SRR12161401.sra SRR12161401.sra file validated SRR12161401 is paired end SRR12161401 is conventional basespace SRR12161401 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161401_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.537 37.0 37.0 37.0 37.0 37.0 2 36.4785 37.0 37.0 37.0 37.0 37.0 3 36.5015 37.0 37.0 37.0 37.0 37.0 4 36.567 37.0 37.0 37.0 37.0 37.0 5 36.6505 37.0 37.0 37.0 37.0 37.0 6 36.628 37.0 37.0 37.0 37.0 37.0 7 36.5255 37.0 37.0 37.0 37.0 37.0 8 36.5845 37.0 37.0 37.0 37.0 37.0 9 36.5085 37.0 37.0 37.0 37.0 37.0 10-14 36.5689 37.0 37.0 37.0 37.0 37.0 15-19 36.53059999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5104 37.0 37.0 37.0 37.0 37.0 25-29 36.4939 37.0 37.0 37.0 37.0 37.0 30-34 36.470299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4813 37.0 37.0 37.0 37.0 37.0 40-44 36.4304 37.0 37.0 37.0 37.0 37.0 45-49 36.4248 37.0 37.0 37.0 37.0 37.0 50-54 36.3266 37.0 37.0 37.0 37.0 37.0 55-59 36.34739999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.330200000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.31179999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.348099999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.296099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2947 37.0 37.0 37.0 37.0 37.0 85-89 36.2246 37.0 37.0 37.0 37.0 37.0 90-94 36.3125 37.0 37.0 37.0 37.0 37.0 95-99 36.2043 37.0 37.0 37.0 37.0 37.0 100-104 36.1421 37.0 37.0 37.0 37.0 37.0 105-109 36.1458 37.0 37.0 37.0 37.0 37.0 110-114 36.164699999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.146699999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.169 37.0 37.0 37.0 37.0 37.0 125-129 36.0788 37.0 37.0 37.0 37.0 37.0 130-134 36.0112 37.0 37.0 37.0 37.0 37.0 135-139 36.0059 37.0 37.0 37.0 37.0 37.0 140-144 35.94109999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.986200000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.7515 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 5.0 26 2.0 27 5.0 28 11.0 29 13.0 30 24.0 31 25.0 32 59.0 33 75.0 34 127.0 35 310.0 36 2949.0 37 394.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.572786393196594 13.406703351675839 5.177588794397199 35.842921460730366 2 19.45 12.5 34.325 33.725 3 15.25 17.150000000000002 30.25 37.35 4 21.75 24.474999999999998 25.525 28.249999999999996 5 23.875 30.225 23.775 22.125 6 20.4 34.325 23.474999999999998 21.8 7 15.2 26.174999999999997 41.275 17.349999999999998 8 17.25 26.025 32.6 24.125 9 18.099999999999998 23.400000000000002 34.65 23.849999999999998 10-14 19.139999999999997 29.365000000000002 27.625 23.87 15-19 19.695 28.405 27.92 23.98 20-24 19.62 28.605000000000004 27.775 24.0 25-29 19.865 28.53 27.834999999999997 23.77 30-34 19.75 28.535 27.439999999999998 24.275 35-39 19.765 28.24 27.555000000000003 24.44 40-44 19.755 27.955000000000002 28.235 24.055 45-49 19.509999999999998 28.235 27.79 24.465 50-54 19.355 28.645 28.035 23.965 55-59 20.015 28.625 27.235 24.125 60-64 19.805 28.410000000000004 27.500000000000004 24.285 65-69 20.335 28.67 27.405 23.59 70-74 20.125 28.055000000000003 28.22 23.599999999999998 75-79 19.515 28.165000000000003 27.82 24.5 80-84 19.825 28.33 27.74 24.104999999999997 85-89 20.13 28.439999999999998 27.6 23.830000000000002 90-94 20.015 27.73 28.32 23.935000000000002 95-99 19.715 27.985 28.28 24.02 100-104 20.21 27.965 27.51 24.315 105-109 20.385 28.555000000000003 27.71 23.35 110-114 20.415 28.439999999999998 27.21 23.935000000000002 115-119 20.84 27.634999999999998 27.555000000000003 23.97 120-124 20.49 27.794999999999998 27.43 24.285 125-129 20.794999999999998 28.144999999999996 26.91 24.15 130-134 20.875 27.935 27.185 24.005000000000003 135-139 20.580000000000002 27.884999999999998 27.639999999999997 23.895 140-144 21.154999999999998 27.445000000000004 27.515 23.885 145-149 20.71 28.1 27.255000000000003 23.935000000000002 150-151 20.674999999999997 28.5875 26.700000000000003 24.0375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 4.5 26 4.0 27 4.5 28 7.5 29 15.0 30 23.0 31 24.0 32 25.0 33 36.0 34 50.0 35 66.0 36 94.5 37 108.0 38 127.5 39 163.0 40 185.0 41 205.5 42 228.0 43 255.0 44 256.0 45 241.5 46 251.0 47 253.5 48 256.5 49 235.0 50 207.0 51 167.5 52 116.0 53 89.0 54 65.0 55 53.0 56 43.5 57 31.5 58 23.5 59 24.0 60 18.0 61 10.5 62 8.5 63 5.0 64 2.0 65 2.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.14180672268907 90.575 2 4.70063025210084 8.95 3 0.13130252100840337 0.375 4 0.026260504201680673 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.2375 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 2.1125 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.5625 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGGCA 10 0.006830828 145.0 9 >>END_MODULE SRR12161401 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161401_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4305 37.0 37.0 37.0 37.0 37.0 2 36.182 37.0 37.0 37.0 37.0 37.0 3 36.162 37.0 37.0 37.0 37.0 37.0 4 36.1535 37.0 37.0 37.0 37.0 37.0 5 36.221 37.0 37.0 37.0 37.0 37.0 6 36.313 37.0 37.0 37.0 37.0 37.0 7 36.241 37.0 37.0 37.0 37.0 37.0 8 36.2675 37.0 37.0 37.0 37.0 37.0 9 36.3075 37.0 37.0 37.0 37.0 37.0 10-14 36.278499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.272 37.0 37.0 37.0 37.0 37.0 20-24 36.2624 37.0 37.0 37.0 37.0 37.0 25-29 36.2202 37.0 37.0 37.0 37.0 37.0 30-34 36.2187 37.0 37.0 37.0 37.0 37.0 35-39 36.2066 37.0 37.0 37.0 37.0 37.0 40-44 36.188 37.0 37.0 37.0 37.0 37.0 45-49 36.1051 37.0 37.0 37.0 37.0 37.0 50-54 36.1428 37.0 37.0 37.0 37.0 37.0 55-59 36.128400000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.0427 37.0 37.0 37.0 37.0 37.0 65-69 36.0252 37.0 37.0 37.0 37.0 37.0 70-74 36.006299999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9543 37.0 37.0 37.0 37.0 37.0 80-84 36.0121 37.0 37.0 37.0 37.0 37.0 85-89 35.8983 37.0 37.0 37.0 37.0 37.0 90-94 35.9853 37.0 37.0 37.0 37.0 37.0 95-99 35.909299999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.9327 37.0 37.0 37.0 37.0 37.0 105-109 35.8355 37.0 37.0 37.0 37.0 37.0 110-114 35.823800000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.831199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.8486 37.0 37.0 37.0 37.0 37.0 125-129 35.7067 37.0 37.0 37.0 37.0 37.0 130-134 35.6239 37.0 37.0 37.0 37.0 37.0 135-139 35.6643 37.0 37.0 37.0 37.0 37.0 140-144 35.6476 37.0 37.0 37.0 37.0 37.0 145-149 35.6652 37.0 37.0 37.0 37.0 37.0 150-151 35.1105 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 1.0 16 0.0 17 3.0 18 1.0 19 0.0 20 1.0 21 3.0 22 6.0 23 6.0 24 10.0 25 3.0 26 2.0 27 11.0 28 12.0 29 17.0 30 17.0 31 39.0 32 44.0 33 104.0 34 176.0 35 487.0 36 2771.0 37 280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.6 27.075 8.3 21.025 2 29.099999999999998 26.424999999999997 28.975 15.5 3 19.825 27.35 33.35 19.475 4 24.2 34.225 23.625 17.95 5 24.375 38.4 20.849999999999998 16.375 6 22.175 40.45 21.5 15.875 7 22.275 23.575 36.4 17.75 8 22.175 27.275 26.825 23.724999999999998 9 22.325 25.724999999999998 29.5 22.45 10-14 24.09 30.145 25.15 20.615 15-19 23.53 29.065 26.985 20.419999999999998 20-24 23.235 29.275000000000002 27.02 20.47 25-29 23.205000000000002 28.715000000000003 27.13 20.95 30-34 23.27 28.315 27.49 20.925 35-39 22.830000000000002 28.189999999999998 27.925 21.055 40-44 23.26 27.76 27.889999999999997 21.09 45-49 23.23 27.944999999999997 27.884999999999998 20.94 50-54 23.145 28.53 27.715 20.61 55-59 23.44 28.08 27.224999999999998 21.255 60-64 23.09 28.299999999999997 27.82 20.79 65-69 23.685000000000002 28.185 27.725 20.405 70-74 23.9 28.23 27.115000000000002 20.755000000000003 75-79 23.21 28.105000000000004 27.46 21.224999999999998 80-84 23.465 28.54 27.334999999999997 20.66 85-89 23.465 27.805000000000003 27.515 21.215 90-94 23.68 28.194999999999997 27.400000000000002 20.724999999999998 95-99 23.485 28.73 27.115000000000002 20.669999999999998 100-104 24.025 27.67 27.505000000000003 20.8 105-109 23.674999999999997 28.02 27.595 20.71 110-114 23.685000000000002 28.64 27.084999999999997 20.59 115-119 23.990000000000002 27.584999999999997 27.689999999999998 20.735 120-124 24.665 28.665000000000003 26.995 19.675 125-129 24.335 28.194999999999997 27.175 20.294999999999998 130-134 24.779999999999998 27.765 27.49 19.965 135-139 24.38 27.435 27.655 20.53 140-144 24.285 27.93 27.075 20.71 145-149 25.05 28.165000000000003 26.76 20.025000000000002 150-151 24.4875 27.0875 27.6875 20.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 0.5 11 1.0 12 1.5 13 1.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 4.0 26 4.0 27 4.5 28 10.0 29 15.5 30 15.5 31 16.5 32 25.5 33 31.5 34 44.5 35 60.5 36 73.0 37 100.0 38 134.0 39 175.0 40 216.5 41 246.5 42 267.5 43 263.0 44 247.0 45 253.0 46 260.5 47 253.0 48 225.5 49 207.5 50 177.0 51 135.5 52 114.0 53 93.0 54 82.0 55 63.0 56 40.0 57 32.5 58 21.0 59 10.0 60 11.5 61 12.5 62 6.5 63 2.5 64 3.5 65 1.5 66 0.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 1.0 99 1.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.45573942737063 90.85 2 4.307853953244025 8.200000000000001 3 0.18387181507748881 0.525 4 0.026267402153926978 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026267402153926978 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 2.0875000000000004 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.5375 0.0 0.0 0.0 0.0 134-135 2.7125 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521252 spots for SRR12161401.sra Written 521252 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra Read 521238 spots for SRR12161401.sra Written 521238 spots for SRR12161401.sra SRR ids: ['SRR12161401.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5rcs3r0l SRR12161401.sra spots: 10424774 blocks: [[1, 521238], [521239, 1042476], [1042477, 1563714], [1563715, 2084952], [2084953, 2606190], [2606191, 3127428], [3127429, 3648666], [3648667, 4169904], [4169905, 4691142], [4691143, 5212380], [5212381, 5733618], [5733619, 6254856], [6254857, 6776094], [6776095, 7297332], [7297333, 7818570], [7818571, 8339808], [8339809, 8861046], [8861047, 9382284], [9382285, 9903522], [9903523, 10424774]] SRR12161401 file size 3521093 SRR12161401 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161401 SRR12161401_1.fastq SRR12161401_2.fastq Input file: SRR12161401_1.fastq Paired file: SRR12161401_2.fastq trimmed: SRR12161401-trimmed-pair1.fastq, SRR12161401-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:37:51 2025 >> started Thu Feb 13 20:38:02 2025 >> done (11.187s) 10424774 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 1077 ( 0.01%) empty read pairs filtered out after trimming by size control 10423685 (99.99%) read pairs available; of these: 598851 ( 5.75%) trimmed read pairs available after processing 9824834 (94.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 1 0.00% 23 6 0.00% 24 6 0.00% 25 5 0.00% 26 9 0.00% 27 0 0.00% 28 6 0.00% 29 7 0.00% 30 11 0.00% 31 5 0.00% 32 8 0.00% 33 7 0.00% 34 2 0.00% 35 11 0.00% 36 6 0.00% 37 12 0.00% 38 6 0.00% 39 8 0.00% 40 7 0.00% 41 6 0.00% 42 10 0.00% 43 6 0.00% 44 7 0.00% 45 12 0.00% 46 12 0.00% 47 11 0.00% 48 17 0.00% 49 15 0.00% 50 15 0.00% 51 13 0.00% 52 17 0.00% 53 26 0.00% 54 22 0.00% 55 28 0.00% 56 22 0.00% 57 20 0.00% 58 27 0.00% 59 36 0.00% 60 48 0.00% 61 40 0.00% 62 45 0.00% 63 59 0.00% 64 74 0.00% 65 64 0.00% 66 82 0.00% 67 87 0.00% 68 85 0.00% 69 122 0.00% 70 126 0.00% 71 136 0.00% 72 174 0.00% 73 151 0.00% 74 211 0.00% 75 227 0.00% 76 245 0.00% 77 306 0.00% 78 283 0.00% 79 354 0.00% 80 385 0.00% 81 462 0.00% 82 534 0.01% 83 606 0.01% 84 647 0.01% 85 743 0.01% 86 868 0.01% 87 891 0.01% 88 1007 0.01% 89 1175 0.01% 90 1158 0.01% 91 1318 0.01% 92 1466 0.01% 93 1645 0.02% 94 1874 0.02% 95 2058 0.02% 96 2191 0.02% 97 2312 0.02% 98 2414 0.02% 99 2648 0.03% 100 2883 0.03% 101 3043 0.03% 102 3453 0.03% 103 3692 0.04% 104 3985 0.04% 105 4120 0.04% 106 4363 0.04% 107 4629 0.04% 108 4886 0.05% 109 4985 0.05% 110 5327 0.05% 111 5662 0.05% 112 5966 0.06% 113 6436 0.06% 114 6746 0.06% 115 7113 0.07% 116 7254 0.07% 117 7758 0.07% 118 8017 0.08% 119 8223 0.08% 120 8542 0.08% 121 8997 0.09% 122 9457 0.09% 123 9901 0.09% 124 10344 0.10% 125 10717 0.10% 126 10937 0.10% 127 11514 0.11% 128 11621 0.11% 129 12076 0.12% 130 12556 0.12% 131 12800 0.12% 132 13228 0.13% 133 13865 0.13% 134 14439 0.14% 135 14883 0.14% 136 15190 0.15% 137 15684 0.15% 138 16006 0.15% 139 16395 0.16% 140 16884 0.16% 141 16970 0.16% 142 17877 0.17% 143 18210 0.17% 144 18693 0.18% 145 19175 0.18% 146 19707 0.19% 147 20324 0.19% 148 21019 0.20% 149 20810 0.20% 150 21716 0.21% 151 9824834 94.25% 10423685 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=18 prefix-density=0.39 prefix-fanout=3.7 sequence=GCATTCTCAGGCAG criterion=fanout-score sequence-density=0.17 sequence-density-rank=7 fanout-score=46.63 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=10.7 sequence=TCATCTTCAATCT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=38 prefix-density=0.30 prefix-fanout=2.1 sequence=GATCCTTTCTCTCTTGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=569.57 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=21.5 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGG SRR12161401 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:38:48 Started mapping on | Feb 13 20:38:48 Finished on | Feb 13 20:39:58 Mapping speed, Million of reads per hour | 536.08 Number of input reads | 10423685 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 9740673 Uniquely mapped reads % | 93.45% Average mapped length | 298.41 Number of splices: Total | 9446195 Number of splices: Annotated (sjdb) | 9225644 Number of splices: GT/AG | 9264730 Number of splices: GC/AG | 141938 Number of splices: AT/AC | 8085 Number of splices: Non-canonical | 31442 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 246585 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 66120 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.38% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436427 436427 436427 N_multimapping 246585 246585 246585 N_noFeature 357611 9604004 408078 N_ambiguous 148131 904 61318 UnstrandedReadsAssigned:9234931 PositiveStrandReadsAssigned:135765 NegativeStrandReadsAssigned:9271277 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161401 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161401-trimmed-pair1.fastq SRR12161401-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,423,685 reads, 9,294,566 reads pseudoaligned [quant] estimated average fragment length: 277.643 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR12161401.ke.tsv 34699 SRR12161401.se.tsv 87100 total ==> SRR12161401.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.36 773 40.5017 Potri.005G024800.1.v4.1 1035 758.357 359 43.1919 Potri.004G059700.1.v4.1 961 684.577 47 6.26408 Potri.007G009000.2.v4.1 1416 1139.36 0 0 Potri.003G141000.2.v4.1 2943 2666.36 379.409 12.9829 Potri.016G087400.1.v4.1 270 72.6654 501.155 629.254 Potri.015G069301.1.v4.1 564 303.518 0 0 Potri.010G195200.1.v4.1 1773 1496.36 30 1.82923 Potri.012G127500.1.v4.1 977 700.488 136 17.7141 ==> SRR12161401.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 77 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 133 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR12161401 completed mapping pipeline successfully