Starting /dee2/code/volunteer_pipeline.sh SRR12161402 current disk space = 3087777927168 free memory = 1449815552 SRR12161402 SRAfilesize c20cb61b70b2ac371d87865ea25b6592 SRR12161402.sra SRR12161402.sra file validated SRR12161402 is paired end SRR12161402 is conventional basespace SRR12161402 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161402_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59125 37.0 37.0 37.0 37.0 37.0 2 36.5045 37.0 37.0 37.0 37.0 37.0 3 36.463 37.0 37.0 37.0 37.0 37.0 4 36.479 37.0 37.0 37.0 37.0 37.0 5 36.556 37.0 37.0 37.0 37.0 37.0 6 36.5885 37.0 37.0 37.0 37.0 37.0 7 36.4205 37.0 37.0 37.0 37.0 37.0 8 36.527 37.0 37.0 37.0 37.0 37.0 9 36.5535 37.0 37.0 37.0 37.0 37.0 10-14 36.604200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.5382 37.0 37.0 37.0 37.0 37.0 20-24 36.521699999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.44680000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.4582 37.0 37.0 37.0 37.0 37.0 35-39 36.464999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4304 37.0 37.0 37.0 37.0 37.0 45-49 36.46 37.0 37.0 37.0 37.0 37.0 50-54 36.3876 37.0 37.0 37.0 37.0 37.0 55-59 36.420500000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3163 37.0 37.0 37.0 37.0 37.0 65-69 36.31420000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.318 37.0 37.0 37.0 37.0 37.0 75-79 36.2571 37.0 37.0 37.0 37.0 37.0 80-84 36.2713 37.0 37.0 37.0 37.0 37.0 85-89 36.23219999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.263799999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2018 37.0 37.0 37.0 37.0 37.0 100-104 36.185500000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1203 37.0 37.0 37.0 37.0 37.0 110-114 36.105399999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0739 37.0 37.0 37.0 37.0 37.0 120-124 36.072900000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.012 37.0 37.0 37.0 37.0 37.0 130-134 35.965599999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9034 37.0 37.0 37.0 37.0 37.0 140-144 35.8803 37.0 37.0 37.0 37.0 37.0 145-149 35.815 37.0 37.0 37.0 37.0 37.0 150-151 35.65625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 0.0 24 1.0 25 5.0 26 4.0 27 8.0 28 9.0 29 13.0 30 27.0 31 35.0 32 45.0 33 74.0 34 135.0 35 289.0 36 2962.0 37 390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.76194048512128 12.928232058014505 6.326581645411353 32.98324581145287 2 20.875 13.15 33.225 32.75 3 16.725 20.175 31.025000000000002 32.074999999999996 4 20.474999999999998 28.325 25.224999999999998 25.974999999999998 5 21.325 34.225 23.95 20.5 6 20.349999999999998 34.949999999999996 24.6 20.1 7 14.299999999999999 25.474999999999998 44.125 16.1 8 16.05 25.825 32.15 25.974999999999998 9 16.85 23.3 34.65 25.2 10-14 19.32 29.599999999999998 27.155 23.925 15-19 19.52 28.499999999999996 27.88 24.099999999999998 20-24 19.885 28.560000000000002 27.860000000000003 23.695 25-29 18.875 29.07 27.87 24.185000000000002 30-34 18.655 28.57 28.125 24.65 35-39 19.06 28.505000000000003 27.985 24.45 40-44 19.794999999999998 28.189999999999998 27.805000000000003 24.21 45-49 20.165 27.87 27.584999999999997 24.38 50-54 19.515 28.925 27.544999999999998 24.015 55-59 19.765 28.235 27.845 24.154999999999998 60-64 19.595000000000002 28.89 27.634999999999998 23.880000000000003 65-69 19.665 28.285 27.61 24.44 70-74 19.575 28.815 27.810000000000002 23.799999999999997 75-79 19.945 27.765 28.050000000000004 24.240000000000002 80-84 19.475 28.305000000000003 28.000000000000004 24.22 85-89 19.285 28.77 27.68 24.265 90-94 20.19 28.415000000000003 27.185 24.21 95-99 20.275000000000002 28.565 27.339999999999996 23.82 100-104 20.195 28.48 27.639999999999997 23.685000000000002 105-109 20.415 27.82 27.6 24.165 110-114 20.03 27.935 27.800000000000004 24.235 115-119 19.93 28.444999999999997 27.295 24.33 120-124 20.115 28.78 27.6 23.505000000000003 125-129 20.205000000000002 28.22 27.37 24.205 130-134 19.895 28.1 27.48 24.525 135-139 20.29 28.305000000000003 27.42 23.985 140-144 20.325 27.755000000000003 27.505000000000003 24.415 145-149 20.18 28.610000000000003 26.895000000000003 24.315 150-151 20.1375 29.037499999999998 26.650000000000002 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 2.0 2 1.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 1.0 23 1.0 24 2.5 25 4.0 26 4.5 27 14.0 28 19.0 29 19.5 30 24.5 31 24.5 32 26.5 33 42.5 34 58.5 35 78.0 36 86.0 37 98.5 38 117.5 39 147.5 40 189.0 41 216.0 42 222.0 43 232.5 44 259.0 45 258.0 46 262.5 47 261.5 48 232.5 49 212.5 50 190.0 51 150.5 52 119.0 53 106.0 54 93.5 55 60.5 56 38.0 57 34.5 58 28.5 59 19.5 60 9.5 61 5.5 62 4.5 63 3.0 64 3.5 65 3.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 93.78666666666666 87.925 2 5.8133333333333335 10.9 3 0.3466666666666667 0.975 4 0.05333333333333334 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.3499999999999996 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.2249999999999996 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTTTT 10 0.006830828 145.0 2 >>END_MODULE SRR12161402 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161402_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.006 37.0 37.0 37.0 37.0 37.0 2 35.5105 37.0 37.0 37.0 37.0 37.0 3 35.5915 37.0 37.0 37.0 37.0 37.0 4 35.824 37.0 37.0 37.0 37.0 37.0 5 36.0355 37.0 37.0 37.0 37.0 37.0 6 35.8685 37.0 37.0 37.0 37.0 37.0 7 35.95 37.0 37.0 37.0 37.0 37.0 8 35.8625 37.0 37.0 37.0 37.0 37.0 9 36.0155 37.0 37.0 37.0 37.0 37.0 10-14 35.9678 37.0 37.0 37.0 37.0 37.0 15-19 35.822199999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.836400000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.7442 37.0 37.0 37.0 37.0 37.0 30-34 35.710300000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.76550000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.693400000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.6702 37.0 37.0 37.0 37.0 37.0 50-54 35.6844 37.0 37.0 37.0 37.0 37.0 55-59 35.62499999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.6379 37.0 37.0 37.0 37.0 37.0 65-69 35.6139 37.0 37.0 37.0 37.0 37.0 70-74 35.528499999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.5269 37.0 37.0 37.0 37.0 37.0 80-84 35.5818 37.0 37.0 37.0 37.0 37.0 85-89 35.512299999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.467 37.0 37.0 37.0 37.0 37.0 95-99 35.463800000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.4532 37.0 37.0 37.0 37.0 37.0 105-109 35.3488 37.0 37.0 37.0 37.0 37.0 110-114 35.3246 37.0 37.0 37.0 34.6 37.0 115-119 35.3703 37.0 37.0 37.0 37.0 37.0 120-124 35.3227 37.0 37.0 37.0 37.0 37.0 125-129 35.1523 37.0 37.0 37.0 27.4 37.0 130-134 35.0715 37.0 37.0 37.0 25.0 37.0 135-139 35.1766 37.0 37.0 37.0 25.0 37.0 140-144 35.132099999999994 37.0 37.0 37.0 27.4 37.0 145-149 35.0834 37.0 37.0 37.0 25.0 37.0 150-151 34.50725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 12.0 14 6.0 15 3.0 16 1.0 17 3.0 18 4.0 19 2.0 20 4.0 21 3.0 22 4.0 23 9.0 24 13.0 25 9.0 26 15.0 27 12.0 28 18.0 29 30.0 30 55.0 31 57.0 32 70.0 33 125.0 34 237.0 35 633.0 36 2481.0 37 192.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.475 23.7 8.3 18.525 2 28.875 25.6 28.325 17.2 3 22.25 27.35 32.275 18.125 4 24.7 34.475 23.05 17.775 5 24.875 38.1 19.85 17.175 6 21.975 40.35 19.950000000000003 17.724999999999998 7 22.3 22.025 37.375 18.3 8 22.725 26.174999999999997 26.974999999999998 24.125 9 23.599999999999998 25.074999999999996 27.55 23.775 10-14 24.26 29.409999999999997 25.674999999999997 20.655 15-19 23.74 29.07 27.055 20.135 20-24 24.075 29.225 26.229999999999997 20.47 25-29 23.515 28.655 27.105 20.724999999999998 30-34 23.315 28.384999999999998 28.455000000000002 19.845 35-39 23.34 28.225 27.565 20.87 40-44 23.29 28.7 27.565 20.445 45-49 23.82 28.76 27.595 19.825 50-54 23.77 28.655 27.284999999999997 20.29 55-59 23.494999999999997 28.26 27.975 20.27 60-64 23.715 27.685 28.044999999999998 20.555 65-69 23.82 28.18 28.000000000000004 20.0 70-74 23.64 27.76 28.134999999999998 20.465 75-79 23.56 27.785 27.975 20.68 80-84 24.01 28.485 27.38 20.125 85-89 24.099999999999998 28.185 27.38 20.335 90-94 24.07 27.91 27.425 20.595 95-99 23.46 28.854999999999997 27.125 20.560000000000002 100-104 23.87 28.335 27.445000000000004 20.349999999999998 105-109 23.7 27.905 27.825 20.57 110-114 23.985 28.389999999999997 27.48 20.145 115-119 24.26 27.935 27.825 19.98 120-124 24.125 28.535 27.425 19.915 125-129 24.485 27.675 27.67 20.169999999999998 130-134 25.165 27.975 26.740000000000002 20.119999999999997 135-139 24.315 27.810000000000002 27.750000000000004 20.125 140-144 25.035 27.99 27.384999999999998 19.59 145-149 25.595000000000002 28.065 27.115000000000002 19.225 150-151 26.1125 28.15 25.4875 20.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 1.0 12 1.0 13 1.5 14 1.5 15 1.5 16 1.5 17 1.0 18 1.5 19 2.5 20 3.0 21 2.5 22 3.0 23 4.5 24 3.5 25 1.0 26 1.5 27 5.5 28 11.0 29 17.0 30 19.0 31 18.5 32 28.0 33 41.5 34 47.5 35 61.5 36 89.5 37 92.5 38 107.5 39 154.0 40 190.0 41 226.0 42 260.0 43 273.5 44 262.0 45 260.0 46 259.0 47 242.0 48 236.5 49 213.5 50 180.0 51 154.5 52 118.5 53 89.0 54 71.5 55 55.0 56 40.5 57 31.0 58 20.0 59 11.5 60 14.0 61 14.0 62 7.0 63 6.5 64 7.0 65 3.0 66 0.0 67 1.0 68 2.0 69 2.5 70 2.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.30699654163341 88.625 2 5.21415270018622 9.8 3 0.39904229848363926 1.125 4 0.053205639797818574 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026602819898909287 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 3.0125 0.0 0.0 0.0 0.0 132-133 3.3499999999999996 0.0 0.0 0.0 0.0 134-135 3.575 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCGGA 10 0.006830828 145.0 9 >>END_MODULE Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785425 spots for SRR12161402.sra Written 785425 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra Read 785416 spots for SRR12161402.sra Written 785416 spots for SRR12161402.sra SRR ids: ['SRR12161402.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lpydsyi3 SRR12161402.sra spots: 15708329 blocks: [[1, 785416], [785417, 1570832], [1570833, 2356248], [2356249, 3141664], [3141665, 3927080], [3927081, 4712496], [4712497, 5497912], [5497913, 6283328], [6283329, 7068744], [7068745, 7854160], [7854161, 8639576], [8639577, 9424992], [9424993, 10210408], [10210409, 10995824], [10995825, 11781240], [11781241, 12566656], [12566657, 13352072], [13352073, 14137488], [14137489, 14922904], [14922905, 15708329]] SRR12161402 file size 5316677 SRR12161402 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161402 SRR12161402_1.fastq SRR12161402_2.fastq Input file: SRR12161402_1.fastq Paired file: SRR12161402_2.fastq trimmed: SRR12161402-trimmed-pair1.fastq, SRR12161402-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:39:23 2025 >> started Thu Feb 13 20:39:48 2025 >> done (25.172s) 15708329 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 3986 ( 0.03%) empty read pairs filtered out after trimming by size control 15704316 (99.97%) read pairs available; of these: 1241550 ( 7.91%) trimmed read pairs available after processing 14462766 (92.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 4 0.00% 21 2 0.00% 22 4 0.00% 23 8 0.00% 24 13 0.00% 25 13 0.00% 26 9 0.00% 27 10 0.00% 28 15 0.00% 29 7 0.00% 30 14 0.00% 31 14 0.00% 32 12 0.00% 33 7 0.00% 34 13 0.00% 35 13 0.00% 36 12 0.00% 37 12 0.00% 38 20 0.00% 39 14 0.00% 40 17 0.00% 41 25 0.00% 42 22 0.00% 43 20 0.00% 44 20 0.00% 45 18 0.00% 46 40 0.00% 47 22 0.00% 48 26 0.00% 49 36 0.00% 50 48 0.00% 51 41 0.00% 52 39 0.00% 53 63 0.00% 54 48 0.00% 55 46 0.00% 56 62 0.00% 57 57 0.00% 58 86 0.00% 59 95 0.00% 60 86 0.00% 61 109 0.00% 62 130 0.00% 63 146 0.00% 64 118 0.00% 65 153 0.00% 66 168 0.00% 67 189 0.00% 68 247 0.00% 69 280 0.00% 70 272 0.00% 71 352 0.00% 72 384 0.00% 73 467 0.00% 74 464 0.00% 75 527 0.00% 76 578 0.00% 77 682 0.00% 78 719 0.00% 79 803 0.01% 80 938 0.01% 81 1089 0.01% 82 1244 0.01% 83 1381 0.01% 84 1567 0.01% 85 1648 0.01% 86 1872 0.01% 87 1962 0.01% 88 2102 0.01% 89 2294 0.01% 90 2661 0.02% 91 3121 0.02% 92 3398 0.02% 93 3851 0.02% 94 4244 0.03% 95 4472 0.03% 96 4901 0.03% 97 5252 0.03% 98 5374 0.03% 99 5848 0.04% 100 6463 0.04% 101 6907 0.04% 102 7888 0.05% 103 8424 0.05% 104 8978 0.06% 105 9443 0.06% 106 9801 0.06% 107 10156 0.06% 108 10690 0.07% 109 11236 0.07% 110 11786 0.08% 111 12824 0.08% 112 13949 0.09% 113 14482 0.09% 114 15760 0.10% 115 16210 0.10% 116 16736 0.11% 117 17153 0.11% 118 17444 0.11% 119 17708 0.11% 120 18417 0.12% 121 19445 0.12% 122 20430 0.13% 123 22155 0.14% 124 22859 0.15% 125 23468 0.15% 126 23994 0.15% 127 24358 0.16% 128 24387 0.16% 129 25059 0.16% 130 25755 0.16% 131 26345 0.17% 132 27990 0.18% 133 28803 0.18% 134 30214 0.19% 135 30900 0.20% 136 31613 0.20% 137 31122 0.20% 138 31904 0.20% 139 32286 0.21% 140 32445 0.21% 141 33103 0.21% 142 34641 0.22% 143 35749 0.23% 144 37194 0.24% 145 38011 0.24% 146 38917 0.25% 147 39178 0.25% 148 39649 0.25% 149 39141 0.25% 150 40838 0.26% 151 14462766 92.09% 15704316 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=19 prefix-density=0.77 prefix-fanout=3.0 sequence=GCATTCTCAGGCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=97.54 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.0 sequence=GAAAGAGAAGAAGCAAGACATTACATTTTCAAATACAATACAAGGACTGAAAGTTCTTTCAAAACAAAAGCATTATACATGGTACAGACTTCTTATAAAATCTTTCACTGGATTTGGACATCAATGACCTTAGGTTCAACTTTGGTCTTAGGAATGTTAATGAACAGAACTCCATTTTTCAACTCAGCCTTGATCTTATCCTTTCCGCAATTATCCGGTAGCCTAAGCCGGGTATCATAAGAGCTGACGCTGCTACTAGACCATGAATCATCGCCAGTTTCTTCCTTCTTGTGCTCTCCTTTAATAACAAGCACATCATCCTCGACCGAGACCTTGACATCCTCCTTAGACAGTCCTGGCATGTCGAACCTCATCTTGATCTCATGTTCCTCATCTTTGATTTCCCATGGTGCACGCACCTCTCCTCCTGTCCTGTTCCTGCTGCTAGGAATTGTCAGTGCATCATCGAACAGTCGGTCCATTGTGTCCAGCATTTGACGCATTGTCCTCA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=30 prefix-density=0.51 prefix-fanout=2.2 sequence=GATCCTTTCTCTCTTGACGTTTGGGACCCTTTAAAGGATTTCCCTTTTCCTTCTCCTTCCTTCCCTCGCGATGAAAACTCTGCTTTTGTTAACACTCGCATCGACTGGAAGGAAACCCCAGAAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=205.51 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=18.6 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12161402 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:40:34 Started mapping on | Feb 13 20:40:34 Finished on | Feb 13 20:42:30 Mapping speed, Million of reads per hour | 487.38 Number of input reads | 15704316 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14190581 Uniquely mapped reads % | 90.36% Average mapped length | 297.00 Number of splices: Total | 12743599 Number of splices: Annotated (sjdb) | 12340324 Number of splices: GT/AG | 12501367 Number of splices: GC/AG | 183910 Number of splices: AT/AC | 11237 Number of splices: Non-canonical | 47085 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381077 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 55826 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.62% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1132658 1132658 1132658 N_multimapping 381077 381077 381077 N_noFeature 593868 13993283 674516 N_ambiguous 195307 1352 77780 UnstrandedReadsAssigned:13401406 PositiveStrandReadsAssigned:195946 NegativeStrandReadsAssigned:13438285 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161402 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161402-trimmed-pair1.fastq SRR12161402-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,704,316 reads, 13,637,710 reads pseudoaligned [quant] estimated average fragment length: 261.474 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR12161402.ke.tsv 34699 SRR12161402.se.tsv 87100 total ==> SRR12161402.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.53 768 28.9603 Potri.005G024800.1.v4.1 1035 774.526 923 78.9786 Potri.004G059700.1.v4.1 961 700.686 153 14.4714 Potri.007G009000.2.v4.1 1416 1155.53 0 0 Potri.003G141000.2.v4.1 2943 2682.53 603.418 14.908 Potri.016G087400.1.v4.1 270 78.7591 935.833 787.484 Potri.015G069301.1.v4.1 564 316.322 0 0 Potri.010G195200.1.v4.1 1773 1512.53 50 2.19084 Potri.012G127500.1.v4.1 977 716.592 286 26.4508 ==> SRR12161402.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 171 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12161402 completed mapping pipeline successfully