Starting /dee2/code/volunteer_pipeline.sh SRR12161403 current disk space = 3087936638976 free memory = 1463492204 SRR12161403 SRAfilesize 78a9e408a2dcdf96971e94f1cf0f2907 SRR12161403.sra SRR12161403.sra file validated SRR12161403 is paired end SRR12161403 is conventional basespace SRR12161403 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161403_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.536 37.0 37.0 37.0 37.0 37.0 2 36.4435 37.0 37.0 37.0 37.0 37.0 3 36.4995 37.0 37.0 37.0 37.0 37.0 4 36.5465 37.0 37.0 37.0 37.0 37.0 5 36.6005 37.0 37.0 37.0 37.0 37.0 6 36.5055 37.0 37.0 37.0 37.0 37.0 7 36.4165 37.0 37.0 37.0 37.0 37.0 8 36.4815 37.0 37.0 37.0 37.0 37.0 9 36.4785 37.0 37.0 37.0 37.0 37.0 10-14 36.543600000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5313 37.0 37.0 37.0 37.0 37.0 20-24 36.47 37.0 37.0 37.0 37.0 37.0 25-29 36.455200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4341 37.0 37.0 37.0 37.0 37.0 35-39 36.3728 37.0 37.0 37.0 37.0 37.0 40-44 36.3765 37.0 37.0 37.0 37.0 37.0 45-49 36.3572 37.0 37.0 37.0 37.0 37.0 50-54 36.3366 37.0 37.0 37.0 37.0 37.0 55-59 36.3222 37.0 37.0 37.0 37.0 37.0 60-64 36.3237 37.0 37.0 37.0 37.0 37.0 65-69 36.3389 37.0 37.0 37.0 37.0 37.0 70-74 36.2684 37.0 37.0 37.0 37.0 37.0 75-79 36.265699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.271699999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.234899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.249900000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1999 37.0 37.0 37.0 37.0 37.0 100-104 36.1924 37.0 37.0 37.0 37.0 37.0 105-109 36.134299999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.13340000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1456 37.0 37.0 37.0 37.0 37.0 120-124 36.0494 37.0 37.0 37.0 37.0 37.0 125-129 36.0146 37.0 37.0 37.0 37.0 37.0 130-134 36.04090000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.9373 37.0 37.0 37.0 37.0 37.0 140-144 35.94930000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.8931 37.0 37.0 37.0 37.0 37.0 150-151 35.671499999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 0.0 25 3.0 26 3.0 27 5.0 28 9.0 29 24.0 30 28.0 31 37.0 32 49.0 33 78.0 34 125.0 35 312.0 36 2928.0 37 397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.64682341170585 12.031015507753876 5.777888944472236 38.54427213606804 2 19.425 13.4 33.125 34.050000000000004 3 16.7 16.775000000000002 27.875 38.65 4 21.025 24.525 23.9 30.55 5 22.625 31.5 23.45 22.425 6 20.599999999999998 34.225 23.474999999999998 21.7 7 16.1 27.0 40.400000000000006 16.5 8 18.075 26.474999999999998 31.025000000000002 24.425 9 16.85 24.375 35.35 23.425 10-14 20.03 29.825000000000003 26.66 23.485 15-19 20.185 28.84 27.229999999999997 23.745 20-24 19.49 28.765 27.985 23.76 25-29 20.599999999999998 28.035 26.919999999999998 24.445 30-34 20.105 28.7 26.855 24.34 35-39 20.599999999999998 28.144999999999996 26.87 24.385 40-44 20.235 28.585 26.76 24.42 45-49 20.61 28.54 26.91 23.94 50-54 19.994999999999997 28.13 27.655 24.22 55-59 20.580000000000002 28.42 26.8 24.2 60-64 19.759999999999998 28.535 27.47 24.235 65-69 21.12 27.634999999999998 27.265 23.98 70-74 20.31 28.42 27.01 24.26 75-79 20.005 28.575 27.005000000000003 24.415 80-84 20.349999999999998 28.485 27.0 24.165 85-89 20.46 28.310000000000002 27.47 23.76 90-94 20.61 28.1 27.089999999999996 24.2 95-99 20.925 27.62 27.415 24.04 100-104 20.495 28.395 27.235 23.875 105-109 20.630000000000003 27.575 27.205000000000002 24.59 110-114 20.84 27.975 26.985 24.2 115-119 21.325 28.025 27.215 23.435 120-124 20.325 28.33 27.365000000000002 23.98 125-129 20.735 28.015 27.279999999999998 23.97 130-134 20.695 27.595 27.99 23.72 135-139 21.13 27.67 27.04 24.16 140-144 21.47 27.755000000000003 26.765 24.01 145-149 21.64 28.13 26.384999999999998 23.845 150-151 22.0 28.249999999999996 25.974999999999998 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 1.0 25 2.0 26 1.5 27 2.5 28 10.0 29 16.0 30 19.5 31 28.5 32 25.5 33 35.0 34 54.5 35 60.5 36 73.5 37 97.0 38 114.5 39 127.5 40 169.5 41 205.5 42 213.0 43 234.5 44 248.0 45 241.0 46 250.0 47 249.0 48 244.0 49 238.5 50 205.5 51 173.0 52 141.5 53 114.5 54 95.0 55 76.5 56 62.5 57 47.5 58 41.0 59 29.0 60 15.5 61 15.0 62 9.0 63 2.5 64 1.5 65 0.5 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.375 #Duplication Level Percentage of deduplicated Percentage of total 1 94.83443708609272 89.5 2 4.529801324503311 8.55 3 0.5033112582781457 1.425 4 0.10596026490066225 0.4 5 0.026490066225165563 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.1125 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.825 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.225 0.0 0.0 0.0 0.0 138-139 2.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTACCA 10 0.006830828 145.0 7 >>END_MODULE SRR12161403 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161403_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2945 37.0 37.0 37.0 37.0 37.0 2 35.8125 37.0 37.0 37.0 37.0 37.0 3 35.9205 37.0 37.0 37.0 37.0 37.0 4 35.975 37.0 37.0 37.0 37.0 37.0 5 36.0955 37.0 37.0 37.0 37.0 37.0 6 35.9645 37.0 37.0 37.0 37.0 37.0 7 36.027 37.0 37.0 37.0 37.0 37.0 8 36.1775 37.0 37.0 37.0 37.0 37.0 9 36.158 37.0 37.0 37.0 37.0 37.0 10-14 36.144600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.128699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.069 37.0 37.0 37.0 37.0 37.0 25-29 36.0022 37.0 37.0 37.0 37.0 37.0 30-34 36.058499999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.9598 37.0 37.0 37.0 37.0 37.0 40-44 35.933899999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9405 37.0 37.0 37.0 37.0 37.0 50-54 35.951800000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.85850000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.8407 37.0 37.0 37.0 37.0 37.0 65-69 35.8806 37.0 37.0 37.0 37.0 37.0 70-74 35.715199999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7255 37.0 37.0 37.0 37.0 37.0 80-84 35.8211 37.0 37.0 37.0 37.0 37.0 85-89 35.7492 37.0 37.0 37.0 37.0 37.0 90-94 35.692400000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.665800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.6882 37.0 37.0 37.0 37.0 37.0 105-109 35.6319 37.0 37.0 37.0 37.0 37.0 110-114 35.669599999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.591 37.0 37.0 37.0 37.0 37.0 120-124 35.5822 37.0 37.0 37.0 37.0 37.0 125-129 35.5199 37.0 37.0 37.0 37.0 37.0 130-134 35.4028 37.0 37.0 37.0 34.6 37.0 135-139 35.5048 37.0 37.0 37.0 37.0 37.0 140-144 35.3598 37.0 37.0 37.0 34.6 37.0 145-149 35.4674 37.0 37.0 37.0 37.0 37.0 150-151 34.94125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 2.0 15 4.0 16 0.0 17 4.0 18 3.0 19 0.0 20 5.0 21 4.0 22 2.0 23 10.0 24 8.0 25 8.0 26 11.0 27 13.0 28 17.0 29 27.0 30 23.0 31 36.0 32 67.0 33 103.0 34 210.0 35 581.0 36 2595.0 37 262.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.375 27.175 7.7 23.75 2 27.55 27.775 28.599999999999998 16.075 3 19.85 28.849999999999998 32.5 18.8 4 23.35 33.925 23.95 18.775 5 23.825 36.199999999999996 22.650000000000002 17.325 6 21.325 39.25 20.575 18.85 7 20.474999999999998 23.474999999999998 36.925000000000004 19.125 8 21.025 26.900000000000002 27.0 25.074999999999996 9 22.825 24.8 28.95 23.425 10-14 22.994999999999997 29.395 26.06 21.55 15-19 23.330000000000002 29.115000000000002 26.590000000000003 20.965 20-24 23.085 28.955 26.47 21.490000000000002 25-29 22.75 28.665000000000003 27.315 21.27 30-34 23.02 28.044999999999998 27.339999999999996 21.595 35-39 23.235 27.779999999999998 27.955000000000002 21.029999999999998 40-44 23.285 27.134999999999998 28.185 21.395 45-49 22.99 27.32 27.96 21.73 50-54 24.09 27.13 28.13 20.65 55-59 23.330000000000002 27.994999999999997 27.35 21.325 60-64 23.445 27.150000000000002 28.194999999999997 21.21 65-69 23.799999999999997 27.284999999999997 27.395000000000003 21.52 70-74 23.369999999999997 27.04 27.505000000000003 22.085 75-79 23.07 27.605 27.529999999999998 21.795 80-84 23.28 28.310000000000002 26.619999999999997 21.790000000000003 85-89 24.035 26.889999999999997 27.18 21.895 90-94 23.235 28.110000000000003 26.305 22.35 95-99 23.265 27.255000000000003 27.560000000000002 21.92 100-104 24.08 27.74 27.015 21.165 105-109 24.145 27.534999999999997 27.255000000000003 21.065 110-114 23.385 27.605 27.37 21.64 115-119 23.805 27.705000000000002 27.169999999999998 21.32 120-124 23.53 26.955000000000002 27.529999999999998 21.985 125-129 24.529999999999998 27.694999999999997 26.724999999999998 21.05 130-134 23.724999999999998 27.560000000000002 27.505000000000003 21.21 135-139 24.79 26.729999999999997 27.555000000000003 20.925 140-144 24.75 27.685 26.935 20.630000000000003 145-149 24.7 27.18 26.93 21.19 150-151 24.25 27.725 27.500000000000004 20.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 1.0 12 1.0 13 0.5 14 1.0 15 0.5 16 0.5 17 1.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.0 24 3.5 25 4.0 26 4.0 27 5.5 28 7.5 29 8.5 30 11.5 31 18.5 32 30.5 33 37.5 34 45.5 35 58.0 36 72.0 37 106.0 38 133.5 39 158.5 40 159.5 41 180.5 42 237.0 43 242.5 44 254.0 45 285.5 46 273.0 47 240.5 48 232.0 49 214.0 50 171.5 51 136.5 52 129.5 53 122.5 54 103.5 55 76.0 56 48.5 57 39.0 58 32.0 59 28.5 60 22.5 61 12.5 62 6.0 63 5.5 64 5.0 65 3.0 66 1.5 67 1.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.51725060176518 88.35 2 4.840866541856111 9.049999999999999 3 0.4011767852366943 1.125 4 0.08023535704733886 0.3 5 0.0 0.0 6 0.10698047606311847 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05349023803155924 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 10 0.25 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 6 0.15 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 6 0.15 No Hit GTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.0750000000000002 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.6749999999999998 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0250000000000004 0.0 0.0 0.0 0.0 136-137 2.25 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGACTT 10 0.006830828 145.0 7 GAACATT 10 0.006830828 145.0 2 AACATTG 10 0.006830828 145.0 3 >>END_MODULE Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra Read 881276 spots for SRR12161403.sra Written 881276 spots for SRR12161403.sra Read 881263 spots for SRR12161403.sra Written 881263 spots for SRR12161403.sra SRR ids: ['SRR12161403.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cleiqjfj SRR12161403.sra spots: 17625273 blocks: [[1, 881263], [881264, 1762526], [1762527, 2643789], [2643790, 3525052], [3525053, 4406315], [4406316, 5287578], [5287579, 6168841], [6168842, 7050104], [7050105, 7931367], [7931368, 8812630], [8812631, 9693893], [9693894, 10575156], [10575157, 11456419], [11456420, 12337682], [12337683, 13218945], [13218946, 14100208], [14100209, 14981471], [14981472, 15862734], [15862735, 16743997], [16743998, 17625273]] SRR12161403 file size 5968138 SRR12161403 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161403 SRR12161403_1.fastq SRR12161403_2.fastq Input file: SRR12161403_1.fastq Paired file: SRR12161403_2.fastq trimmed: SRR12161403-trimmed-pair1.fastq, SRR12161403-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:50:05 2025 >> started Thu Feb 13 20:50:24 2025 >> done (19.012s) 17625273 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 2777 ( 0.02%) empty read pairs filtered out after trimming by size control 17622478 (99.98%) read pairs available; of these: 957767 ( 5.43%) trimmed read pairs available after processing 16664711 (94.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 1 0.00% 21 0 0.00% 22 8 0.00% 23 7 0.00% 24 6 0.00% 25 5 0.00% 26 3 0.00% 27 6 0.00% 28 8 0.00% 29 6 0.00% 30 9 0.00% 31 6 0.00% 32 8 0.00% 33 11 0.00% 34 8 0.00% 35 4 0.00% 36 4 0.00% 37 4 0.00% 38 11 0.00% 39 9 0.00% 40 9 0.00% 41 5 0.00% 42 10 0.00% 43 9 0.00% 44 12 0.00% 45 4 0.00% 46 13 0.00% 47 15 0.00% 48 12 0.00% 49 13 0.00% 50 16 0.00% 51 19 0.00% 52 13 0.00% 53 23 0.00% 54 33 0.00% 55 18 0.00% 56 31 0.00% 57 35 0.00% 58 32 0.00% 59 49 0.00% 60 40 0.00% 61 63 0.00% 62 56 0.00% 63 61 0.00% 64 74 0.00% 65 67 0.00% 66 78 0.00% 67 90 0.00% 68 119 0.00% 69 140 0.00% 70 137 0.00% 71 155 0.00% 72 182 0.00% 73 241 0.00% 74 253 0.00% 75 261 0.00% 76 321 0.00% 77 318 0.00% 78 349 0.00% 79 445 0.00% 80 505 0.00% 81 590 0.00% 82 665 0.00% 83 776 0.00% 84 853 0.00% 85 946 0.01% 86 1076 0.01% 87 1168 0.01% 88 1356 0.01% 89 1493 0.01% 90 1582 0.01% 91 1735 0.01% 92 2047 0.01% 93 2284 0.01% 94 2456 0.01% 95 2725 0.02% 96 2948 0.02% 97 3234 0.02% 98 3556 0.02% 99 3831 0.02% 100 4013 0.02% 101 4393 0.02% 102 4708 0.03% 103 5316 0.03% 104 5550 0.03% 105 6104 0.03% 106 6523 0.04% 107 6996 0.04% 108 7083 0.04% 109 7751 0.04% 110 8134 0.05% 111 8690 0.05% 112 9199 0.05% 113 9419 0.05% 114 10276 0.06% 115 10978 0.06% 116 11317 0.06% 117 12312 0.07% 118 12275 0.07% 119 12909 0.07% 120 13791 0.08% 121 14363 0.08% 122 15087 0.09% 123 15661 0.09% 124 16311 0.09% 125 16749 0.10% 126 17723 0.10% 127 18320 0.10% 128 19565 0.11% 129 19635 0.11% 130 20177 0.11% 131 20752 0.12% 132 21814 0.12% 133 22530 0.13% 134 22992 0.13% 135 24062 0.14% 136 24755 0.14% 137 25216 0.14% 138 26182 0.15% 139 27121 0.15% 140 27548 0.16% 141 28461 0.16% 142 29441 0.17% 143 29865 0.17% 144 31320 0.18% 145 32165 0.18% 146 32511 0.18% 147 33442 0.19% 148 34848 0.20% 149 35171 0.20% 150 36467 0.21% 151 16664711 94.57% 17622478 reads passed initial QC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=1.05 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=37.29 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.0 sequence=AAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGA criterion=sequence-density sequence-density=1.41 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=22 prefix-density=1.43 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=34.61 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12161403 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:51:07 Started mapping on | Feb 13 20:51:07 Finished on | Feb 13 20:52:53 Mapping speed, Million of reads per hour | 598.50 Number of input reads | 17622478 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16598521 Uniquely mapped reads % | 94.19% Average mapped length | 298.73 Number of splices: Total | 16651160 Number of splices: Annotated (sjdb) | 16345392 Number of splices: GT/AG | 16328809 Number of splices: GC/AG | 271805 Number of splices: AT/AC | 13845 Number of splices: Non-canonical | 36701 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471422 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 113229 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 552535 552535 552535 N_multimapping 471422 471422 471422 N_noFeature 497594 16425470 551482 N_ambiguous 224883 851 105154 UnstrandedReadsAssigned:15876044 PositiveStrandReadsAssigned:172200 NegativeStrandReadsAssigned:15941885 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161403 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161403-trimmed-pair1.fastq SRR12161403-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,622,478 reads, 16,038,030 reads pseudoaligned [quant] estimated average fragment length: 278.401 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR12161403.ke.tsv 34699 SRR12161403.se.tsv 87100 total ==> SRR12161403.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.6 380 11.5929 Potri.005G024800.1.v4.1 1035 757.599 148 10.3736 Potri.004G059700.1.v4.1 961 683.845 49 3.80493 Potri.007G009000.2.v4.1 1416 1138.6 0 0 Potri.003G141000.2.v4.1 2943 2665.6 401 7.98835 Potri.016G087400.1.v4.1 270 72.1054 1208 889.625 Potri.015G069301.1.v4.1 564 302.793 0 0 Potri.010G195200.1.v4.1 1773 1495.6 0 0 Potri.012G127500.1.v4.1 977 699.733 1008 76.4955 ==> SRR12161403.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 165 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 26 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12161403 completed mapping pipeline successfully