Starting /dee2/code/volunteer_pipeline.sh SRR12161404 current disk space = 3088180101120 free memory = 1460623684 SRR12161404 SRAfilesize c3c09e5c9926d363de603ec90597ab37 SRR12161404.sra SRR12161404.sra file validated SRR12161404 is paired end SRR12161404 is conventional basespace SRR12161404 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161404_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.615 37.0 37.0 37.0 37.0 37.0 2 36.3755 37.0 37.0 37.0 37.0 37.0 3 36.491 37.0 37.0 37.0 37.0 37.0 4 36.447 37.0 37.0 37.0 37.0 37.0 5 36.4865 37.0 37.0 37.0 37.0 37.0 6 36.5685 37.0 37.0 37.0 37.0 37.0 7 36.4735 37.0 37.0 37.0 37.0 37.0 8 36.537 37.0 37.0 37.0 37.0 37.0 9 36.4555 37.0 37.0 37.0 37.0 37.0 10-14 36.5486 37.0 37.0 37.0 37.0 37.0 15-19 36.5461 37.0 37.0 37.0 37.0 37.0 20-24 36.5286 37.0 37.0 37.0 37.0 37.0 25-29 36.4604 37.0 37.0 37.0 37.0 37.0 30-34 36.439 37.0 37.0 37.0 37.0 37.0 35-39 36.4088 37.0 37.0 37.0 37.0 37.0 40-44 36.367200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.33120000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.326699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3371 37.0 37.0 37.0 37.0 37.0 60-64 36.3052 37.0 37.0 37.0 37.0 37.0 65-69 36.261700000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3236 37.0 37.0 37.0 37.0 37.0 75-79 36.2195 37.0 37.0 37.0 37.0 37.0 80-84 36.2335 37.0 37.0 37.0 37.0 37.0 85-89 36.22760000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.23010000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.16609999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.1846 37.0 37.0 37.0 37.0 37.0 105-109 36.098 37.0 37.0 37.0 37.0 37.0 110-114 36.105000000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.076699999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0444 37.0 37.0 37.0 37.0 37.0 125-129 36.020399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9852 37.0 37.0 37.0 37.0 37.0 135-139 35.936699999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.89919999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.8305 37.0 37.0 37.0 37.0 37.0 150-151 35.655249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 4.0 24 1.0 25 4.0 26 5.0 27 10.0 28 14.0 29 25.0 30 21.0 31 38.0 32 52.0 33 81.0 34 108.0 35 260.0 36 2920.0 37 453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.05 11.825 5.3 33.825 2 21.425 13.450000000000001 33.575 31.55 3 16.85 19.425 29.799999999999997 33.925 4 21.425 26.674999999999997 23.9 28.000000000000004 5 21.775 33.1 23.95 21.175 6 21.975 35.075 23.9 19.05 7 14.774999999999999 25.374999999999996 43.075 16.775000000000002 8 17.849999999999998 25.85 30.3 26.0 9 17.150000000000002 23.05 36.025 23.775 10-14 20.405 29.475 26.740000000000002 23.380000000000003 15-19 20.255000000000003 27.675 27.54 24.529999999999998 20-24 19.98 28.325 27.735 23.96 25-29 20.21 28.065 27.57 24.154999999999998 30-34 20.474999999999998 27.815 27.815 23.895 35-39 20.580000000000002 28.865000000000002 26.889999999999997 23.665 40-44 20.115 28.62 27.355 23.91 45-49 19.830000000000002 28.375 27.634999999999998 24.16 50-54 19.895 28.634999999999998 27.255000000000003 24.215 55-59 20.29 28.199999999999996 27.255000000000003 24.255 60-64 20.605 28.77 26.634999999999998 23.990000000000002 65-69 20.424999999999997 27.985 27.73 23.86 70-74 20.07 28.54 27.284999999999997 24.104999999999997 75-79 20.580000000000002 27.805000000000003 27.51 24.104999999999997 80-84 20.195 27.939999999999998 27.805000000000003 24.060000000000002 85-89 19.68 28.560000000000002 27.61 24.15 90-94 20.79 27.82 27.025 24.365000000000002 95-99 21.05 27.889999999999997 26.915 24.145 100-104 20.7 28.685 26.91 23.705000000000002 105-109 20.91 28.02 27.915 23.155 110-114 21.02 27.975 27.205000000000002 23.799999999999997 115-119 21.135 28.375 27.49 23.0 120-124 20.995 27.72 27.529999999999998 23.755000000000003 125-129 21.065 27.860000000000003 26.86 24.215 130-134 21.12 27.865000000000002 27.575 23.44 135-139 21.745 27.525 27.229999999999997 23.5 140-144 21.185000000000002 27.900000000000002 27.12 23.794999999999998 145-149 20.974999999999998 28.27 26.619999999999997 24.135 150-151 21.325 29.2 26.525 22.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 2.0 3 2.5 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 3.0 24 5.5 25 4.5 26 4.5 27 9.0 28 14.5 29 17.0 30 21.5 31 21.5 32 25.5 33 45.0 34 58.0 35 63.0 36 74.0 37 92.0 38 113.5 39 132.0 40 153.5 41 171.0 42 204.0 43 246.0 44 242.5 45 247.5 46 260.5 47 241.5 48 251.5 49 251.0 50 199.5 51 172.5 52 152.5 53 116.0 54 92.5 55 73.5 56 54.5 57 41.0 58 33.0 59 23.5 60 16.0 61 11.5 62 10.5 63 8.0 64 3.5 65 2.5 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.45 #Duplication Level Percentage of deduplicated Percentage of total 1 93.76672017121456 87.625 2 5.698234349919743 10.65 3 0.4280363830925628 1.2 4 0.05350454788657035 0.2 5 0.0 0.0 6 0.026752273943285176 0.15 7 0.026752273943285176 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 0.9125000000000001 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.6749999999999998 0.0 0.0 0.0 0.0 130-131 1.8875000000000002 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138-139 3.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCAA 20 0.00593511 29.0 90-94 >>END_MODULE SRR12161404 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161404_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.053 37.0 37.0 37.0 37.0 37.0 2 35.527 37.0 37.0 37.0 37.0 37.0 3 35.7735 37.0 37.0 37.0 37.0 37.0 4 35.7985 37.0 37.0 37.0 37.0 37.0 5 36.003 37.0 37.0 37.0 37.0 37.0 6 35.8225 37.0 37.0 37.0 37.0 37.0 7 35.951 37.0 37.0 37.0 37.0 37.0 8 35.8675 37.0 37.0 37.0 37.0 37.0 9 35.951 37.0 37.0 37.0 37.0 37.0 10-14 35.9393 37.0 37.0 37.0 37.0 37.0 15-19 35.9763 37.0 37.0 37.0 37.0 37.0 20-24 35.8811 37.0 37.0 37.0 37.0 37.0 25-29 35.892 37.0 37.0 37.0 37.0 37.0 30-34 35.8476 37.0 37.0 37.0 37.0 37.0 35-39 35.775 37.0 37.0 37.0 37.0 37.0 40-44 35.7574 37.0 37.0 37.0 37.0 37.0 45-49 35.772999999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.7775 37.0 37.0 37.0 37.0 37.0 55-59 35.691700000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.7332 37.0 37.0 37.0 37.0 37.0 65-69 35.639599999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.5475 37.0 37.0 37.0 37.0 37.0 75-79 35.527 37.0 37.0 37.0 37.0 37.0 80-84 35.63 37.0 37.0 37.0 37.0 37.0 85-89 35.4687 37.0 37.0 37.0 37.0 37.0 90-94 35.4667 37.0 37.0 37.0 37.0 37.0 95-99 35.4925 37.0 37.0 37.0 37.0 37.0 100-104 35.4325 37.0 37.0 37.0 37.0 37.0 105-109 35.436899999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.347300000000004 37.0 37.0 37.0 34.6 37.0 115-119 35.427099999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.42020000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.325399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.143600000000006 37.0 37.0 37.0 27.4 37.0 135-139 35.1939 37.0 37.0 37.0 29.8 37.0 140-144 35.1914 37.0 37.0 37.0 29.8 37.0 145-149 35.1262 37.0 37.0 37.0 29.8 37.0 150-151 34.5415 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 7.0 14 5.0 15 2.0 16 2.0 17 3.0 18 3.0 19 6.0 20 0.0 21 4.0 22 5.0 23 6.0 24 12.0 25 15.0 26 7.0 27 16.0 28 20.0 29 26.0 30 43.0 31 56.0 32 88.0 33 127.0 34 225.0 35 633.0 36 2492.0 37 195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.949999999999996 23.825 7.925 21.3 2 27.925 26.150000000000002 27.1 18.825 3 22.15 26.450000000000003 32.725 18.675 4 24.075 34.675 22.8 18.45 5 25.1 36.6 20.275000000000002 18.025 6 21.725 39.125 20.5 18.65 7 21.349999999999998 22.5 36.65 19.5 8 21.825 25.974999999999998 26.075 26.125 9 22.225 25.5 28.9 23.375 10-14 23.39 28.999999999999996 25.915 21.695 15-19 23.76 28.115000000000002 27.029999999999998 21.095 20-24 22.825 29.195 26.735 21.245 25-29 22.955000000000002 28.48 26.924999999999997 21.64 30-34 23.01 28.515 26.955000000000002 21.52 35-39 22.82 28.134999999999998 27.26 21.785 40-44 23.02 27.575 27.42 21.985 45-49 23.035 27.310000000000002 27.46 22.195 50-54 23.005 27.77 27.54 21.685 55-59 23.46 27.1 27.589999999999996 21.85 60-64 23.825 27.66 27.055 21.46 65-69 23.445 27.38 27.55 21.625 70-74 23.27 28.07 27.37 21.29 75-79 23.415 27.200000000000003 27.775 21.61 80-84 23.69 27.215 27.37 21.725 85-89 23.72 27.275 27.229999999999997 21.775 90-94 23.830000000000002 27.224999999999998 28.000000000000004 20.945 95-99 23.695 27.555000000000003 27.55 21.2 100-104 23.97 27.284999999999997 27.73 21.015 105-109 23.745 27.565 27.26 21.43 110-114 23.735 27.134999999999998 27.98 21.15 115-119 24.195 27.455000000000002 27.905 20.445 120-124 24.18 27.715 27.365000000000002 20.74 125-129 23.57 27.855 27.365000000000002 21.21 130-134 24.185000000000002 27.92 27.445000000000004 20.45 135-139 24.62 27.915 27.08 20.385 140-144 24.66 27.16 27.474999999999998 20.705000000000002 145-149 24.990000000000002 26.93 27.215 20.865000000000002 150-151 25.374999999999996 26.337500000000002 28.237499999999997 20.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 2.0 15 1.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.5 25 2.0 26 2.5 27 5.0 28 9.5 29 10.5 30 10.0 31 18.0 32 23.0 33 28.0 34 39.5 35 53.5 36 73.0 37 106.5 38 130.5 39 146.0 40 178.5 41 200.5 42 210.5 43 240.5 44 257.5 45 252.0 46 252.5 47 260.5 48 256.5 49 236.5 50 189.5 51 148.5 52 129.5 53 102.5 54 90.5 55 84.0 56 64.5 57 38.0 58 23.0 59 24.0 60 24.5 61 17.5 62 13.0 63 7.0 64 1.5 65 0.5 66 1.5 67 1.0 68 0.5 69 1.0 70 1.0 71 1.5 72 1.0 73 0.5 74 1.0 75 1.5 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 1.5 88 1.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 1.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.17088102209209 88.44999999999999 2 5.4032472717593825 10.15 3 0.31940377961139205 0.8999999999999999 4 0.07985094490284801 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026616981634282673 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 0.9125000000000001 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.8875000000000002 0.0 0.0 0.0 0.0 132-133 2.2125 0.0 0.0 0.0 0.0 134-135 2.4749999999999996 0.0 0.0 0.0 0.0 136-137 2.675 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730556 spots for SRR12161404.sra Written 730556 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra Read 730550 spots for SRR12161404.sra Written 730550 spots for SRR12161404.sra SRR ids: ['SRR12161404.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vr5kinzn SRR12161404.sra spots: 14611006 blocks: [[1, 730550], [730551, 1461100], [1461101, 2191650], [2191651, 2922200], [2922201, 3652750], [3652751, 4383300], [4383301, 5113850], [5113851, 5844400], [5844401, 6574950], [6574951, 7305500], [7305501, 8036050], [8036051, 8766600], [8766601, 9497150], [9497151, 10227700], [10227701, 10958250], [10958251, 11688800], [11688801, 12419350], [12419351, 13149900], [13149901, 13880450], [13880451, 14611006]] SRR12161404 file size 4943758 SRR12161404 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161404 SRR12161404_1.fastq SRR12161404_2.fastq Input file: SRR12161404_1.fastq Paired file: SRR12161404_2.fastq trimmed: SRR12161404-trimmed-pair1.fastq, SRR12161404-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:05:23 2025 >> started Thu Feb 13 21:05:41 2025 >> done (18.353s) 14611006 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 1940 ( 0.01%) empty read pairs filtered out after trimming by size control 14609039 (99.99%) read pairs available; of these: 734143 ( 5.03%) trimmed read pairs available after processing 13874896 (94.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 4 0.00% 21 7 0.00% 22 8 0.00% 23 10 0.00% 24 8 0.00% 25 9 0.00% 26 8 0.00% 27 11 0.00% 28 19 0.00% 29 8 0.00% 30 7 0.00% 31 9 0.00% 32 19 0.00% 33 9 0.00% 34 15 0.00% 35 12 0.00% 36 15 0.00% 37 12 0.00% 38 9 0.00% 39 18 0.00% 40 12 0.00% 41 9 0.00% 42 18 0.00% 43 13 0.00% 44 21 0.00% 45 14 0.00% 46 21 0.00% 47 22 0.00% 48 14 0.00% 49 14 0.00% 50 24 0.00% 51 25 0.00% 52 17 0.00% 53 29 0.00% 54 38 0.00% 55 39 0.00% 56 29 0.00% 57 32 0.00% 58 36 0.00% 59 40 0.00% 60 54 0.00% 61 62 0.00% 62 75 0.00% 63 73 0.00% 64 65 0.00% 65 90 0.00% 66 101 0.00% 67 86 0.00% 68 83 0.00% 69 140 0.00% 70 148 0.00% 71 164 0.00% 72 183 0.00% 73 225 0.00% 74 230 0.00% 75 229 0.00% 76 264 0.00% 77 290 0.00% 78 324 0.00% 79 389 0.00% 80 426 0.00% 81 471 0.00% 82 558 0.00% 83 621 0.00% 84 691 0.00% 85 799 0.01% 86 794 0.01% 87 866 0.01% 88 920 0.01% 89 1015 0.01% 90 1201 0.01% 91 1372 0.01% 92 1547 0.01% 93 1780 0.01% 94 1909 0.01% 95 2140 0.01% 96 2199 0.02% 97 2250 0.02% 98 2487 0.02% 99 2643 0.02% 100 2892 0.02% 101 3236 0.02% 102 3493 0.02% 103 3934 0.03% 104 4223 0.03% 105 4402 0.03% 106 4625 0.03% 107 4817 0.03% 108 5127 0.04% 109 5363 0.04% 110 5660 0.04% 111 6129 0.04% 112 6677 0.05% 113 6933 0.05% 114 7499 0.05% 115 7960 0.05% 116 8252 0.06% 117 8622 0.06% 118 8641 0.06% 119 9068 0.06% 120 9558 0.07% 121 10124 0.07% 122 10792 0.07% 123 11554 0.08% 124 12213 0.08% 125 12682 0.09% 126 13273 0.09% 127 13377 0.09% 128 13981 0.10% 129 14554 0.10% 130 14762 0.10% 131 15166 0.10% 132 16179 0.11% 133 17406 0.12% 134 18026 0.12% 135 18996 0.13% 136 19615 0.13% 137 19748 0.14% 138 20673 0.14% 139 21102 0.14% 140 21134 0.14% 141 21642 0.15% 142 23036 0.16% 143 24168 0.17% 144 25395 0.17% 145 26471 0.18% 146 26805 0.18% 147 27771 0.19% 148 27978 0.19% 149 28572 0.20% 150 29186 0.20% 151 13874896 94.97% 14609039 reads passed initial QC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=1.06 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=27.73 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.4 sequence=CAGTTTCATTTGAGACTACAAATGAAGGAAGAAAAACTTGGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAAATCCACCCCCCCTGCCGGAACACCACCGACGACACAAACAGAAAGAGATCTTATTTAACCGCTAAACTCTTCCTCTTTGTGTGTCTCGATGACAACATCAGACGTAGGATAAGCAACACAGGTGAGAACCCAGCCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCACAGTCCCCTTCACAATCTTGCCAAGACATGAAGAGCATGAGCCAGCCCTGCATGAGTAGGGGAGGTCAATCTCTTCTGCCTCCTCAGCATGGTCAAGGATGTAGATGTCATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCC criterion=sequence-density sequence-density=1.29 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=15 prefix-density=1.32 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=59.64 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12161404 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:06:30 Started mapping on | Feb 13 21:06:30 Finished on | Feb 13 21:08:25 Mapping speed, Million of reads per hour | 457.33 Number of input reads | 14609039 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13557140 Uniquely mapped reads % | 92.80% Average mapped length | 298.76 Number of splices: Total | 13985063 Number of splices: Annotated (sjdb) | 13743181 Number of splices: GT/AG | 13687470 Number of splices: GC/AG | 253274 Number of splices: AT/AC | 8601 Number of splices: Non-canonical | 35718 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310988 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 92501 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.22% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 740911 740911 740911 N_multimapping 310988 310988 310988 N_noFeature 406169 13405958 451518 N_ambiguous 203848 699 97519 UnstrandedReadsAssigned:12947123 PositiveStrandReadsAssigned:150483 NegativeStrandReadsAssigned:13008103 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161404 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161404-trimmed-pair1.fastq SRR12161404-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,609,039 reads, 13,166,202 reads pseudoaligned [quant] estimated average fragment length: 263.523 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR12161404.ke.tsv 34699 SRR12161404.se.tsv 87100 total ==> SRR12161404.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.48 248 9.77428 Potri.005G024800.1.v4.1 1035 772.477 236 21.1376 Potri.004G059700.1.v4.1 961 698.64 37 3.66418 Potri.007G009000.2.v4.1 1416 1153.48 0 0 Potri.003G141000.2.v4.1 2943 2680.48 363 9.36964 Potri.016G087400.1.v4.1 270 69.9438 564.653 558.548 Potri.015G069301.1.v4.1 564 312.721 0 0 Potri.010G195200.1.v4.1 1773 1510.48 4 0.183221 Potri.012G127500.1.v4.1 977 714.592 238 23.0434 ==> SRR12161404.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 102 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 172 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12161404 completed mapping pipeline successfully