Starting /dee2/code/volunteer_pipeline.sh SRR12161405 current disk space = 3088051023872 free memory = 1413338272 SRR12161405 SRAfilesize 621f8957f77858c1562430cf1aafede6 SRR12161405.sra SRR12161405.sra file validated SRR12161405 is paired end SRR12161405 is conventional basespace SRR12161405 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161405_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5475 37.0 37.0 37.0 37.0 37.0 2 36.3965 37.0 37.0 37.0 37.0 37.0 3 36.5535 37.0 37.0 37.0 37.0 37.0 4 36.469 37.0 37.0 37.0 37.0 37.0 5 36.6455 37.0 37.0 37.0 37.0 37.0 6 36.6055 37.0 37.0 37.0 37.0 37.0 7 36.5575 37.0 37.0 37.0 37.0 37.0 8 36.489 37.0 37.0 37.0 37.0 37.0 9 36.514 37.0 37.0 37.0 37.0 37.0 10-14 36.5751 37.0 37.0 37.0 37.0 37.0 15-19 36.5034 37.0 37.0 37.0 37.0 37.0 20-24 36.5049 37.0 37.0 37.0 37.0 37.0 25-29 36.431 37.0 37.0 37.0 37.0 37.0 30-34 36.473200000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.400099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3748 37.0 37.0 37.0 37.0 37.0 45-49 36.4236 37.0 37.0 37.0 37.0 37.0 50-54 36.3507 37.0 37.0 37.0 37.0 37.0 55-59 36.3484 37.0 37.0 37.0 37.0 37.0 60-64 36.2759 37.0 37.0 37.0 37.0 37.0 65-69 36.2587 37.0 37.0 37.0 37.0 37.0 70-74 36.29469999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.2667 37.0 37.0 37.0 37.0 37.0 80-84 36.314499999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.29 37.0 37.0 37.0 37.0 37.0 90-94 36.27720000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.283100000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2254 37.0 37.0 37.0 37.0 37.0 105-109 36.17829999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1954 37.0 37.0 37.0 37.0 37.0 115-119 36.21659999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.1373 37.0 37.0 37.0 37.0 37.0 125-129 36.1117 37.0 37.0 37.0 37.0 37.0 130-134 36.0855 37.0 37.0 37.0 37.0 37.0 135-139 36.0202 37.0 37.0 37.0 37.0 37.0 140-144 35.946299999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.9476 37.0 37.0 37.0 37.0 37.0 150-151 35.775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 3.0 26 3.0 27 6.0 28 8.0 29 18.0 30 18.0 31 43.0 32 61.0 33 74.0 34 104.0 35 283.0 36 2959.0 37 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.775 12.225 5.775 36.225 2 20.75 13.075000000000001 33.4 32.775 3 16.6 16.950000000000003 29.725 36.725 4 22.775000000000002 23.45 23.724999999999998 30.049999999999997 5 23.7 31.55 22.35 22.400000000000002 6 20.125 34.5 22.75 22.625 7 14.774999999999999 27.224999999999998 41.65 16.35 8 18.55 25.874999999999996 31.75 23.825 9 17.424999999999997 24.349999999999998 34.275 23.95 10-14 19.16 30.17 27.200000000000003 23.47 15-19 20.335 27.935 28.360000000000003 23.369999999999997 20-24 20.825 27.93 27.21 24.035 25-29 20.335 28.625 27.22 23.82 30-34 19.93 28.32 27.665 24.085 35-39 20.575 28.105000000000004 27.005000000000003 24.315 40-44 20.1 28.32 27.825 23.755000000000003 45-49 20.275000000000002 28.22 27.075 24.43 50-54 21.02 27.93 27.375 23.674999999999997 55-59 20.76 28.57 26.650000000000002 24.02 60-64 20.93 28.535 26.735 23.799999999999997 65-69 21.13 28.22 26.86 23.79 70-74 20.705000000000002 28.560000000000002 26.924999999999997 23.810000000000002 75-79 20.474999999999998 28.18 27.3 24.044999999999998 80-84 20.66 28.194999999999997 27.355 23.79 85-89 20.885 28.04 26.855 24.22 90-94 20.48 28.475 27.115000000000002 23.93 95-99 20.855 27.61 27.38 24.154999999999998 100-104 20.424999999999997 29.349999999999998 26.795 23.43 105-109 21.305 28.110000000000003 26.505000000000003 24.08 110-114 21.255 27.439999999999998 27.77 23.535 115-119 21.345 27.55 27.235 23.87 120-124 20.59 28.34 27.115000000000002 23.955000000000002 125-129 21.435000000000002 27.38 27.445000000000004 23.74 130-134 21.02 28.265 26.85 23.865 135-139 21.245 28.549999999999997 26.395000000000003 23.810000000000002 140-144 21.25 28.29 27.075 23.385 145-149 21.22 27.950000000000003 26.46 24.37 150-151 20.4 28.499999999999996 26.9125 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 4.0 26 7.0 27 8.0 28 8.0 29 9.0 30 12.5 31 24.0 32 38.0 33 43.5 34 51.0 35 66.0 36 81.5 37 87.5 38 107.5 39 144.0 40 180.0 41 190.0 42 208.5 43 238.0 44 251.5 45 247.0 46 243.0 47 252.0 48 237.0 49 221.0 50 195.0 51 164.5 52 148.0 53 121.0 54 88.0 55 75.0 56 61.0 57 49.5 58 44.0 59 33.5 60 23.5 61 13.0 62 8.5 63 5.0 64 2.5 65 2.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 94.77020602218701 89.7 2 4.833597464342314 9.15 3 0.369783412572636 1.05 4 0.02641310089804543 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.9249999999999998 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.3375 0.0 0.0 0.0 0.0 136-137 3.5875 0.0 0.0 0.0 0.0 138-139 3.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGCTT 10 0.006830828 145.0 2 CGGCTTG 10 0.006830828 145.0 3 >>END_MODULE SRR12161405 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161405_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3895 37.0 37.0 37.0 37.0 37.0 2 36.049 37.0 37.0 37.0 37.0 37.0 3 36.192 37.0 37.0 37.0 37.0 37.0 4 36.131 37.0 37.0 37.0 37.0 37.0 5 36.2575 37.0 37.0 37.0 37.0 37.0 6 36.2095 37.0 37.0 37.0 37.0 37.0 7 36.2295 37.0 37.0 37.0 37.0 37.0 8 36.214 37.0 37.0 37.0 37.0 37.0 9 36.31 37.0 37.0 37.0 37.0 37.0 10-14 36.3236 37.0 37.0 37.0 37.0 37.0 15-19 36.2543 37.0 37.0 37.0 37.0 37.0 20-24 36.2423 37.0 37.0 37.0 37.0 37.0 25-29 36.1992 37.0 37.0 37.0 37.0 37.0 30-34 36.1303 37.0 37.0 37.0 37.0 37.0 35-39 36.147400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1332 37.0 37.0 37.0 37.0 37.0 45-49 36.0398 37.0 37.0 37.0 37.0 37.0 50-54 36.0631 37.0 37.0 37.0 37.0 37.0 55-59 36.019600000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0599 37.0 37.0 37.0 37.0 37.0 65-69 36.021100000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9328 37.0 37.0 37.0 37.0 37.0 75-79 35.9346 37.0 37.0 37.0 37.0 37.0 80-84 35.972 37.0 37.0 37.0 37.0 37.0 85-89 35.9243 37.0 37.0 37.0 37.0 37.0 90-94 35.8881 37.0 37.0 37.0 37.0 37.0 95-99 35.9269 37.0 37.0 37.0 37.0 37.0 100-104 35.889599999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.827799999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.8478 37.0 37.0 37.0 37.0 37.0 115-119 35.8722 37.0 37.0 37.0 37.0 37.0 120-124 35.834399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.7216 37.0 37.0 37.0 37.0 37.0 130-134 35.662 37.0 37.0 37.0 37.0 37.0 135-139 35.6846 37.0 37.0 37.0 37.0 37.0 140-144 35.590599999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.6126 37.0 37.0 37.0 37.0 37.0 150-151 35.137249999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 4.0 22 4.0 23 8.0 24 13.0 25 8.0 26 7.0 27 9.0 28 17.0 29 13.0 30 27.0 31 30.0 32 49.0 33 104.0 34 161.0 35 502.0 36 2724.0 37 311.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.05 26.75 8.3 23.9 2 27.6 28.025 27.900000000000002 16.475 3 20.674999999999997 27.200000000000003 33.575 18.55 4 23.05 33.175 24.8 18.975 5 24.275 37.175000000000004 21.675 16.875 6 20.849999999999998 40.150000000000006 21.325 17.675 7 20.75 22.125 38.0 19.125 8 20.974999999999998 25.5 27.950000000000003 25.575 9 22.75 25.1 28.65 23.5 10-14 23.055 29.78 26.05 21.115000000000002 15-19 23.01 27.765 27.200000000000003 22.025 20-24 22.97 28.360000000000003 27.560000000000002 21.11 25-29 23.695 28.395 27.05 20.86 30-34 22.895 28.07 27.644999999999996 21.39 35-39 22.91 27.639999999999997 27.815 21.634999999999998 40-44 22.755 27.755000000000003 27.694999999999997 21.795 45-49 22.195 27.47 28.465 21.87 50-54 23.11 26.889999999999997 28.115000000000002 21.884999999999998 55-59 23.185 27.29 27.834999999999997 21.69 60-64 23.315 26.645000000000003 28.194999999999997 21.845 65-69 22.905 27.425 27.665 22.005 70-74 22.919999999999998 27.305 27.845 21.93 75-79 22.765 27.689999999999998 28.084999999999997 21.46 80-84 24.015 27.775 26.810000000000002 21.4 85-89 23.830000000000002 27.615000000000002 26.655 21.9 90-94 23.57 27.345000000000002 27.6 21.485000000000003 95-99 23.95 27.345000000000002 27.529999999999998 21.175 100-104 23.5 28.4 26.939999999999998 21.16 105-109 24.065 27.445000000000004 26.810000000000002 21.68 110-114 23.855 27.675 27.235 21.235 115-119 23.77 27.705000000000002 27.284999999999997 21.240000000000002 120-124 23.41 27.855 27.61 21.125 125-129 23.61 27.589999999999996 27.13 21.67 130-134 24.635 27.415 27.060000000000002 20.89 135-139 24.055 28.060000000000002 27.115000000000002 20.77 140-144 24.265 27.555000000000003 27.46 20.72 145-149 24.85 27.500000000000004 26.445 21.205 150-151 25.387500000000003 27.525 27.1125 19.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 2.0 9 1.5 10 0.0 11 1.0 12 1.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 3.0 26 2.0 27 4.5 28 8.0 29 10.5 30 15.0 31 18.5 32 22.0 33 30.0 34 54.0 35 67.5 36 77.5 37 104.5 38 128.5 39 151.0 40 178.5 41 198.5 42 214.5 43 244.5 44 268.0 45 256.5 46 241.5 47 248.5 48 251.5 49 226.0 50 190.5 51 158.0 52 124.5 53 108.5 54 91.5 55 63.0 56 51.5 57 48.0 58 33.5 59 31.0 60 23.0 61 9.0 62 7.5 63 4.5 64 3.5 65 3.0 66 1.0 67 1.5 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 1.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.45329087048833 88.97500000000001 2 4.989384288747346 9.4 3 0.5042462845010616 1.425 4 0.05307855626326964 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0125 0.0 124-125 1.9249999999999998 0.0 0.0 0.025 0.0 126-127 2.1500000000000004 0.0 0.0 0.025 0.0 128-129 2.4125 0.0 0.0 0.025 0.0 130-131 2.6375 0.0 0.0 0.025 0.0 132-133 3.075 0.0 0.0 0.025 0.0 134-135 3.3499999999999996 0.0 0.0 0.025 0.0 136-137 3.6375 0.0 0.0 0.025 0.0 138-139 4.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACTTA 10 0.006830828 145.0 3 GATAGAG 10 0.006830828 145.0 5 >>END_MODULE Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606341 spots for SRR12161405.sra Written 606341 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra Read 606328 spots for SRR12161405.sra Written 606328 spots for SRR12161405.sra SRR ids: ['SRR12161405.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fvpm247w SRR12161405.sra spots: 12126573 blocks: [[1, 606328], [606329, 1212656], [1212657, 1818984], [1818985, 2425312], [2425313, 3031640], [3031641, 3637968], [3637969, 4244296], [4244297, 4850624], [4850625, 5456952], [5456953, 6063280], [6063281, 6669608], [6669609, 7275936], [7275937, 7882264], [7882265, 8488592], [8488593, 9094920], [9094921, 9701248], [9701249, 10307576], [10307577, 10913904], [10913905, 11520232], [11520233, 12126573]] SRR12161405 file size 4099439 SRR12161405 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161405 SRR12161405_1.fastq SRR12161405_2.fastq Input file: SRR12161405_1.fastq Paired file: SRR12161405_2.fastq trimmed: SRR12161405-trimmed-pair1.fastq, SRR12161405-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:53:43 2025 >> started Thu Feb 13 20:53:56 2025 >> done (13.281s) 12126573 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 7430 ( 0.06%) empty read pairs filtered out after trimming by size control 12119114 (99.94%) read pairs available; of these: 667654 ( 5.51%) trimmed read pairs available after processing 11451460 (94.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 7 0.00% 24 4 0.00% 25 4 0.00% 26 7 0.00% 27 10 0.00% 28 3 0.00% 29 4 0.00% 30 5 0.00% 31 5 0.00% 32 10 0.00% 33 7 0.00% 34 11 0.00% 35 8 0.00% 36 6 0.00% 37 8 0.00% 38 12 0.00% 39 9 0.00% 40 10 0.00% 41 8 0.00% 42 8 0.00% 43 8 0.00% 44 7 0.00% 45 10 0.00% 46 18 0.00% 47 12 0.00% 48 11 0.00% 49 13 0.00% 50 11 0.00% 51 15 0.00% 52 21 0.00% 53 23 0.00% 54 14 0.00% 55 22 0.00% 56 21 0.00% 57 32 0.00% 58 30 0.00% 59 37 0.00% 60 45 0.00% 61 41 0.00% 62 55 0.00% 63 44 0.00% 64 58 0.00% 65 65 0.00% 66 74 0.00% 67 90 0.00% 68 88 0.00% 69 115 0.00% 70 120 0.00% 71 145 0.00% 72 137 0.00% 73 187 0.00% 74 227 0.00% 75 225 0.00% 76 248 0.00% 77 255 0.00% 78 311 0.00% 79 384 0.00% 80 409 0.00% 81 468 0.00% 82 502 0.00% 83 598 0.00% 84 665 0.01% 85 755 0.01% 86 757 0.01% 87 886 0.01% 88 1030 0.01% 89 1031 0.01% 90 1190 0.01% 91 1374 0.01% 92 1499 0.01% 93 1675 0.01% 94 1852 0.02% 95 2084 0.02% 96 2205 0.02% 97 2406 0.02% 98 2515 0.02% 99 2746 0.02% 100 2988 0.02% 101 3232 0.03% 102 3594 0.03% 103 3878 0.03% 104 4289 0.04% 105 4280 0.04% 106 4538 0.04% 107 4985 0.04% 108 5144 0.04% 109 5575 0.05% 110 5790 0.05% 111 6072 0.05% 112 6539 0.05% 113 6781 0.06% 114 7223 0.06% 115 7671 0.06% 116 8279 0.07% 117 8522 0.07% 118 8937 0.07% 119 9078 0.07% 120 9639 0.08% 121 9978 0.08% 122 10076 0.08% 123 11013 0.09% 124 11517 0.10% 125 11696 0.10% 126 12508 0.10% 127 12885 0.11% 128 13062 0.11% 129 13711 0.11% 130 14019 0.12% 131 14298 0.12% 132 15220 0.13% 133 15437 0.13% 134 16086 0.13% 135 16684 0.14% 136 17309 0.14% 137 17480 0.14% 138 17844 0.15% 139 18842 0.16% 140 18922 0.16% 141 19558 0.16% 142 20261 0.17% 143 20731 0.17% 144 21650 0.18% 145 22177 0.18% 146 22652 0.19% 147 23080 0.19% 148 23505 0.19% 149 23670 0.20% 150 24728 0.20% 151 11451460 94.49% 12119114 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.89 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=72.05 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=2.0 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=27 prefix-density=1.07 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=103.15 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=15.8 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCAG SRR12161405 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:54:39 Started mapping on | Feb 13 20:54:39 Finished on | Feb 13 20:55:49 Mapping speed, Million of reads per hour | 623.27 Number of input reads | 12119114 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11310667 Uniquely mapped reads % | 93.33% Average mapped length | 298.58 Number of splices: Total | 10921740 Number of splices: Annotated (sjdb) | 10718040 Number of splices: GT/AG | 10697956 Number of splices: GC/AG | 188410 Number of splices: AT/AC | 7773 Number of splices: Non-canonical | 27601 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321726 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 60287 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.37% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 486721 486721 486721 N_multimapping 321726 321726 321726 N_noFeature 319376 11191582 359643 N_ambiguous 167391 513 88248 UnstrandedReadsAssigned:10823900 PositiveStrandReadsAssigned:118572 NegativeStrandReadsAssigned:10862776 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161405 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161405-trimmed-pair1.fastq SRR12161405-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,119,114 reads, 10,993,801 reads pseudoaligned [quant] estimated average fragment length: 276.733 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,001 rounds 52401 SRR12161405.ke.tsv 34699 SRR12161405.se.tsv 87100 total ==> SRR12161405.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.27 218 10.2547 Potri.005G024800.1.v4.1 1035 759.267 108 11.6576 Potri.004G059700.1.v4.1 961 685.407 13 1.55445 Potri.007G009000.2.v4.1 1416 1140.27 0 0 Potri.003G141000.2.v4.1 2943 2667.27 252 7.7431 Potri.016G087400.1.v4.1 270 72.6041 780 880.469 Potri.015G069301.1.v4.1 564 303.477 0 0 Potri.010G195200.1.v4.1 1773 1497.27 4 0.218948 Potri.012G127500.1.v4.1 977 701.344 1188 138.825 ==> SRR12161405.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 206 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12161405 completed mapping pipeline successfully