Starting /dee2/code/volunteer_pipeline.sh SRR12161406 current disk space = 3088895537152 free memory = 1486978476 SRR12161406 SRAfilesize be6066ec3ad4c4b7c2acc6351d20a3cc SRR12161406.sra SRR12161406.sra file validated SRR12161406 is paired end SRR12161406 is conventional basespace SRR12161406 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161406_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5945 37.0 37.0 37.0 37.0 37.0 2 36.4375 37.0 37.0 37.0 37.0 37.0 3 36.553 37.0 37.0 37.0 37.0 37.0 4 36.538 37.0 37.0 37.0 37.0 37.0 5 36.577 37.0 37.0 37.0 37.0 37.0 6 36.5965 37.0 37.0 37.0 37.0 37.0 7 36.569 37.0 37.0 37.0 37.0 37.0 8 36.5385 37.0 37.0 37.0 37.0 37.0 9 36.469 37.0 37.0 37.0 37.0 37.0 10-14 36.5508 37.0 37.0 37.0 37.0 37.0 15-19 36.552800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5302 37.0 37.0 37.0 37.0 37.0 25-29 36.4726 37.0 37.0 37.0 37.0 37.0 30-34 36.444100000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4457 37.0 37.0 37.0 37.0 37.0 40-44 36.376400000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.420399999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.393100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.376200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.35770000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.279199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3178 37.0 37.0 37.0 37.0 37.0 75-79 36.2963 37.0 37.0 37.0 37.0 37.0 80-84 36.302800000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.237300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.32459999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.213499999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1928 37.0 37.0 37.0 37.0 37.0 105-109 36.083200000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.157599999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1913 37.0 37.0 37.0 37.0 37.0 120-124 36.0866 37.0 37.0 37.0 37.0 37.0 125-129 36.0346 37.0 37.0 37.0 37.0 37.0 130-134 36.0555 37.0 37.0 37.0 37.0 37.0 135-139 36.0108 37.0 37.0 37.0 37.0 37.0 140-144 35.925599999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.8829 37.0 37.0 37.0 37.0 37.0 150-151 35.82175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 1.0 25 7.0 26 3.0 27 6.0 28 12.0 29 13.0 30 28.0 31 37.0 32 49.0 33 84.0 34 103.0 35 289.0 36 2923.0 37 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.625 11.95 6.4 35.025 2 20.875 12.15 32.775 34.2 3 17.974999999999998 16.025 29.099999999999998 36.9 4 19.825 24.275 24.625 31.275 5 22.75 31.125000000000004 23.175 22.95 6 22.575 35.0 21.975 20.45 7 15.375 26.674999999999997 41.75 16.2 8 18.3 25.974999999999998 30.7 25.025 9 18.6 24.7 34.125 22.575 10-14 20.165 29.645 27.22 22.97 15-19 20.01 28.22 27.52 24.25 20-24 20.575 28.325 27.63 23.47 25-29 20.14 28.005000000000003 27.644999999999996 24.21 30-34 19.900000000000002 28.720000000000002 27.27 24.11 35-39 20.200000000000003 28.439999999999998 27.200000000000003 24.16 40-44 20.075000000000003 28.565 27.16 24.2 45-49 20.65 28.53 27.045 23.775 50-54 20.53 28.405 27.155 23.91 55-59 20.47 28.165000000000003 27.395000000000003 23.97 60-64 20.515 27.944999999999997 27.279999999999998 24.26 65-69 20.205000000000002 28.065 27.384999999999998 24.345 70-74 20.505000000000003 28.12 27.455000000000002 23.919999999999998 75-79 20.52 28.110000000000003 27.46 23.91 80-84 19.925 28.544999999999998 27.6 23.93 85-89 20.66 28.365000000000002 26.974999999999998 24.0 90-94 21.215 28.185 26.695 23.905 95-99 20.215 27.61 28.29 23.885 100-104 20.925 28.000000000000004 27.83 23.244999999999997 105-109 21.12 27.29 27.615000000000002 23.974999999999998 110-114 20.935000000000002 27.950000000000003 27.27 23.845 115-119 21.245 27.810000000000002 26.965 23.98 120-124 20.669999999999998 27.445000000000004 27.935 23.95 125-129 20.945 28.060000000000002 27.38 23.615 130-134 20.995 27.36 28.194999999999997 23.45 135-139 21.005 27.73 27.375 23.89 140-144 20.965 27.435 27.815 23.785 145-149 20.845 28.235 26.85 24.07 150-151 21.2 28.6125 26.6625 23.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 2.0 26 6.5 27 9.0 28 12.0 29 15.5 30 15.5 31 17.5 32 28.5 33 43.0 34 49.5 35 58.5 36 76.5 37 97.0 38 123.0 39 140.5 40 169.0 41 207.0 42 216.5 43 219.5 44 232.0 45 240.0 46 253.5 47 263.0 48 247.0 49 235.5 50 213.0 51 175.5 52 144.0 53 110.0 54 89.5 55 75.5 56 57.5 57 43.0 58 33.0 59 25.5 60 16.0 61 7.5 62 5.0 63 5.5 64 3.5 65 1.5 66 3.5 67 3.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.05 #Duplication Level Percentage of deduplicated Percentage of total 1 94.28495481127061 88.675 2 5.236576289207869 9.85 3 0.3721424774056353 1.05 4 0.07974481658692185 0.3 5 0.026581605528973953 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 2.125 0.0 0.0 0.0 0.0 136-137 2.3375 0.0 0.0 0.0 0.0 138-139 2.6624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCTTT 10 0.006830828 145.0 1 GCTCCAC 10 0.006830828 145.0 5 CTTTGCA 10 0.006830828 145.0 4 >>END_MODULE SRR12161406 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161406_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0255 37.0 37.0 37.0 37.0 37.0 2 35.6245 37.0 37.0 37.0 37.0 37.0 3 35.768 37.0 37.0 37.0 37.0 37.0 4 35.821 37.0 37.0 37.0 37.0 37.0 5 36.018 37.0 37.0 37.0 37.0 37.0 6 36.1255 37.0 37.0 37.0 37.0 37.0 7 35.94 37.0 37.0 37.0 37.0 37.0 8 36.0945 37.0 37.0 37.0 37.0 37.0 9 35.9985 37.0 37.0 37.0 37.0 37.0 10-14 36.042699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.0144 37.0 37.0 37.0 37.0 37.0 20-24 35.9495 37.0 37.0 37.0 37.0 37.0 25-29 35.9512 37.0 37.0 37.0 37.0 37.0 30-34 35.9106 37.0 37.0 37.0 37.0 37.0 35-39 35.8055 37.0 37.0 37.0 37.0 37.0 40-44 35.8978 37.0 37.0 37.0 37.0 37.0 45-49 35.859899999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.8489 37.0 37.0 37.0 37.0 37.0 55-59 35.7927 37.0 37.0 37.0 37.0 37.0 60-64 35.7539 37.0 37.0 37.0 37.0 37.0 65-69 35.802299999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.690599999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.557100000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.639599999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.6314 37.0 37.0 37.0 37.0 37.0 90-94 35.60359999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.5729 37.0 37.0 37.0 37.0 37.0 100-104 35.5287 37.0 37.0 37.0 37.0 37.0 105-109 35.5582 37.0 37.0 37.0 37.0 37.0 110-114 35.589099999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.525999999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.5032 37.0 37.0 37.0 37.0 37.0 125-129 35.3404 37.0 37.0 37.0 34.6 37.0 130-134 35.317899999999995 37.0 37.0 37.0 32.2 37.0 135-139 35.3298 37.0 37.0 37.0 37.0 37.0 140-144 35.221199999999996 37.0 37.0 37.0 29.8 37.0 145-149 35.308400000000006 37.0 37.0 37.0 32.2 37.0 150-151 34.7945 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 7.0 16 4.0 17 3.0 18 3.0 19 2.0 20 2.0 21 1.0 22 4.0 23 4.0 24 9.0 25 13.0 26 10.0 27 10.0 28 22.0 29 18.0 30 37.0 31 61.0 32 83.0 33 124.0 34 223.0 35 620.0 36 2543.0 37 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.75 25.1 9.4 22.75 2 29.175 27.1 27.375 16.35 3 21.425 28.799999999999997 31.474999999999998 18.3 4 23.05 33.925 24.725 18.3 5 24.4 38.125 20.375 17.1 6 22.525000000000002 38.125 20.7 18.65 7 20.7 21.925 37.724999999999994 19.650000000000002 8 22.15 26.974999999999998 27.175 23.7 9 22.475 24.925 28.725 23.875 10-14 23.39 29.154999999999998 26.195 21.26 15-19 23.685000000000002 28.255000000000003 26.87 21.19 20-24 22.785 28.610000000000003 27.415 21.19 25-29 23.11 28.665000000000003 27.389999999999997 20.835 30-34 23.535 28.215 27.544999999999998 20.705000000000002 35-39 23.455000000000002 28.04 27.265 21.240000000000002 40-44 23.48 27.839999999999996 27.925 20.755000000000003 45-49 23.669999999999998 27.61 27.384999999999998 21.335 50-54 23.36 27.544999999999998 27.884999999999998 21.21 55-59 23.400000000000002 27.584999999999997 27.284999999999997 21.73 60-64 23.345 27.705000000000002 27.63 21.32 65-69 23.515 27.975 27.175 21.335 70-74 23.580000000000002 27.650000000000002 27.389999999999997 21.38 75-79 23.47 27.555000000000003 27.189999999999998 21.785 80-84 23.669999999999998 28.17 26.825 21.335 85-89 23.765 28.23 26.31 21.695 90-94 24.0 27.955000000000002 27.005000000000003 21.04 95-99 24.47 28.055000000000003 26.700000000000003 20.775 100-104 23.61 27.944999999999997 27.700000000000003 20.745 105-109 24.060000000000002 28.015 26.71 21.215 110-114 23.945 28.199999999999996 26.86 20.995 115-119 24.19 27.169999999999998 27.61 21.029999999999998 120-124 24.66 27.72 26.919999999999998 20.7 125-129 24.575 28.199999999999996 27.139999999999997 20.085 130-134 25.224999999999998 26.935 26.955000000000002 20.885 135-139 24.445 27.62 27.1 20.835 140-144 24.635 27.925 26.935 20.505000000000003 145-149 25.019999999999996 27.46 26.805 20.715 150-151 25.112499999999997 26.650000000000002 26.937499999999996 21.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 1.5 7 1.5 8 0.0 9 0.5 10 0.5 11 1.0 12 1.5 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 2.0 24 2.0 25 1.0 26 2.0 27 4.5 28 5.0 29 6.0 30 13.0 31 16.0 32 19.5 33 37.0 34 49.5 35 56.5 36 74.5 37 100.0 38 124.0 39 153.0 40 186.5 41 220.5 42 237.5 43 240.0 44 255.5 45 253.0 46 260.0 47 268.5 48 239.0 49 221.5 50 197.0 51 146.0 52 118.0 53 105.5 54 94.5 55 75.0 56 48.5 57 32.5 58 24.5 59 23.5 60 18.0 61 14.5 62 10.5 63 5.5 64 4.0 65 1.5 66 0.0 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.5 73 1.5 74 1.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 1.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.7410358565737 89.17500000000001 2 4.648074369189907 8.75 3 0.4249667994687915 1.2 4 0.10624169986719788 0.4 5 0.02656042496679947 0.125 6 0.0 0.0 7 0.05312084993359894 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.48750000000000004 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.4874999999999998 0.0 0.0 0.0 0.0 130-131 1.6375 0.0 0.0 0.0 0.0 132-133 1.7999999999999998 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCAA 10 0.006830828 145.0 9 TCTCTCA 10 0.006830828 145.0 8 ATCAACC 10 0.006830828 145.0 2 >>END_MODULE Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805975 spots for SRR12161406.sra Written 805975 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra Read 805969 spots for SRR12161406.sra Written 805969 spots for SRR12161406.sra SRR ids: ['SRR12161406.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zzi6o19n SRR12161406.sra spots: 16119386 blocks: [[1, 805969], [805970, 1611938], [1611939, 2417907], [2417908, 3223876], [3223877, 4029845], [4029846, 4835814], [4835815, 5641783], [5641784, 6447752], [6447753, 7253721], [7253722, 8059690], [8059691, 8865659], [8865660, 9671628], [9671629, 10477597], [10477598, 11283566], [11283567, 12089535], [12089536, 12895504], [12895505, 13701473], [13701474, 14507442], [14507443, 15313411], [15313412, 16119386]] SRR12161406 file size 5456372 SRR12161406 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161406 SRR12161406_1.fastq SRR12161406_2.fastq Input file: SRR12161406_1.fastq Paired file: SRR12161406_2.fastq trimmed: SRR12161406-trimmed-pair1.fastq, SRR12161406-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:41:59 2025 >> started Thu Feb 13 16:42:17 2025 >> done (18.039s) 16119386 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 4731 ( 0.03%) empty read pairs filtered out after trimming by size control 16114634 (99.97%) read pairs available; of these: 840572 ( 5.22%) trimmed read pairs available after processing 15274062 (94.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 5 0.00% 21 10 0.00% 22 10 0.00% 23 13 0.00% 24 7 0.00% 25 16 0.00% 26 9 0.00% 27 24 0.00% 28 17 0.00% 29 13 0.00% 30 13 0.00% 31 7 0.00% 32 18 0.00% 33 9 0.00% 34 9 0.00% 35 28 0.00% 36 16 0.00% 37 16 0.00% 38 10 0.00% 39 15 0.00% 40 12 0.00% 41 7 0.00% 42 20 0.00% 43 14 0.00% 44 26 0.00% 45 13 0.00% 46 16 0.00% 47 20 0.00% 48 14 0.00% 49 25 0.00% 50 24 0.00% 51 19 0.00% 52 29 0.00% 53 28 0.00% 54 29 0.00% 55 28 0.00% 56 27 0.00% 57 47 0.00% 58 41 0.00% 59 47 0.00% 60 60 0.00% 61 43 0.00% 62 61 0.00% 63 83 0.00% 64 89 0.00% 65 92 0.00% 66 83 0.00% 67 95 0.00% 68 101 0.00% 69 129 0.00% 70 127 0.00% 71 174 0.00% 72 169 0.00% 73 203 0.00% 74 218 0.00% 75 255 0.00% 76 275 0.00% 77 291 0.00% 78 381 0.00% 79 371 0.00% 80 414 0.00% 81 487 0.00% 82 618 0.00% 83 651 0.00% 84 738 0.00% 85 761 0.00% 86 855 0.01% 87 945 0.01% 88 1041 0.01% 89 1153 0.01% 90 1327 0.01% 91 1457 0.01% 92 1659 0.01% 93 1888 0.01% 94 2009 0.01% 95 2279 0.01% 96 2473 0.02% 97 2537 0.02% 98 2683 0.02% 99 3064 0.02% 100 3232 0.02% 101 3683 0.02% 102 3995 0.02% 103 4323 0.03% 104 4649 0.03% 105 4942 0.03% 106 5169 0.03% 107 5588 0.03% 108 5903 0.04% 109 6316 0.04% 110 6619 0.04% 111 6990 0.04% 112 7399 0.05% 113 8070 0.05% 114 8514 0.05% 115 9164 0.06% 116 9310 0.06% 117 10271 0.06% 118 10371 0.06% 119 10646 0.07% 120 11624 0.07% 121 12127 0.08% 122 12534 0.08% 123 13428 0.08% 124 14289 0.09% 125 14456 0.09% 126 15310 0.10% 127 15690 0.10% 128 16297 0.10% 129 17111 0.11% 130 17416 0.11% 131 18068 0.11% 132 18785 0.12% 133 20117 0.12% 134 20921 0.13% 135 21553 0.13% 136 22369 0.14% 137 22625 0.14% 138 23018 0.14% 139 23984 0.15% 140 24480 0.15% 141 25612 0.16% 142 26569 0.16% 143 27414 0.17% 144 28647 0.18% 145 29757 0.18% 146 30120 0.19% 147 30714 0.19% 148 31384 0.19% 149 32201 0.20% 150 33705 0.21% 151 15274062 94.78% 16114634 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=0.92 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=107.21 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=14.4 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=11 prefix-density=1.53 prefix-fanout=1.6 sequence=ATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=24.45 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.4 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR12161406 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:42:58 Started mapping on | Feb 13 16:42:58 Finished on | Feb 13 16:44:47 Mapping speed, Million of reads per hour | 532.23 Number of input reads | 16114634 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14912869 Uniquely mapped reads % | 92.54% Average mapped length | 298.66 Number of splices: Total | 15117043 Number of splices: Annotated (sjdb) | 14814512 Number of splices: GT/AG | 14795347 Number of splices: GC/AG | 271581 Number of splices: AT/AC | 11974 Number of splices: Non-canonical | 38141 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440278 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 127075 % of reads mapped to too many loci | 0.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 761487 761487 761487 N_multimapping 440278 440278 440278 N_noFeature 423562 14741650 475697 N_ambiguous 232900 865 113259 UnstrandedReadsAssigned:14256407 PositiveStrandReadsAssigned:170354 NegativeStrandReadsAssigned:14323913 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161406 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161406-trimmed-pair1.fastq SRR12161406-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,114,634 reads, 14,578,152 reads pseudoaligned [quant] estimated average fragment length: 271.046 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,008 rounds 52401 SRR12161406.ke.tsv 34699 SRR12161406.se.tsv 87100 total ==> SRR12161406.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.95 344 11.7027 Potri.005G024800.1.v4.1 1035 764.954 376 29.2287 Potri.004G059700.1.v4.1 961 691.106 24 2.06502 Potri.007G009000.2.v4.1 1416 1145.95 0 0 Potri.003G141000.2.v4.1 2943 2672.95 420.278 9.34978 Potri.016G087400.1.v4.1 270 71.4539 740 615.832 Potri.015G069301.1.v4.1 564 307.789 0 0 Potri.010G195200.1.v4.1 1773 1502.95 3 0.118695 Potri.012G127500.1.v4.1 977 707.026 724 60.8919 ==> SRR12161406.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 149 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR12161406 completed mapping pipeline successfully