Starting /dee2/code/volunteer_pipeline.sh SRR12161407 current disk space = 3088685375488 free memory = 1582585820 SRR12161407 SRAfilesize c17948c4f167fef7066e837e3e10d6f7 SRR12161407.sra SRR12161407.sra file validated SRR12161407 is paired end SRR12161407 is conventional basespace SRR12161407 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161407_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42425 37.0 37.0 37.0 37.0 37.0 2 36.2905 37.0 37.0 37.0 37.0 37.0 3 36.4725 37.0 37.0 37.0 37.0 37.0 4 36.522 37.0 37.0 37.0 37.0 37.0 5 36.6115 37.0 37.0 37.0 37.0 37.0 6 36.5025 37.0 37.0 37.0 37.0 37.0 7 36.4515 37.0 37.0 37.0 37.0 37.0 8 36.542 37.0 37.0 37.0 37.0 37.0 9 36.427 37.0 37.0 37.0 37.0 37.0 10-14 36.5146 37.0 37.0 37.0 37.0 37.0 15-19 36.449299999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4367 37.0 37.0 37.0 37.0 37.0 25-29 36.42 37.0 37.0 37.0 37.0 37.0 30-34 36.4005 37.0 37.0 37.0 37.0 37.0 35-39 36.3553 37.0 37.0 37.0 37.0 37.0 40-44 36.3424 37.0 37.0 37.0 37.0 37.0 45-49 36.3389 37.0 37.0 37.0 37.0 37.0 50-54 36.275600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2761 37.0 37.0 37.0 37.0 37.0 60-64 36.2649 37.0 37.0 37.0 37.0 37.0 65-69 36.263799999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.243700000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2031 37.0 37.0 37.0 37.0 37.0 80-84 36.2077 37.0 37.0 37.0 37.0 37.0 85-89 36.20290000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.27669999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.180099999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2099 37.0 37.0 37.0 37.0 37.0 105-109 36.047399999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.0952 37.0 37.0 37.0 37.0 37.0 115-119 36.01709999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.040800000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9735 37.0 37.0 37.0 37.0 37.0 130-134 35.957300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.8782 37.0 37.0 37.0 37.0 37.0 140-144 35.834700000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.777 37.0 37.0 37.0 37.0 37.0 150-151 35.743 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 1.0 25 1.0 26 5.0 27 9.0 28 10.0 29 19.0 30 24.0 31 45.0 32 75.0 33 81.0 34 138.0 35 303.0 36 2903.0 37 383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.88722180545136 11.227806951737934 6.301575393848462 33.58339584896224 2 20.5 11.825 33.125 34.55 3 17.424999999999997 16.400000000000002 29.325000000000003 36.85 4 20.4 23.925 25.275 30.4 5 22.425 30.0 24.6 22.975 6 22.05 32.7 23.0 22.25 7 16.900000000000002 27.450000000000003 39.45 16.2 8 18.125 26.55 31.5 23.825 9 18.85 24.875 33.75 22.525000000000002 10-14 20.445 28.83 27.3 23.425 15-19 20.345 28.28 27.58 23.794999999999998 20-24 20.625 27.655 27.915 23.805 25-29 20.87 28.055000000000003 27.3 23.775 30-34 20.200000000000003 28.24 27.66 23.9 35-39 19.905 28.549999999999997 27.575 23.97 40-44 20.535 28.175 27.395000000000003 23.895 45-49 20.294999999999998 29.04 26.86 23.805 50-54 20.97 29.075 26.82 23.135 55-59 20.305 28.64 27.474999999999998 23.580000000000002 60-64 19.994999999999997 28.455000000000002 27.245 24.305 65-69 20.275000000000002 29.23 26.71 23.785 70-74 20.45 28.22 27.41 23.919999999999998 75-79 20.015 28.310000000000002 27.705000000000002 23.97 80-84 19.685 28.494999999999997 27.58 24.240000000000002 85-89 20.7 27.73 27.284999999999997 24.285 90-94 20.424999999999997 27.425 27.85 24.3 95-99 20.615 28.43 27.224999999999998 23.73 100-104 20.49 28.22 27.065 24.224999999999998 105-109 20.91 27.725 27.634999999999998 23.73 110-114 21.02 27.029999999999998 28.050000000000004 23.9 115-119 20.775 27.96 27.36 23.905 120-124 21.14 27.250000000000004 27.295 24.315 125-129 20.995 27.6 27.08 24.325 130-134 20.979999999999997 27.555000000000003 27.339999999999996 24.125 135-139 21.47 27.389999999999997 27.439999999999998 23.7 140-144 21.235 27.334999999999997 27.43 24.0 145-149 21.335 28.255000000000003 27.485 22.925 150-151 21.1875 27.725 26.5625 24.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 2.5 22 2.5 23 3.5 24 4.0 25 6.0 26 5.5 27 3.5 28 7.0 29 11.0 30 13.5 31 22.5 32 33.0 33 44.5 34 58.0 35 70.5 36 79.5 37 86.0 38 113.5 39 144.5 40 164.5 41 183.5 42 200.5 43 221.5 44 245.0 45 250.0 46 254.5 47 256.5 48 242.0 49 238.5 50 224.0 51 183.5 52 151.0 53 127.0 54 94.5 55 65.0 56 46.5 57 35.5 58 25.0 59 21.0 60 17.0 61 10.5 62 6.0 63 3.0 64 2.0 65 4.5 66 5.5 67 3.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.43266171792153 89.05 2 5.143160127253447 9.700000000000001 3 0.3711558854718982 1.05 4 0.05302226935312832 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.175 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.3875000000000002 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.6375000000000002 0.0 0.0 0.0 0.0 134-135 1.85 0.0 0.0 0.0 0.0 136-137 2.1625 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGTAA 10 0.006830828 145.0 7 >>END_MODULE SRR12161407 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161407_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1065 37.0 37.0 37.0 37.0 37.0 2 35.8135 37.0 37.0 37.0 37.0 37.0 3 35.796 37.0 37.0 37.0 37.0 37.0 4 35.9085 37.0 37.0 37.0 37.0 37.0 5 35.951 37.0 37.0 37.0 37.0 37.0 6 36.0475 37.0 37.0 37.0 37.0 37.0 7 35.834 37.0 37.0 37.0 37.0 37.0 8 36.03 37.0 37.0 37.0 37.0 37.0 9 36.001 37.0 37.0 37.0 37.0 37.0 10-14 35.9945 37.0 37.0 37.0 37.0 37.0 15-19 36.00599999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.0293 37.0 37.0 37.0 37.0 37.0 25-29 35.9115 37.0 37.0 37.0 37.0 37.0 30-34 35.9066 37.0 37.0 37.0 37.0 37.0 35-39 35.886 37.0 37.0 37.0 37.0 37.0 40-44 35.81850000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.7412 37.0 37.0 37.0 37.0 37.0 50-54 35.818 37.0 37.0 37.0 37.0 37.0 55-59 35.75970000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.7144 37.0 37.0 37.0 37.0 37.0 65-69 35.7779 37.0 37.0 37.0 37.0 37.0 70-74 35.6657 37.0 37.0 37.0 37.0 37.0 75-79 35.708000000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.7457 37.0 37.0 37.0 37.0 37.0 85-89 35.725 37.0 37.0 37.0 37.0 37.0 90-94 35.5785 37.0 37.0 37.0 37.0 37.0 95-99 35.5984 37.0 37.0 37.0 37.0 37.0 100-104 35.6345 37.0 37.0 37.0 37.0 37.0 105-109 35.571600000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5338 37.0 37.0 37.0 37.0 37.0 115-119 35.568 37.0 37.0 37.0 37.0 37.0 120-124 35.5715 37.0 37.0 37.0 37.0 37.0 125-129 35.4385 37.0 37.0 37.0 37.0 37.0 130-134 35.3004 37.0 37.0 37.0 34.6 37.0 135-139 35.43429999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.3083 37.0 37.0 37.0 32.2 37.0 145-149 35.312 37.0 37.0 37.0 34.6 37.0 150-151 34.79175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 7.0 15 0.0 16 2.0 17 1.0 18 2.0 19 2.0 20 2.0 21 2.0 22 8.0 23 10.0 24 10.0 25 10.0 26 8.0 27 15.0 28 18.0 29 17.0 30 42.0 31 46.0 32 78.0 33 138.0 34 257.0 35 578.0 36 2501.0 37 244.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.300000000000004 26.400000000000002 8.1 20.200000000000003 2 30.725 26.1 25.724999999999998 17.45 3 21.25 28.1 32.2 18.45 4 24.099999999999998 34.949999999999996 23.849999999999998 17.1 5 26.075 34.925 21.15 17.849999999999998 6 21.325 39.625 20.849999999999998 18.2 7 21.9 23.799999999999997 35.55 18.75 8 21.875 26.974999999999998 26.55 24.6 9 22.475 24.349999999999998 29.925 23.25 10-14 23.835 29.475 25.869999999999997 20.82 15-19 23.419999999999998 28.49 26.915 21.175 20-24 23.335 29.215000000000003 26.52 20.93 25-29 23.115 28.985 26.575 21.325 30-34 23.59 28.505000000000003 27.125 20.78 35-39 23.435 27.155 28.02 21.39 40-44 23.385 27.51 27.785 21.32 45-49 23.765 27.689999999999998 27.74 20.805 50-54 22.97 28.055000000000003 27.560000000000002 21.415 55-59 23.665 27.365000000000002 27.49 21.48 60-64 23.57 28.535 26.905 20.990000000000002 65-69 23.3 27.63 27.089999999999996 21.98 70-74 23.544999999999998 28.205000000000002 26.96 21.29 75-79 23.105 27.700000000000003 27.36 21.834999999999997 80-84 23.31 28.02 27.115000000000002 21.555 85-89 23.685000000000002 27.534999999999997 26.724999999999998 22.055 90-94 24.22 27.685 26.955000000000002 21.14 95-99 23.955000000000002 27.505000000000003 27.834999999999997 20.705000000000002 100-104 23.974999999999998 27.400000000000002 27.125 21.5 105-109 23.84 27.639999999999997 27.665 20.855 110-114 24.19 27.805000000000003 27.060000000000002 20.945 115-119 24.095 27.685 27.13 21.09 120-124 24.415 27.925 27.095000000000002 20.565 125-129 23.849999999999998 27.794999999999998 27.189999999999998 21.165 130-134 23.98 27.735 27.825 20.46 135-139 24.735 27.534999999999997 27.16 20.57 140-144 24.09 27.625 27.815 20.47 145-149 24.86 27.495000000000005 26.895000000000003 20.75 150-151 24.7375 27.212500000000002 27.0 21.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 1.0 5 2.0 6 1.5 7 1.0 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 0.5 19 1.0 20 2.0 21 1.5 22 1.5 23 1.0 24 1.5 25 3.0 26 5.0 27 5.5 28 7.0 29 8.5 30 7.0 31 13.0 32 19.0 33 24.5 34 39.5 35 60.0 36 72.5 37 95.0 38 132.5 39 163.5 40 183.0 41 204.0 42 226.0 43 247.0 44 263.0 45 268.0 46 275.0 47 252.0 48 224.0 49 211.5 50 190.0 51 159.0 52 129.0 53 104.0 54 83.5 55 73.0 56 56.5 57 39.5 58 29.5 59 26.5 60 22.5 61 14.5 62 10.0 63 6.5 64 4.5 65 4.0 66 2.0 67 0.5 68 0.5 69 0.0 70 1.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.025 #Duplication Level Percentage of deduplicated Percentage of total 1 94.68226535495879 89.025 2 4.812549853762297 9.049999999999999 3 0.3190640787024727 0.8999999999999999 4 0.07976601967561818 0.3 5 0.0 0.0 6 0.0 0.0 7 0.07976601967561818 0.525 8 0.026588673225206066 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCT 8 0.2 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.175 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.6124999999999998 0.0 0.0 0.0 0.0 134-135 1.825 0.0 0.0 0.0 0.0 136-137 2.0875 0.0 0.0 0.0 0.0 138-139 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGTGC 10 0.006830828 145.0 6 >>END_MODULE Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617472 spots for SRR12161407.sra Written 617472 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra Read 617470 spots for SRR12161407.sra Written 617470 spots for SRR12161407.sra SRR ids: ['SRR12161407.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_33dbt9np SRR12161407.sra spots: 12349402 blocks: [[1, 617470], [617471, 1234940], [1234941, 1852410], [1852411, 2469880], [2469881, 3087350], [3087351, 3704820], [3704821, 4322290], [4322291, 4939760], [4939761, 5557230], [5557231, 6174700], [6174701, 6792170], [6792171, 7409640], [7409641, 8027110], [8027111, 8644580], [8644581, 9262050], [9262051, 9879520], [9879521, 10496990], [10496991, 11114460], [11114461, 11731930], [11731931, 12349402]] SRR12161407 file size 4175166 SRR12161407 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161407 SRR12161407_1.fastq SRR12161407_2.fastq Input file: SRR12161407_1.fastq Paired file: SRR12161407_2.fastq trimmed: SRR12161407-trimmed-pair1.fastq, SRR12161407-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:16:45 2025 >> started Thu Feb 13 17:17:00 2025 >> done (14.543s) 12349402 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 15024 ( 0.12%) empty read pairs filtered out after trimming by size control 12334367 (99.88%) read pairs available; of these: 616176 ( 5.00%) trimmed read pairs available after processing 11718191 (95.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 5 0.00% 21 5 0.00% 22 4 0.00% 23 10 0.00% 24 6 0.00% 25 11 0.00% 26 10 0.00% 27 12 0.00% 28 14 0.00% 29 14 0.00% 30 20 0.00% 31 13 0.00% 32 16 0.00% 33 15 0.00% 34 14 0.00% 35 19 0.00% 36 11 0.00% 37 17 0.00% 38 11 0.00% 39 6 0.00% 40 15 0.00% 41 21 0.00% 42 12 0.00% 43 12 0.00% 44 12 0.00% 45 25 0.00% 46 10 0.00% 47 21 0.00% 48 16 0.00% 49 20 0.00% 50 28 0.00% 51 28 0.00% 52 31 0.00% 53 25 0.00% 54 28 0.00% 55 39 0.00% 56 43 0.00% 57 31 0.00% 58 36 0.00% 59 30 0.00% 60 44 0.00% 61 60 0.00% 62 47 0.00% 63 68 0.00% 64 72 0.00% 65 74 0.00% 66 100 0.00% 67 94 0.00% 68 87 0.00% 69 121 0.00% 70 123 0.00% 71 130 0.00% 72 169 0.00% 73 154 0.00% 74 212 0.00% 75 210 0.00% 76 248 0.00% 77 275 0.00% 78 297 0.00% 79 362 0.00% 80 379 0.00% 81 445 0.00% 82 482 0.00% 83 546 0.00% 84 635 0.01% 85 700 0.01% 86 766 0.01% 87 818 0.01% 88 886 0.01% 89 938 0.01% 90 1093 0.01% 91 1282 0.01% 92 1259 0.01% 93 1446 0.01% 94 1725 0.01% 95 1845 0.01% 96 2012 0.02% 97 2083 0.02% 98 2393 0.02% 99 2428 0.02% 100 2594 0.02% 101 2929 0.02% 102 3025 0.02% 103 3375 0.03% 104 3621 0.03% 105 3940 0.03% 106 4157 0.03% 107 4266 0.03% 108 4469 0.04% 109 4739 0.04% 110 5106 0.04% 111 5379 0.04% 112 5670 0.05% 113 5970 0.05% 114 6437 0.05% 115 6834 0.06% 116 7160 0.06% 117 7347 0.06% 118 7648 0.06% 119 7918 0.06% 120 8504 0.07% 121 8888 0.07% 122 9200 0.07% 123 9831 0.08% 124 10420 0.08% 125 10589 0.09% 126 11153 0.09% 127 11558 0.09% 128 12012 0.10% 129 12461 0.10% 130 12691 0.10% 131 13133 0.11% 132 13676 0.11% 133 14340 0.12% 134 14985 0.12% 135 15620 0.13% 136 16135 0.13% 137 16479 0.13% 138 16589 0.13% 139 17677 0.14% 140 17514 0.14% 141 18675 0.15% 142 18755 0.15% 143 19709 0.16% 144 20414 0.17% 145 21205 0.17% 146 21708 0.18% 147 22065 0.18% 148 22703 0.18% 149 23220 0.19% 150 23854 0.19% 151 11718191 95.00% 12334367 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.82 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=50.19 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=2.2 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=21 prefix-density=1.02 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=55.22 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.8 sequence=ACACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAG SRR12161407 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:17:44 Started mapping on | Feb 13 17:17:44 Finished on | Feb 13 17:19:18 Mapping speed, Million of reads per hour | 472.38 Number of input reads | 12334367 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11215816 Uniquely mapped reads % | 90.93% Average mapped length | 298.73 Number of splices: Total | 11240470 Number of splices: Annotated (sjdb) | 11030320 Number of splices: GT/AG | 11006565 Number of splices: GC/AG | 198498 Number of splices: AT/AC | 8354 Number of splices: Non-canonical | 27053 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311782 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 128497 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 806769 806769 806769 N_multimapping 311782 311782 311782 N_noFeature 323640 11067524 360202 N_ambiguous 191618 723 79456 UnstrandedReadsAssigned:10700558 PositiveStrandReadsAssigned:147569 NegativeStrandReadsAssigned:10776158 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161407 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161407-trimmed-pair1.fastq SRR12161407-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,334,367 reads, 10,958,943 reads pseudoaligned [quant] estimated average fragment length: 283.2 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR12161407.ke.tsv 34699 SRR12161407.se.tsv 87100 total ==> SRR12161407.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.8 212 9.35831 Potri.005G024800.1.v4.1 1035 752.8 252 25.6497 Potri.004G059700.1.v4.1 961 679.003 50 5.64234 Potri.007G009000.2.v4.1 1416 1133.8 0 0 Potri.003G141000.2.v4.1 2943 2660.8 236 6.79612 Potri.016G087400.1.v4.1 270 72.1818 480 509.535 Potri.015G069301.1.v4.1 564 300.043 0 0 Potri.010G195200.1.v4.1 1773 1490.8 4 0.20559 Potri.012G127500.1.v4.1 977 694.905 533 58.7709 ==> SRR12161407.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 69 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 176 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR12161407 completed mapping pipeline successfully