Starting /dee2/code/volunteer_pipeline.sh SRR12161408 current disk space = 3088076242944 free memory = 1405713200 SRR12161408 SRAfilesize 78175151056c7ce7df1f0ad740637086 SRR12161408.sra SRR12161408.sra file validated SRR12161408 is paired end SRR12161408 is conventional basespace SRR12161408 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161408_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.589 37.0 37.0 37.0 37.0 37.0 2 36.4405 37.0 37.0 37.0 37.0 37.0 3 36.571 37.0 37.0 37.0 37.0 37.0 4 36.4905 37.0 37.0 37.0 37.0 37.0 5 36.5675 37.0 37.0 37.0 37.0 37.0 6 36.65 37.0 37.0 37.0 37.0 37.0 7 36.5225 37.0 37.0 37.0 37.0 37.0 8 36.6025 37.0 37.0 37.0 37.0 37.0 9 36.5005 37.0 37.0 37.0 37.0 37.0 10-14 36.563599999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5198 37.0 37.0 37.0 37.0 37.0 20-24 36.537699999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.465500000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.475899999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.438599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3806 37.0 37.0 37.0 37.0 37.0 45-49 36.380900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3724 37.0 37.0 37.0 37.0 37.0 55-59 36.335899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.32280000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.323899999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.34140000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.2986 37.0 37.0 37.0 37.0 37.0 80-84 36.2931 37.0 37.0 37.0 37.0 37.0 85-89 36.2937 37.0 37.0 37.0 37.0 37.0 90-94 36.2453 37.0 37.0 37.0 37.0 37.0 95-99 36.2896 37.0 37.0 37.0 37.0 37.0 100-104 36.2062 37.0 37.0 37.0 37.0 37.0 105-109 36.1696 37.0 37.0 37.0 37.0 37.0 110-114 36.178 37.0 37.0 37.0 37.0 37.0 115-119 36.181799999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.1264 37.0 37.0 37.0 37.0 37.0 125-129 36.0947 37.0 37.0 37.0 37.0 37.0 130-134 36.061299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.958600000000004 37.0 37.0 37.0 37.0 37.0 140-144 36.007799999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.9301 37.0 37.0 37.0 37.0 37.0 150-151 35.8575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 3.0 26 2.0 27 4.0 28 13.0 29 17.0 30 26.0 31 32.0 32 47.0 33 75.0 34 120.0 35 294.0 36 2947.0 37 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.875 12.2 5.55 37.375 2 19.625 12.625 34.25 33.5 3 15.775 17.549999999999997 29.099999999999998 37.574999999999996 4 21.15 24.575 25.7 28.575 5 22.7 30.925000000000004 24.099999999999998 22.275 6 20.075000000000003 34.925 24.099999999999998 20.9 7 16.225 25.35 41.6 16.825000000000003 8 17.349999999999998 25.8 31.900000000000002 24.95 9 17.424999999999997 24.3 33.4 24.875 10-14 19.259999999999998 28.9 27.834999999999997 24.005000000000003 15-19 20.075000000000003 28.134999999999998 27.639999999999997 24.15 20-24 19.905 28.345 27.255000000000003 24.495 25-29 20.11 28.205000000000002 27.700000000000003 23.985 30-34 19.61 28.585 27.284999999999997 24.52 35-39 19.935 28.42 27.315 24.33 40-44 20.215 28.405 27.095000000000002 24.285 45-49 20.145 29.095 26.855 23.905 50-54 19.919999999999998 28.265 27.485 24.33 55-59 20.25 28.365000000000002 27.43 23.955000000000002 60-64 21.125 27.884999999999998 27.265 23.724999999999998 65-69 20.005 27.87 27.71 24.415 70-74 20.375 28.375 27.32 23.93 75-79 20.200000000000003 28.355000000000004 27.365000000000002 24.08 80-84 20.435 28.494999999999997 27.22 23.849999999999998 85-89 20.29 27.644999999999996 27.825 24.240000000000002 90-94 20.435 28.53 26.745 24.29 95-99 20.97 27.694999999999997 27.515 23.82 100-104 20.96 28.035 27.134999999999998 23.87 105-109 20.945 27.755000000000003 27.6 23.7 110-114 20.69 27.955000000000002 27.27 24.085 115-119 20.94 28.735 26.595000000000002 23.73 120-124 20.36 28.21 27.01 24.42 125-129 20.54 27.779999999999998 27.400000000000002 24.279999999999998 130-134 21.555 27.615000000000002 27.150000000000002 23.68 135-139 21.759999999999998 27.750000000000004 27.295 23.195 140-144 21.105 28.025 26.995 23.875 145-149 20.785 27.905 27.405 23.905 150-151 20.3 27.85 27.775 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 2.5 25 3.5 26 4.0 27 5.5 28 9.5 29 13.5 30 16.5 31 23.0 32 32.5 33 41.5 34 50.0 35 60.5 36 71.0 37 91.0 38 119.5 39 147.5 40 173.0 41 188.5 42 217.0 43 235.0 44 239.5 45 266.0 46 262.0 47 263.5 48 256.0 49 217.0 50 188.5 51 159.5 52 140.0 53 129.5 54 107.5 55 79.5 56 56.0 57 39.0 58 27.0 59 18.0 60 14.5 61 9.5 62 7.0 63 2.5 64 1.0 65 1.0 66 0.5 67 1.5 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 93.58803099118354 87.575 2 5.957787870691958 11.15 3 0.4541811381244991 1.275 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.05 0.0 60-61 0.0 0.0 0.0 0.05 0.0 62-63 0.0 0.0 0.0 0.05 0.0 64-65 0.0 0.0 0.0 0.05 0.0 66-67 0.0 0.0 0.0 0.05 0.0 68-69 0.0 0.0 0.0 0.05 0.0 70-71 0.0 0.0 0.0 0.05 0.0 72-73 0.0 0.0 0.0 0.05 0.0 74-75 0.0 0.0 0.0 0.05 0.0 76-77 0.0 0.0 0.0 0.05 0.0 78-79 0.0 0.0 0.0 0.05 0.0 80-81 0.0 0.0 0.0 0.05 0.0 82-83 0.0125 0.0 0.0 0.05 0.0 84-85 0.025 0.0 0.0 0.05 0.0 86-87 0.025 0.0 0.0 0.05 0.0 88-89 0.025 0.0 0.0 0.05 0.0 90-91 0.037500000000000006 0.0 0.0 0.05 0.0 92-93 0.075 0.0 0.0 0.05 0.0 94-95 0.1 0.0 0.0 0.05 0.0 96-97 0.15 0.0 0.0 0.05 0.0 98-99 0.175 0.0 0.0 0.05 0.0 100-101 0.2 0.0 0.0 0.05 0.0 102-103 0.225 0.0 0.0 0.05 0.0 104-105 0.25 0.0 0.0 0.05 0.0 106-107 0.2625 0.0 0.0 0.05 0.0 108-109 0.275 0.0 0.0 0.05 0.0 110-111 0.3125 0.0 0.0 0.05 0.0 112-113 0.35 0.0 0.0 0.05 0.0 114-115 0.3625 0.0 0.0 0.05 0.0 116-117 0.475 0.0 0.0 0.05 0.0 118-119 0.55 0.0 0.0 0.05 0.0 120-121 0.6625000000000001 0.0 0.0 0.05 0.0 122-123 0.7625 0.0 0.0 0.05 0.0 124-125 0.825 0.0 0.0 0.05 0.0 126-127 0.9125000000000001 0.0 0.0 0.05 0.0 128-129 0.975 0.0 0.0 0.05 0.0 130-131 1.1 0.0 0.0 0.05 0.0 132-133 1.2374999999999998 0.0 0.0 0.05 0.0 134-135 1.3250000000000002 0.0 0.0 0.05 0.0 136-137 1.5125000000000002 0.0 0.0 0.05 0.0 138-139 1.6375000000000002 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGATG 10 0.006830828 145.0 2 >>END_MODULE SRR12161408 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161408_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1195 37.0 37.0 37.0 37.0 37.0 2 35.759 37.0 37.0 37.0 37.0 37.0 3 36.0705 37.0 37.0 37.0 37.0 37.0 4 35.9355 37.0 37.0 37.0 37.0 37.0 5 35.9855 37.0 37.0 37.0 37.0 37.0 6 36.029 37.0 37.0 37.0 37.0 37.0 7 36.115 37.0 37.0 37.0 37.0 37.0 8 36.1785 37.0 37.0 37.0 37.0 37.0 9 36.1155 37.0 37.0 37.0 37.0 37.0 10-14 36.0901 37.0 37.0 37.0 37.0 37.0 15-19 36.0928 37.0 37.0 37.0 37.0 37.0 20-24 36.0621 37.0 37.0 37.0 37.0 37.0 25-29 36.009100000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.992200000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.9217 37.0 37.0 37.0 37.0 37.0 40-44 35.9122 37.0 37.0 37.0 37.0 37.0 45-49 35.8695 37.0 37.0 37.0 37.0 37.0 50-54 35.8752 37.0 37.0 37.0 37.0 37.0 55-59 35.8568 37.0 37.0 37.0 37.0 37.0 60-64 35.8702 37.0 37.0 37.0 37.0 37.0 65-69 35.7844 37.0 37.0 37.0 37.0 37.0 70-74 35.6924 37.0 37.0 37.0 37.0 37.0 75-79 35.765499999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.8435 37.0 37.0 37.0 37.0 37.0 85-89 35.7164 37.0 37.0 37.0 37.0 37.0 90-94 35.692 37.0 37.0 37.0 37.0 37.0 95-99 35.666399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.704499999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.673700000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5788 37.0 37.0 37.0 37.0 37.0 115-119 35.6083 37.0 37.0 37.0 37.0 37.0 120-124 35.5526 37.0 37.0 37.0 37.0 37.0 125-129 35.4551 37.0 37.0 37.0 37.0 37.0 130-134 35.3603 37.0 37.0 37.0 34.6 37.0 135-139 35.4063 37.0 37.0 37.0 37.0 37.0 140-144 35.425 37.0 37.0 37.0 34.6 37.0 145-149 35.435900000000004 37.0 37.0 37.0 37.0 37.0 150-151 34.8335 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 5.0 15 0.0 16 0.0 17 2.0 18 1.0 19 0.0 20 1.0 21 1.0 22 3.0 23 5.0 24 6.0 25 9.0 26 6.0 27 13.0 28 22.0 29 24.0 30 39.0 31 44.0 32 76.0 33 120.0 34 249.0 35 624.0 36 2555.0 37 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.75 26.200000000000003 8.774999999999999 24.275 2 28.799999999999997 26.650000000000002 29.575000000000003 14.975 3 21.325 27.675 32.324999999999996 18.675 4 22.875 35.699999999999996 23.7 17.724999999999998 5 23.575 38.625 21.25 16.55 6 21.125 40.0 21.825 17.05 7 21.6 23.35 35.525 19.525000000000002 8 20.8 26.8 28.125 24.275 9 23.025000000000002 22.875 29.299999999999997 24.8 10-14 23.135 29.125 26.965 20.775 15-19 22.575 27.915 28.175 21.335 20-24 22.665 28.335 27.67 21.33 25-29 22.945 28.65 27.685 20.72 30-34 22.919999999999998 27.88 27.975 21.224999999999998 35-39 22.355 27.575 28.494999999999997 21.575 40-44 23.53 28.02 27.560000000000002 20.89 45-49 22.965 27.875 27.935 21.224999999999998 50-54 23.225 27.46 27.82 21.495 55-59 23.345 27.474999999999998 28.255000000000003 20.925 60-64 22.685 28.01 27.935 21.37 65-69 23.599999999999998 27.3 27.455000000000002 21.645 70-74 23.244999999999997 27.705000000000002 27.005000000000003 22.045 75-79 23.335 27.12 27.515 22.03 80-84 23.555 27.775 26.91 21.759999999999998 85-89 23.419999999999998 27.529999999999998 27.3 21.75 90-94 23.175 27.800000000000004 27.52 21.505 95-99 24.01 27.41 27.655 20.925 100-104 23.925 27.915 27.400000000000002 20.76 105-109 23.815 27.834999999999997 27.505000000000003 20.845 110-114 23.695 27.97 27.075 21.26 115-119 23.745 27.675 27.24 21.34 120-124 24.07 27.375 28.134999999999998 20.419999999999998 125-129 24.235 27.48 27.185 21.099999999999998 130-134 24.005000000000003 27.625 27.37 21.0 135-139 23.835 27.105 27.735 21.325 140-144 23.61 27.589999999999996 27.48 21.32 145-149 24.505 27.83 27.084999999999997 20.580000000000002 150-151 24.762500000000003 26.487500000000004 27.925 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.5 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 2.0 26 1.5 27 6.0 28 10.5 29 10.5 30 14.0 31 20.0 32 23.0 33 32.0 34 45.5 35 66.0 36 77.5 37 98.5 38 131.0 39 155.5 40 184.5 41 204.5 42 242.5 43 265.5 44 270.0 45 273.0 46 276.5 47 261.0 48 248.5 49 220.5 50 157.5 51 140.5 52 126.5 53 100.0 54 77.5 55 66.0 56 52.5 57 39.0 58 29.0 59 17.5 60 11.0 61 5.5 62 6.5 63 4.5 64 2.0 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.96944518895738 87.64999999999999 2 5.306888233717502 9.9 3 0.5360493165371214 1.5 4 0.08040739748056822 0.3 5 0.0 0.0 6 0.08040739748056822 0.44999999999999996 7 0.0 0.0 8 0.02680246582685607 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 8 0.2 No Hit AGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATT 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit GTGTCATTCAGCTTTTATATCCCCTATTCTCTTCGTGAAGATGTCTTGCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6625000000000001 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.9125000000000001 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.1375000000000002 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.3875000000000002 0.0 0.0 0.0 0.0 136-137 1.5875 0.0 0.0 0.0 0.0 138-139 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTCAA 10 0.006830828 145.0 5 AGAGTAG 10 0.006830828 145.0 1 TTTTTTT 20 0.00593511 29.0 120-124 >>END_MODULE Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801554 spots for SRR12161408.sra Written 801554 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra Read 801538 spots for SRR12161408.sra Written 801538 spots for SRR12161408.sra SRR ids: ['SRR12161408.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ffnzggex SRR12161408.sra spots: 16030776 blocks: [[1, 801538], [801539, 1603076], [1603077, 2404614], [2404615, 3206152], [3206153, 4007690], [4007691, 4809228], [4809229, 5610766], [5610767, 6412304], [6412305, 7213842], [7213843, 8015380], [8015381, 8816918], [8816919, 9618456], [9618457, 10419994], [10419995, 11221532], [11221533, 12023070], [12023071, 12824608], [12824609, 13626146], [13626147, 14427684], [14427685, 15229222], [15229223, 16030776]] SRR12161408 file size 5426258 SRR12161408 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161408 SRR12161408_1.fastq SRR12161408_2.fastq Input file: SRR12161408_1.fastq Paired file: SRR12161408_2.fastq trimmed: SRR12161408-trimmed-pair1.fastq, SRR12161408-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:58:07 2025 >> started Thu Feb 13 20:58:26 2025 >> done (18.686s) 16030776 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 1629 ( 0.01%) empty read pairs filtered out after trimming by size control 16029137 (99.99%) read pairs available; of these: 461137 ( 2.88%) trimmed read pairs available after processing 15568000 (97.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 6 0.00% 23 3 0.00% 24 11 0.00% 25 10 0.00% 26 6 0.00% 27 11 0.00% 28 6 0.00% 29 16 0.00% 30 13 0.00% 31 16 0.00% 32 13 0.00% 33 8 0.00% 34 10 0.00% 35 9 0.00% 36 13 0.00% 37 15 0.00% 38 11 0.00% 39 13 0.00% 40 15 0.00% 41 11 0.00% 42 13 0.00% 43 16 0.00% 44 11 0.00% 45 12 0.00% 46 19 0.00% 47 28 0.00% 48 27 0.00% 49 22 0.00% 50 18 0.00% 51 23 0.00% 52 30 0.00% 53 36 0.00% 54 31 0.00% 55 31 0.00% 56 28 0.00% 57 30 0.00% 58 31 0.00% 59 38 0.00% 60 54 0.00% 61 49 0.00% 62 50 0.00% 63 73 0.00% 64 54 0.00% 65 55 0.00% 66 68 0.00% 67 85 0.00% 68 77 0.00% 69 102 0.00% 70 116 0.00% 71 159 0.00% 72 143 0.00% 73 166 0.00% 74 178 0.00% 75 214 0.00% 76 224 0.00% 77 212 0.00% 78 291 0.00% 79 315 0.00% 80 311 0.00% 81 362 0.00% 82 412 0.00% 83 453 0.00% 84 504 0.00% 85 561 0.00% 86 604 0.00% 87 686 0.00% 88 767 0.00% 89 788 0.00% 90 842 0.01% 91 1009 0.01% 92 1085 0.01% 93 1183 0.01% 94 1391 0.01% 95 1477 0.01% 96 1586 0.01% 97 1679 0.01% 98 1818 0.01% 99 1899 0.01% 100 2116 0.01% 101 2144 0.01% 102 2359 0.01% 103 2592 0.02% 104 2789 0.02% 105 2915 0.02% 106 2996 0.02% 107 3200 0.02% 108 3335 0.02% 109 3478 0.02% 110 3763 0.02% 111 3933 0.02% 112 4246 0.03% 113 4396 0.03% 114 4570 0.03% 115 4862 0.03% 116 5059 0.03% 117 5438 0.03% 118 5586 0.03% 119 5889 0.04% 120 6166 0.04% 121 6314 0.04% 122 6822 0.04% 123 7208 0.04% 124 7450 0.05% 125 7562 0.05% 126 8045 0.05% 127 8336 0.05% 128 8480 0.05% 129 8916 0.06% 130 9567 0.06% 131 9573 0.06% 132 9854 0.06% 133 10478 0.07% 134 10398 0.06% 135 11041 0.07% 136 11605 0.07% 137 12141 0.08% 138 12385 0.08% 139 12774 0.08% 140 13357 0.08% 141 13713 0.09% 142 14292 0.09% 143 14919 0.09% 144 15976 0.10% 145 16452 0.10% 146 16631 0.10% 147 16930 0.11% 148 17864 0.11% 149 18157 0.11% 150 19291 0.12% 151 15568000 97.12% 16029137 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=18 prefix-density=0.81 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=11.93 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=3.8 sequence=CAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCATTCTC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=20 prefix-density=1.04 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=43.20 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12161408 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:59:08 Started mapping on | Feb 13 20:59:08 Finished on | Feb 13 21:00:56 Mapping speed, Million of reads per hour | 534.30 Number of input reads | 16029137 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 15119918 Uniquely mapped reads % | 94.33% Average mapped length | 299.63 Number of splices: Total | 16114098 Number of splices: Annotated (sjdb) | 15811548 Number of splices: GT/AG | 15776438 Number of splices: GC/AG | 283779 Number of splices: AT/AC | 11052 Number of splices: Non-canonical | 42829 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388841 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 74581 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 520378 520378 520378 N_multimapping 388841 388841 388841 N_noFeature 444058 14908550 492805 N_ambiguous 272195 704 109113 UnstrandedReadsAssigned:14403665 PositiveStrandReadsAssigned:210664 NegativeStrandReadsAssigned:14518000 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161408 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161408-trimmed-pair1.fastq SRR12161408-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,029,137 reads, 14,607,026 reads pseudoaligned [quant] estimated average fragment length: 291.47 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52401 SRR12161408.ke.tsv 34699 SRR12161408.se.tsv 87100 total ==> SRR12161408.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.53 392 11.5855 Potri.005G024800.1.v4.1 1035 744.53 524 35.9337 Potri.004G059700.1.v4.1 961 670.76 51 3.882 Potri.007G009000.2.v4.1 1416 1125.53 0 0 Potri.003G141000.2.v4.1 2943 2652.53 361 6.94864 Potri.016G087400.1.v4.1 270 62.0328 736.423 606.12 Potri.015G069301.1.v4.1 564 288.511 0 0 Potri.010G195200.1.v4.1 1773 1482.53 3 0.103317 Potri.012G127500.1.v4.1 977 686.659 235 17.4735 ==> SRR12161408.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 165 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 15 Potri.001G452600.v4.1 15 SRR12161408 completed mapping pipeline successfully