Starting /dee2/code/volunteer_pipeline.sh SRR12161409 current disk space = 3088199307264 free memory = 1449887876 SRR12161409 SRAfilesize 00d75015f8298ba804d6eea965d87d1c SRR12161409.sra SRR12161409.sra file validated SRR12161409 is paired end SRR12161409 is conventional basespace SRR12161409 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161409_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.531 37.0 37.0 37.0 37.0 37.0 2 36.397 37.0 37.0 37.0 37.0 37.0 3 36.463 37.0 37.0 37.0 37.0 37.0 4 36.4925 37.0 37.0 37.0 37.0 37.0 5 36.5745 37.0 37.0 37.0 37.0 37.0 6 36.5385 37.0 37.0 37.0 37.0 37.0 7 36.549 37.0 37.0 37.0 37.0 37.0 8 36.507 37.0 37.0 37.0 37.0 37.0 9 36.519 37.0 37.0 37.0 37.0 37.0 10-14 36.5638 37.0 37.0 37.0 37.0 37.0 15-19 36.5136 37.0 37.0 37.0 37.0 37.0 20-24 36.5037 37.0 37.0 37.0 37.0 37.0 25-29 36.4581 37.0 37.0 37.0 37.0 37.0 30-34 36.4073 37.0 37.0 37.0 37.0 37.0 35-39 36.4122 37.0 37.0 37.0 37.0 37.0 40-44 36.3919 37.0 37.0 37.0 37.0 37.0 45-49 36.385000000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2888 37.0 37.0 37.0 37.0 37.0 55-59 36.3103 37.0 37.0 37.0 37.0 37.0 60-64 36.2977 37.0 37.0 37.0 37.0 37.0 65-69 36.334599999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2932 37.0 37.0 37.0 37.0 37.0 75-79 36.2246 37.0 37.0 37.0 37.0 37.0 80-84 36.293099999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2235 37.0 37.0 37.0 37.0 37.0 90-94 36.235 37.0 37.0 37.0 37.0 37.0 95-99 36.1544 37.0 37.0 37.0 37.0 37.0 100-104 36.1924 37.0 37.0 37.0 37.0 37.0 105-109 36.1071 37.0 37.0 37.0 37.0 37.0 110-114 36.106899999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1325 37.0 37.0 37.0 37.0 37.0 120-124 36.0912 37.0 37.0 37.0 37.0 37.0 125-129 36.0374 37.0 37.0 37.0 37.0 37.0 130-134 35.9755 37.0 37.0 37.0 37.0 37.0 135-139 35.9317 37.0 37.0 37.0 37.0 37.0 140-144 35.921 37.0 37.0 37.0 37.0 37.0 145-149 35.847 37.0 37.0 37.0 37.0 37.0 150-151 35.67375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 0.0 24 2.0 25 2.0 26 6.0 27 6.0 28 11.0 29 19.0 30 31.0 31 35.0 32 49.0 33 79.0 34 124.0 35 316.0 36 2896.0 37 420.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.874937468734366 12.256128064032017 5.702851425712856 32.16608304152076 2 20.25 13.450000000000001 32.725 33.575 3 18.15 18.975 28.975 33.900000000000006 4 21.825 27.35 24.15 26.674999999999997 5 21.3 33.425 23.849999999999998 21.425 6 20.724999999999998 35.725 23.625 19.925 7 15.6 25.900000000000002 41.55 16.950000000000003 8 17.599999999999998 24.925 33.375 24.099999999999998 9 17.275 24.725 34.050000000000004 23.95 10-14 19.759999999999998 29.720000000000002 26.884999999999998 23.635 15-19 20.044999999999998 28.24 27.534999999999997 24.18 20-24 20.645 28.365000000000002 27.045 23.945 25-29 20.145 29.104999999999997 26.96 23.79 30-34 19.6 28.610000000000003 27.555000000000003 24.235 35-39 20.31 28.775000000000002 27.310000000000002 23.605 40-44 20.36 28.715000000000003 27.27 23.655 45-49 20.31 28.22 28.015 23.455000000000002 50-54 20.665 27.845 27.805000000000003 23.685000000000002 55-59 19.845 28.810000000000002 26.924999999999997 24.42 60-64 19.99 28.62 27.500000000000004 23.89 65-69 20.43 28.125 27.389999999999997 24.055 70-74 20.765 28.544999999999998 27.279999999999998 23.41 75-79 19.985 28.345 27.62 24.05 80-84 20.03 28.22 28.294999999999998 23.455000000000002 85-89 20.669999999999998 28.02 27.529999999999998 23.78 90-94 20.24 27.985 27.744999999999997 24.03 95-99 20.135 28.199999999999996 27.41 24.255 100-104 20.585 27.615000000000002 27.625 24.175 105-109 20.645 27.500000000000004 27.73 24.125 110-114 20.455000000000002 28.17 27.85 23.525 115-119 21.065 28.549999999999997 26.755000000000003 23.630000000000003 120-124 21.01 28.215 27.189999999999998 23.585 125-129 20.855 28.199999999999996 26.83 24.115000000000002 130-134 20.635 28.02 27.165 24.18 135-139 21.41 27.644999999999996 27.12 23.825 140-144 21.05 28.395 26.884999999999998 23.669999999999998 145-149 20.775 27.955000000000002 27.134999999999998 24.135 150-151 20.3125 28.1875 27.025 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 2.0 22 3.5 23 3.5 24 3.0 25 2.0 26 4.5 27 10.0 28 12.0 29 12.5 30 16.5 31 27.5 32 43.0 33 51.0 34 54.5 35 71.0 36 80.0 37 89.5 38 122.0 39 136.5 40 154.5 41 190.0 42 211.5 43 230.5 44 253.0 45 277.5 46 273.0 47 257.0 48 252.0 49 223.5 50 196.5 51 156.0 52 123.5 53 109.0 54 84.0 55 68.0 56 53.0 57 39.5 58 27.0 59 21.0 60 17.0 61 12.5 62 8.0 63 4.0 64 2.5 65 2.5 66 2.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 94.71737982039092 89.64999999999999 2 4.992076069730586 9.45 3 0.2377179080824089 0.675 4 0.02641310089804543 0.1 5 0.02641310089804543 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.05 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.1624999999999996 0.0 0.0 0.0 0.0 130-131 2.35 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAATA 10 0.006830828 145.0 6 >>END_MODULE SRR12161409 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161409_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2645 37.0 37.0 37.0 37.0 37.0 2 35.988 37.0 37.0 37.0 37.0 37.0 3 36.009 37.0 37.0 37.0 37.0 37.0 4 36.04 37.0 37.0 37.0 37.0 37.0 5 36.0895 37.0 37.0 37.0 37.0 37.0 6 36.128 37.0 37.0 37.0 37.0 37.0 7 35.905 37.0 37.0 37.0 37.0 37.0 8 36.2075 37.0 37.0 37.0 37.0 37.0 9 36.187 37.0 37.0 37.0 37.0 37.0 10-14 36.139700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.119299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.05 37.0 37.0 37.0 37.0 37.0 25-29 35.9927 37.0 37.0 37.0 37.0 37.0 30-34 35.9619 37.0 37.0 37.0 37.0 37.0 35-39 35.9316 37.0 37.0 37.0 37.0 37.0 40-44 35.9182 37.0 37.0 37.0 37.0 37.0 45-49 35.888200000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.9697 37.0 37.0 37.0 37.0 37.0 55-59 35.869400000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.793600000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.8803 37.0 37.0 37.0 37.0 37.0 70-74 35.719500000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.7214 37.0 37.0 37.0 37.0 37.0 80-84 35.8093 37.0 37.0 37.0 37.0 37.0 85-89 35.7427 37.0 37.0 37.0 37.0 37.0 90-94 35.6167 37.0 37.0 37.0 37.0 37.0 95-99 35.7237 37.0 37.0 37.0 37.0 37.0 100-104 35.7039 37.0 37.0 37.0 37.0 37.0 105-109 35.67130000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.6259 37.0 37.0 37.0 37.0 37.0 115-119 35.5817 37.0 37.0 37.0 37.0 37.0 120-124 35.622600000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.5334 37.0 37.0 37.0 37.0 37.0 130-134 35.4057 37.0 37.0 37.0 37.0 37.0 135-139 35.4204 37.0 37.0 37.0 37.0 37.0 140-144 35.2969 37.0 37.0 37.0 34.6 37.0 145-149 35.334 37.0 37.0 37.0 34.6 37.0 150-151 34.926 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 3.0 13 3.0 14 4.0 15 3.0 16 5.0 17 1.0 18 1.0 19 1.0 20 3.0 21 4.0 22 4.0 23 4.0 24 15.0 25 10.0 26 14.0 27 25.0 28 17.0 29 16.0 30 30.0 31 38.0 32 75.0 33 109.0 34 199.0 35 456.0 36 2688.0 37 271.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.075 25.0 7.625 20.3 2 28.875 25.424999999999997 28.849999999999998 16.85 3 23.925 26.224999999999998 31.175000000000004 18.675 4 24.25 34.075 22.925 18.75 5 24.0 39.6 19.925 16.475 6 22.7 38.675 20.5 18.125 7 21.825 21.9 37.6 18.675 8 20.724999999999998 27.575 26.950000000000003 24.75 9 24.224999999999998 24.3 28.050000000000004 23.425 10-14 23.59 29.26 25.77 21.38 15-19 23.525 29.205 26.584999999999997 20.685000000000002 20-24 23.36 28.33 26.915 21.395 25-29 23.830000000000002 28.23 27.565 20.375 30-34 23.200000000000003 27.775 28.1 20.925 35-39 23.015 27.905 28.105000000000004 20.974999999999998 40-44 23.28 28.67 27.055 20.995 45-49 23.355 28.355000000000004 27.57 20.72 50-54 23.395 27.515 28.035 21.055 55-59 23.385 28.435 26.979999999999997 21.2 60-64 24.165 28.144999999999996 26.77 20.919999999999998 65-69 24.15 27.939999999999998 27.515 20.395 70-74 23.965 28.060000000000002 27.12 20.855 75-79 23.76 27.765 27.435 21.04 80-84 23.275000000000002 28.694999999999997 27.35 20.68 85-89 23.77 27.884999999999998 27.389999999999997 20.955 90-94 23.985 27.639999999999997 27.6 20.775 95-99 23.724999999999998 27.950000000000003 27.575 20.75 100-104 23.96 27.485 27.405 21.15 105-109 23.765 27.525 27.560000000000002 21.15 110-114 23.985 28.025 27.034999999999997 20.955 115-119 23.765 27.97 27.279999999999998 20.985 120-124 24.2 27.66 27.634999999999998 20.505000000000003 125-129 24.065 27.76 26.875 21.3 130-134 25.44 27.275 27.18 20.105 135-139 24.785 27.939999999999998 26.845000000000002 20.43 140-144 24.57 28.335 27.034999999999997 20.06 145-149 24.805 27.400000000000002 27.49 20.305 150-151 25.15 27.85 26.187500000000004 20.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 1.0 7 2.0 8 1.0 9 0.5 10 2.0 11 2.0 12 1.0 13 1.5 14 1.0 15 0.5 16 1.0 17 0.5 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 2.0 24 2.5 25 3.5 26 6.5 27 5.5 28 4.0 29 8.0 30 13.0 31 21.0 32 30.5 33 35.0 34 44.0 35 62.5 36 80.0 37 111.5 38 143.5 39 149.0 40 169.0 41 205.0 42 232.0 43 247.5 44 251.0 45 267.0 46 264.5 47 255.5 48 236.0 49 215.5 50 200.0 51 153.5 52 114.5 53 91.0 54 73.0 55 63.5 56 57.0 57 40.0 58 30.0 59 24.5 60 15.0 61 12.0 62 10.0 63 3.5 64 1.5 65 2.5 66 1.0 67 0.5 68 1.5 69 1.0 70 0.5 71 1.0 72 1.0 73 1.5 74 1.0 75 1.5 76 1.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.81069631983056 89.525 2 4.845115170770453 9.15 3 0.18533227429176596 0.525 4 0.07942811755361398 0.3 5 0.026476039184537992 0.125 6 0.026476039184537992 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026476039184537992 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.05 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.7 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.375 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644735 spots for SRR12161409.sra Written 644735 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra Read 644729 spots for SRR12161409.sra Written 644729 spots for SRR12161409.sra SRR ids: ['SRR12161409.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n37ysjpi SRR12161409.sra spots: 12894586 blocks: [[1, 644729], [644730, 1289458], [1289459, 1934187], [1934188, 2578916], [2578917, 3223645], [3223646, 3868374], [3868375, 4513103], [4513104, 5157832], [5157833, 5802561], [5802562, 6447290], [6447291, 7092019], [7092020, 7736748], [7736749, 8381477], [8381478, 9026206], [9026207, 9670935], [9670936, 10315664], [10315665, 10960393], [10960394, 11605122], [11605123, 12249851], [12249852, 12894586]] SRR12161409 file size 4360444 SRR12161409 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161409 SRR12161409_1.fastq SRR12161409_2.fastq Input file: SRR12161409_1.fastq Paired file: SRR12161409_2.fastq trimmed: SRR12161409-trimmed-pair1.fastq, SRR12161409-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:10:13 2025 >> started Thu Feb 13 21:10:34 2025 >> done (21.224s) 12894586 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 1639 ( 0.01%) empty read pairs filtered out after trimming by size control 12892911 (99.99%) read pairs available; of these: 683353 ( 5.30%) trimmed read pairs available after processing 12209558 (94.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 9 0.00% 21 2 0.00% 22 6 0.00% 23 6 0.00% 24 8 0.00% 25 5 0.00% 26 5 0.00% 27 10 0.00% 28 17 0.00% 29 14 0.00% 30 8 0.00% 31 14 0.00% 32 18 0.00% 33 15 0.00% 34 10 0.00% 35 10 0.00% 36 11 0.00% 37 6 0.00% 38 19 0.00% 39 22 0.00% 40 8 0.00% 41 15 0.00% 42 12 0.00% 43 17 0.00% 44 12 0.00% 45 15 0.00% 46 17 0.00% 47 15 0.00% 48 16 0.00% 49 18 0.00% 50 21 0.00% 51 22 0.00% 52 26 0.00% 53 31 0.00% 54 32 0.00% 55 38 0.00% 56 29 0.00% 57 35 0.00% 58 42 0.00% 59 46 0.00% 60 56 0.00% 61 62 0.00% 62 56 0.00% 63 70 0.00% 64 69 0.00% 65 80 0.00% 66 67 0.00% 67 116 0.00% 68 114 0.00% 69 117 0.00% 70 144 0.00% 71 176 0.00% 72 196 0.00% 73 210 0.00% 74 248 0.00% 75 261 0.00% 76 272 0.00% 77 328 0.00% 78 348 0.00% 79 404 0.00% 80 442 0.00% 81 513 0.00% 82 608 0.00% 83 688 0.01% 84 774 0.01% 85 792 0.01% 86 860 0.01% 87 1073 0.01% 88 998 0.01% 89 1218 0.01% 90 1285 0.01% 91 1510 0.01% 92 1624 0.01% 93 1938 0.02% 94 2034 0.02% 95 2090 0.02% 96 2326 0.02% 97 2435 0.02% 98 2690 0.02% 99 2795 0.02% 100 2976 0.02% 101 3354 0.03% 102 3440 0.03% 103 4000 0.03% 104 4196 0.03% 105 4462 0.03% 106 4674 0.04% 107 4770 0.04% 108 5094 0.04% 109 5455 0.04% 110 5636 0.04% 111 5941 0.05% 112 6344 0.05% 113 6940 0.05% 114 7445 0.06% 115 7882 0.06% 116 8059 0.06% 117 8304 0.06% 118 8684 0.07% 119 8899 0.07% 120 9210 0.07% 121 9866 0.08% 122 10343 0.08% 123 10948 0.08% 124 11496 0.09% 125 12163 0.09% 126 12371 0.10% 127 12582 0.10% 128 13004 0.10% 129 13446 0.10% 130 13721 0.11% 131 14200 0.11% 132 15006 0.12% 133 15804 0.12% 134 16566 0.13% 135 17615 0.14% 136 17856 0.14% 137 18006 0.14% 138 18471 0.14% 139 18951 0.15% 140 19319 0.15% 141 20029 0.16% 142 20612 0.16% 143 21687 0.17% 144 22853 0.18% 145 23251 0.18% 146 23853 0.19% 147 24521 0.19% 148 24649 0.19% 149 25420 0.20% 150 26206 0.20% 151 12209558 94.70% 12892911 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.74 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=108.28 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=14.5 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=22 prefix-density=0.93 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=46.04 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12161409 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:11:18 Started mapping on | Feb 13 21:11:18 Finished on | Feb 13 21:12:44 Mapping speed, Million of reads per hour | 539.70 Number of input reads | 12892911 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11835956 Uniquely mapped reads % | 91.80% Average mapped length | 298.54 Number of splices: Total | 12082862 Number of splices: Annotated (sjdb) | 11848731 Number of splices: GT/AG | 11832567 Number of splices: GC/AG | 210184 Number of splices: AT/AC | 8669 Number of splices: Non-canonical | 31442 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326890 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 91599 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.70% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 730065 730065 730065 N_multimapping 326890 326890 326890 N_noFeature 385461 11710291 428928 N_ambiguous 162200 741 79520 UnstrandedReadsAssigned:11288295 PositiveStrandReadsAssigned:124924 NegativeStrandReadsAssigned:11327508 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161409 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161409-trimmed-pair1.fastq SRR12161409-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,892,911 reads, 11,528,898 reads pseudoaligned [quant] estimated average fragment length: 275.532 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR12161409.ke.tsv 34699 SRR12161409.se.tsv 87100 total ==> SRR12161409.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.47 309 14.2695 Potri.005G024800.1.v4.1 1035 760.468 331 35.0439 Potri.004G059700.1.v4.1 961 686.696 39 4.57262 Potri.007G009000.2.v4.1 1416 1141.47 0 0 Potri.003G141000.2.v4.1 2943 2668.47 306 9.23261 Potri.016G087400.1.v4.1 270 72.591 1013 1123.55 Potri.015G069301.1.v4.1 564 306.15 0 0 Potri.010G195200.1.v4.1 1773 1498.47 7 0.376111 Potri.012G127500.1.v4.1 977 702.584 578 66.2361 ==> SRR12161409.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 145 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 40 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12161409 completed mapping pipeline successfully