Starting /dee2/code/volunteer_pipeline.sh SRR12161410 current disk space = 3088212385792 free memory = 1429563408 SRR12161410 SRAfilesize 7f979454538df20990b38bb9b3358101 SRR12161410.sra SRR12161410.sra file validated SRR12161410 is paired end SRR12161410 is conventional basespace SRR12161410 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161410_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.61125 37.0 37.0 37.0 37.0 37.0 2 36.4735 37.0 37.0 37.0 37.0 37.0 3 36.504 37.0 37.0 37.0 37.0 37.0 4 36.621 37.0 37.0 37.0 37.0 37.0 5 36.5965 37.0 37.0 37.0 37.0 37.0 6 36.5655 37.0 37.0 37.0 37.0 37.0 7 36.501 37.0 37.0 37.0 37.0 37.0 8 36.5985 37.0 37.0 37.0 37.0 37.0 9 36.5705 37.0 37.0 37.0 37.0 37.0 10-14 36.5951 37.0 37.0 37.0 37.0 37.0 15-19 36.5593 37.0 37.0 37.0 37.0 37.0 20-24 36.532 37.0 37.0 37.0 37.0 37.0 25-29 36.4696 37.0 37.0 37.0 37.0 37.0 30-34 36.4732 37.0 37.0 37.0 37.0 37.0 35-39 36.4356 37.0 37.0 37.0 37.0 37.0 40-44 36.4262 37.0 37.0 37.0 37.0 37.0 45-49 36.388099999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.3411 37.0 37.0 37.0 37.0 37.0 55-59 36.3495 37.0 37.0 37.0 37.0 37.0 60-64 36.324200000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.308099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3352 37.0 37.0 37.0 37.0 37.0 75-79 36.290200000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.2553 37.0 37.0 37.0 37.0 37.0 85-89 36.2613 37.0 37.0 37.0 37.0 37.0 90-94 36.2111 37.0 37.0 37.0 37.0 37.0 95-99 36.198899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.184400000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0974 37.0 37.0 37.0 37.0 37.0 110-114 36.2178 37.0 37.0 37.0 37.0 37.0 115-119 36.1507 37.0 37.0 37.0 37.0 37.0 120-124 36.1195 37.0 37.0 37.0 37.0 37.0 125-129 36.0486 37.0 37.0 37.0 37.0 37.0 130-134 36.04899999999999 37.0 37.0 37.0 37.0 37.0 135-139 36.0089 37.0 37.0 37.0 37.0 37.0 140-144 35.9018 37.0 37.0 37.0 37.0 37.0 145-149 35.8647 37.0 37.0 37.0 37.0 37.0 150-151 35.699250000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 1.0 26 7.0 27 6.0 28 11.0 29 12.0 30 25.0 31 36.0 32 46.0 33 78.0 34 115.0 35 299.0 36 2955.0 37 405.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.762190547636905 12.303075768942236 5.901475368842211 33.033258314578646 2 21.099999999999998 12.1 34.525 32.275 3 16.650000000000002 16.950000000000003 29.599999999999998 36.8 4 20.95 24.725 24.95 29.375 5 21.825 32.275 25.124999999999996 20.775 6 21.85 33.2 24.525 20.424999999999997 7 16.425 26.3 39.95 17.325 8 17.275 27.450000000000003 30.45 24.825 9 16.400000000000002 24.65 34.849999999999994 24.099999999999998 10-14 19.814999999999998 29.805 27.76 22.62 15-19 20.185 28.405 27.575 23.835 20-24 19.405 28.875 27.49 24.23 25-29 20.28 28.610000000000003 27.505000000000003 23.605 30-34 19.775000000000002 28.744999999999997 27.93 23.549999999999997 35-39 19.580000000000002 28.389999999999997 27.715 24.315 40-44 20.200000000000003 28.449999999999996 27.35 24.0 45-49 19.950000000000003 28.194999999999997 27.57 24.285 50-54 20.04 27.694999999999997 28.285 23.98 55-59 19.755 28.315 27.605 24.325 60-64 20.73 28.110000000000003 26.82 24.34 65-69 19.905 28.705000000000002 28.15 23.24 70-74 20.69 28.03 27.605 23.674999999999997 75-79 20.064999999999998 28.560000000000002 27.389999999999997 23.985 80-84 20.294999999999998 27.96 27.965 23.78 85-89 20.59 28.025 27.555000000000003 23.830000000000002 90-94 20.244999999999997 28.32 27.29 24.145 95-99 20.19 27.775 27.529999999999998 24.505 100-104 20.669999999999998 28.175 27.534999999999997 23.62 105-109 20.57 27.71 27.76 23.96 110-114 20.745 27.150000000000002 27.85 24.255 115-119 20.855 28.139999999999997 27.35 23.655 120-124 20.77 27.875 27.455000000000002 23.9 125-129 19.939999999999998 28.34 27.785 23.935000000000002 130-134 20.71 27.905 27.994999999999997 23.39 135-139 21.33 27.485 26.96 24.224999999999998 140-144 20.835 27.38 27.675 24.11 145-149 20.76 27.905 27.29 24.044999999999998 150-151 20.575 28.512500000000003 27.150000000000002 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.5 24 2.5 25 2.5 26 6.5 27 8.0 28 8.5 29 17.5 30 22.5 31 26.0 32 29.5 33 35.5 34 47.5 35 59.0 36 72.0 37 110.5 38 143.5 39 159.0 40 180.0 41 198.0 42 218.5 43 240.5 44 252.5 45 252.5 46 250.0 47 254.0 48 243.0 49 221.0 50 201.0 51 167.5 52 132.5 53 94.5 54 75.5 55 71.5 56 56.5 57 37.0 58 24.0 59 21.5 60 15.5 61 11.0 62 9.0 63 3.5 64 2.5 65 1.0 66 1.5 67 2.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.3 #Duplication Level Percentage of deduplicated Percentage of total 1 95.3305351521511 90.85 2 4.4071353620146905 8.4 3 0.26232948583420773 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.8625 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.3375 0.0 0.0 0.0 0.0 138-139 3.6500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161410 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161410_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.263 37.0 37.0 37.0 37.0 37.0 2 35.724 37.0 37.0 37.0 37.0 37.0 3 35.894 37.0 37.0 37.0 37.0 37.0 4 35.8625 37.0 37.0 37.0 37.0 37.0 5 36.154 37.0 37.0 37.0 37.0 37.0 6 36.042 37.0 37.0 37.0 37.0 37.0 7 36.054 37.0 37.0 37.0 37.0 37.0 8 36.235 37.0 37.0 37.0 37.0 37.0 9 36.135 37.0 37.0 37.0 37.0 37.0 10-14 36.093399999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.13530000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.082499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.0186 37.0 37.0 37.0 37.0 37.0 30-34 36.0125 37.0 37.0 37.0 37.0 37.0 35-39 35.9437 37.0 37.0 37.0 37.0 37.0 40-44 35.9868 37.0 37.0 37.0 37.0 37.0 45-49 35.9307 37.0 37.0 37.0 37.0 37.0 50-54 36.0341 37.0 37.0 37.0 37.0 37.0 55-59 35.8991 37.0 37.0 37.0 37.0 37.0 60-64 35.8728 37.0 37.0 37.0 37.0 37.0 65-69 35.8307 37.0 37.0 37.0 37.0 37.0 70-74 35.769099999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.8061 37.0 37.0 37.0 37.0 37.0 80-84 35.8057 37.0 37.0 37.0 37.0 37.0 85-89 35.764700000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.7361 37.0 37.0 37.0 37.0 37.0 95-99 35.7855 37.0 37.0 37.0 37.0 37.0 100-104 35.711 37.0 37.0 37.0 37.0 37.0 105-109 35.7516 37.0 37.0 37.0 37.0 37.0 110-114 35.6832 37.0 37.0 37.0 37.0 37.0 115-119 35.67530000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.6225 37.0 37.0 37.0 37.0 37.0 125-129 35.5015 37.0 37.0 37.0 37.0 37.0 130-134 35.363400000000006 37.0 37.0 37.0 34.6 37.0 135-139 35.4982 37.0 37.0 37.0 37.0 37.0 140-144 35.3778 37.0 37.0 37.0 37.0 37.0 145-149 35.4433 37.0 37.0 37.0 37.0 37.0 150-151 34.7325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 3.0 15 4.0 16 0.0 17 1.0 18 3.0 19 2.0 20 4.0 21 0.0 22 2.0 23 8.0 24 4.0 25 13.0 26 1.0 27 9.0 28 17.0 29 18.0 30 31.0 31 47.0 32 56.0 33 122.0 34 223.0 35 614.0 36 2581.0 37 230.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.474999999999994 26.8 7.5249999999999995 21.2 2 28.975 27.125 28.050000000000004 15.85 3 21.4 28.15 32.425 18.025 4 22.8 36.475 22.775000000000002 17.95 5 25.674999999999997 38.15 20.9 15.275 6 22.025 40.65 20.474999999999998 16.85 7 22.125 22.625 37.0 18.25 8 21.45 27.1 27.0 24.45 9 21.75 24.224999999999998 30.25 23.775 10-14 23.91 29.32 25.91 20.86 15-19 23.674999999999997 28.15 27.425 20.75 20-24 23.395 28.525 27.310000000000002 20.77 25-29 22.99 28.225 28.410000000000004 20.375 30-34 23.21 27.515 28.24 21.035 35-39 23.03 28.28 27.57 21.12 40-44 23.34 28.134999999999998 27.839999999999996 20.685000000000002 45-49 23.535 28.025 27.43 21.01 50-54 23.189999999999998 28.035 28.32 20.455000000000002 55-59 23.49 28.38 27.11 21.02 60-64 22.89 28.754999999999995 27.315 21.04 65-69 23.45 28.005000000000003 27.825 20.72 70-74 23.655 28.115000000000002 27.455000000000002 20.775 75-79 23.51 28.02 27.365000000000002 21.105 80-84 23.155 28.575 27.37 20.9 85-89 24.38 27.644999999999996 27.339999999999996 20.635 90-94 23.555 28.13 26.905 21.41 95-99 23.525 28.21 27.295 20.97 100-104 24.355 28.470000000000002 26.634999999999998 20.54 105-109 23.65 27.855 27.54 20.955 110-114 23.685000000000002 28.384999999999998 26.950000000000003 20.979999999999997 115-119 23.494999999999997 28.395 27.450000000000003 20.66 120-124 24.529999999999998 27.529999999999998 27.034999999999997 20.905 125-129 24.495 27.700000000000003 26.69 21.115000000000002 130-134 24.975 27.515 26.85 20.66 135-139 24.26 27.889999999999997 27.51 20.34 140-144 24.37 28.050000000000004 27.029999999999998 20.549999999999997 145-149 24.615000000000002 28.244999999999997 26.86 20.28 150-151 25.124999999999996 28.6125 26.924999999999997 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 1.0 13 3.0 14 2.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 2.0 21 3.0 22 1.5 23 2.0 24 2.5 25 1.5 26 2.0 27 4.0 28 9.0 29 10.5 30 15.0 31 20.5 32 23.0 33 32.5 34 48.0 35 62.0 36 81.5 37 117.5 38 138.5 39 154.5 40 192.5 41 226.5 42 239.0 43 261.0 44 275.5 45 270.5 46 260.5 47 239.0 48 225.0 49 208.0 50 171.0 51 142.5 52 117.5 53 98.0 54 89.0 55 62.5 56 38.5 57 30.5 58 31.5 59 25.0 60 14.0 61 8.5 62 4.5 63 7.0 64 7.0 65 2.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.3 #Duplication Level Percentage of deduplicated Percentage of total 1 95.46169989506821 90.975 2 4.197271773347324 8.0 3 0.2885624344176285 0.8250000000000001 4 0.05246589716684155 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.2374999999999998 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.8875 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.575 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.1500000000000004 0.0 0.0 0.0 0.0 136-137 3.4125 0.0 0.0 0.0 0.0 138-139 3.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266932 spots for SRR12161410.sra Written 1266932 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra Read 1266924 spots for SRR12161410.sra Written 1266924 spots for SRR12161410.sra SRR ids: ['SRR12161410.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ptqx__w SRR12161410.sra spots: 25338488 blocks: [[1, 1266924], [1266925, 2533848], [2533849, 3800772], [3800773, 5067696], [5067697, 6334620], [6334621, 7601544], [7601545, 8868468], [8868469, 10135392], [10135393, 11402316], [11402317, 12669240], [12669241, 13936164], [13936165, 15203088], [15203089, 16470012], [16470013, 17736936], [17736937, 19003860], [19003861, 20270784], [20270785, 21537708], [21537709, 22804632], [22804633, 24071556], [24071557, 25338488]] SRR12161410 file size 8589426 SRR12161410 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161410 SRR12161410_1.fastq SRR12161410_2.fastq Input file: SRR12161410_1.fastq Paired file: SRR12161410_2.fastq trimmed: SRR12161410-trimmed-pair1.fastq, SRR12161410-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:27:36 2025 >> started Thu Feb 13 21:28:04 2025 >> done (28.110s) 25338488 read pairs processed; of these: 53 ( 0.00%) short read pairs filtered out after trimming by size control 3025 ( 0.01%) empty read pairs filtered out after trimming by size control 25335410 (99.99%) read pairs available; of these: 1627572 ( 6.42%) trimmed read pairs available after processing 23707838 (93.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 8 0.00% 21 14 0.00% 22 12 0.00% 23 14 0.00% 24 12 0.00% 25 18 0.00% 26 10 0.00% 27 24 0.00% 28 23 0.00% 29 15 0.00% 30 25 0.00% 31 18 0.00% 32 25 0.00% 33 18 0.00% 34 24 0.00% 35 19 0.00% 36 21 0.00% 37 23 0.00% 38 26 0.00% 39 22 0.00% 40 20 0.00% 41 25 0.00% 42 25 0.00% 43 31 0.00% 44 36 0.00% 45 25 0.00% 46 32 0.00% 47 34 0.00% 48 43 0.00% 49 41 0.00% 50 40 0.00% 51 51 0.00% 52 42 0.00% 53 40 0.00% 54 51 0.00% 55 59 0.00% 56 65 0.00% 57 78 0.00% 58 77 0.00% 59 83 0.00% 60 133 0.00% 61 114 0.00% 62 101 0.00% 63 147 0.00% 64 168 0.00% 65 163 0.00% 66 168 0.00% 67 227 0.00% 68 222 0.00% 69 263 0.00% 70 330 0.00% 71 389 0.00% 72 381 0.00% 73 487 0.00% 74 462 0.00% 75 555 0.00% 76 576 0.00% 77 685 0.00% 78 767 0.00% 79 905 0.00% 80 977 0.00% 81 1124 0.00% 82 1328 0.01% 83 1437 0.01% 84 1634 0.01% 85 1810 0.01% 86 1999 0.01% 87 2110 0.01% 88 2372 0.01% 89 2589 0.01% 90 2911 0.01% 91 3358 0.01% 92 3870 0.02% 93 4323 0.02% 94 4633 0.02% 95 4934 0.02% 96 5523 0.02% 97 5690 0.02% 98 6242 0.02% 99 6797 0.03% 100 7298 0.03% 101 7892 0.03% 102 8588 0.03% 103 9422 0.04% 104 10162 0.04% 105 11040 0.04% 106 11338 0.04% 107 11977 0.05% 108 12759 0.05% 109 13517 0.05% 110 14064 0.06% 111 14705 0.06% 112 15914 0.06% 113 17017 0.07% 114 18118 0.07% 115 18904 0.07% 116 19915 0.08% 117 20593 0.08% 118 21339 0.08% 119 22039 0.09% 120 23162 0.09% 121 24301 0.10% 122 25605 0.10% 123 26689 0.11% 124 28289 0.11% 125 29218 0.12% 126 30241 0.12% 127 31225 0.12% 128 32167 0.13% 129 32843 0.13% 130 34129 0.13% 131 35005 0.14% 132 36229 0.14% 133 37932 0.15% 134 39201 0.15% 135 40808 0.16% 136 42246 0.17% 137 42794 0.17% 138 43898 0.17% 139 45387 0.18% 140 46149 0.18% 141 46858 0.18% 142 49013 0.19% 143 50761 0.20% 144 52810 0.21% 145 54209 0.21% 146 55426 0.22% 147 56033 0.22% 148 57239 0.23% 149 57680 0.23% 150 59237 0.23% 151 23707838 93.58% 25335410 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.53 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=10.54 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=3.5 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=24 prefix-density=0.38 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=24.92 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR12161410 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:28:49 Started mapping on | Feb 13 21:28:49 Finished on | Feb 13 21:31:42 Mapping speed, Million of reads per hour | 527.21 Number of input reads | 25335410 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 23500773 Uniquely mapped reads % | 92.76% Average mapped length | 298.04 Number of splices: Total | 24399177 Number of splices: Annotated (sjdb) | 23874994 Number of splices: GT/AG | 23882362 Number of splices: GC/AG | 422096 Number of splices: AT/AC | 21204 Number of splices: Non-canonical | 73515 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 579992 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 201481 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1254645 1254645 1254645 N_multimapping 579992 579992 579992 N_noFeature 829651 23182549 926994 N_ambiguous 374392 1647 152496 UnstrandedReadsAssigned:22296730 PositiveStrandReadsAssigned:316577 NegativeStrandReadsAssigned:22421283 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161410 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161410-trimmed-pair1.fastq SRR12161410-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,335,410 reads, 22,617,739 reads pseudoaligned [quant] estimated average fragment length: 270.123 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR12161410.ke.tsv 34699 SRR12161410.se.tsv 87100 total ==> SRR12161410.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.88 885 19.2025 Potri.005G024800.1.v4.1 1035 765.877 1292 64.0144 Potri.004G059700.1.v4.1 961 692.068 94 5.15411 Potri.007G009000.2.v4.1 1416 1146.88 0 0 Potri.003G141000.2.v4.1 2943 2673.88 882.444 12.5233 Potri.016G087400.1.v4.1 270 74.8788 1463 741.412 Potri.015G069301.1.v4.1 564 310.288 0 0 Potri.010G195200.1.v4.1 1773 1503.88 79 1.99337 Potri.012G127500.1.v4.1 977 707.971 278 14.9006 ==> SRR12161410.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 86 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 561 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 13 SRR12161410 completed mapping pipeline successfully