Starting /dee2/code/volunteer_pipeline.sh SRR12161411 current disk space = 3088190980096 free memory = 1445628712 SRR12161411 SRAfilesize edef9dcf9bd888340aeb3405c99afd0c SRR12161411.sra SRR12161411.sra file validated SRR12161411 is paired end SRR12161411 is conventional basespace SRR12161411 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161411_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5875 37.0 37.0 37.0 37.0 37.0 2 36.3995 37.0 37.0 37.0 37.0 37.0 3 36.521 37.0 37.0 37.0 37.0 37.0 4 36.56 37.0 37.0 37.0 37.0 37.0 5 36.605 37.0 37.0 37.0 37.0 37.0 6 36.5725 37.0 37.0 37.0 37.0 37.0 7 36.5165 37.0 37.0 37.0 37.0 37.0 8 36.5615 37.0 37.0 37.0 37.0 37.0 9 36.5015 37.0 37.0 37.0 37.0 37.0 10-14 36.5601 37.0 37.0 37.0 37.0 37.0 15-19 36.5047 37.0 37.0 37.0 37.0 37.0 20-24 36.510200000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.490899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4751 37.0 37.0 37.0 37.0 37.0 35-39 36.4705 37.0 37.0 37.0 37.0 37.0 40-44 36.394400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.371399999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.363800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3633 37.0 37.0 37.0 37.0 37.0 60-64 36.339200000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3562 37.0 37.0 37.0 37.0 37.0 70-74 36.3439 37.0 37.0 37.0 37.0 37.0 75-79 36.28339999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3192 37.0 37.0 37.0 37.0 37.0 85-89 36.2195 37.0 37.0 37.0 37.0 37.0 90-94 36.2774 37.0 37.0 37.0 37.0 37.0 95-99 36.191700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.138400000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1548 37.0 37.0 37.0 37.0 37.0 110-114 36.154799999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.1012 37.0 37.0 37.0 37.0 37.0 120-124 36.0522 37.0 37.0 37.0 37.0 37.0 125-129 36.0612 37.0 37.0 37.0 37.0 37.0 130-134 36.0458 37.0 37.0 37.0 37.0 37.0 135-139 35.9576 37.0 37.0 37.0 37.0 37.0 140-144 35.8834 37.0 37.0 37.0 37.0 37.0 145-149 35.8623 37.0 37.0 37.0 37.0 37.0 150-151 35.71625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 0.0 25 1.0 26 1.0 27 3.0 28 11.0 29 22.0 30 26.0 31 46.0 32 63.0 33 73.0 34 100.0 35 304.0 36 2944.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.91791791791792 12.087087087087086 5.980980980980981 39.014014014014016 2 19.55 11.799999999999999 35.225 33.425 3 17.474999999999998 14.7 28.050000000000004 39.775 4 20.974999999999998 22.625 24.4 32.0 5 22.775000000000002 27.950000000000003 25.45 23.825 6 19.875 32.550000000000004 24.875 22.7 7 15.0 26.200000000000003 41.199999999999996 17.599999999999998 8 17.075000000000003 26.174999999999997 31.3 25.45 9 17.75 23.025000000000002 36.199999999999996 23.025000000000002 10-14 19.21 29.17 28.439999999999998 23.18 15-19 19.36 27.584999999999997 27.825 25.230000000000004 20-24 18.91 28.08 28.000000000000004 25.009999999999998 25-29 19.71 27.625 28.03 24.635 30-34 19.994999999999997 27.72 27.54 24.745 35-39 19.215 27.96 27.944999999999997 24.88 40-44 19.455 28.720000000000002 27.845 23.98 45-49 19.465 27.384999999999998 28.175 24.975 50-54 19.465 28.060000000000002 27.57 24.905 55-59 19.525000000000002 27.625 28.325 24.525 60-64 19.45 27.33 28.01 25.21 65-69 20.035 27.625 28.32 24.02 70-74 20.585 28.26 27.215 23.94 75-79 20.515 27.860000000000003 27.41 24.215 80-84 19.855 28.07 27.83 24.245 85-89 19.994999999999997 27.700000000000003 27.985 24.32 90-94 20.06 28.265 27.265 24.41 95-99 20.09 27.595 27.834999999999997 24.48 100-104 19.735 28.03 27.705000000000002 24.529999999999998 105-109 19.935 27.88 27.779999999999998 24.404999999999998 110-114 19.96 27.97 27.805000000000003 24.265 115-119 20.745 27.425 27.46 24.37 120-124 20.265 27.534999999999997 27.395000000000003 24.805 125-129 20.419999999999998 27.775 27.63 24.175 130-134 20.51 27.35 28.07 24.07 135-139 20.474999999999998 28.03 27.534999999999997 23.96 140-144 20.45 27.474999999999998 28.005000000000003 24.07 145-149 20.73 27.894999999999996 27.589999999999996 23.785 150-151 21.125 27.35 27.6625 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 3.0 26 4.0 27 7.5 28 12.5 29 10.0 30 10.0 31 14.5 32 22.0 33 39.5 34 52.5 35 62.0 36 83.0 37 98.5 38 119.5 39 140.5 40 167.5 41 199.5 42 211.5 43 241.0 44 281.0 45 262.5 46 243.0 47 256.0 48 257.5 49 237.0 50 203.0 51 165.0 52 138.0 53 117.5 54 77.5 55 66.5 56 61.5 57 40.0 58 23.5 59 14.5 60 12.5 61 10.0 62 8.5 63 6.5 64 4.0 65 2.5 66 1.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.05 #Duplication Level Percentage of deduplicated Percentage of total 1 94.09888357256779 88.5 2 5.5289739500265815 10.4 3 0.3189792663476874 0.8999999999999999 4 0.053163211057947905 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.48750000000000004 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.2625000000000002 0.0 0.0 0.0 0.0 128-129 1.5499999999999998 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.8375 0.0 0.0 0.0 0.0 134-135 2.0250000000000004 0.0 0.0 0.0 0.0 136-137 2.2750000000000004 0.0 0.0 0.0 0.0 138-139 2.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGATT 10 0.006830828 145.0 6 AAAAAAA 35 0.0035366106 20.714287 110-114 >>END_MODULE SRR12161411 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161411_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.351 37.0 37.0 37.0 37.0 37.0 2 35.9395 37.0 37.0 37.0 37.0 37.0 3 35.9825 37.0 37.0 37.0 37.0 37.0 4 36.031 37.0 37.0 37.0 37.0 37.0 5 36.221 37.0 37.0 37.0 37.0 37.0 6 36.137 37.0 37.0 37.0 37.0 37.0 7 36.0505 37.0 37.0 37.0 37.0 37.0 8 36.291 37.0 37.0 37.0 37.0 37.0 9 36.246 37.0 37.0 37.0 37.0 37.0 10-14 36.1549 37.0 37.0 37.0 37.0 37.0 15-19 36.182900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.1478 37.0 37.0 37.0 37.0 37.0 25-29 36.066700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0828 37.0 37.0 37.0 37.0 37.0 35-39 36.0353 37.0 37.0 37.0 37.0 37.0 40-44 35.9731 37.0 37.0 37.0 37.0 37.0 45-49 35.9774 37.0 37.0 37.0 37.0 37.0 50-54 35.9705 37.0 37.0 37.0 37.0 37.0 55-59 35.89620000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.9039 37.0 37.0 37.0 37.0 37.0 65-69 35.881600000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.8173 37.0 37.0 37.0 37.0 37.0 75-79 35.8284 37.0 37.0 37.0 37.0 37.0 80-84 35.8686 37.0 37.0 37.0 37.0 37.0 85-89 35.8516 37.0 37.0 37.0 37.0 37.0 90-94 35.7798 37.0 37.0 37.0 37.0 37.0 95-99 35.7699 37.0 37.0 37.0 37.0 37.0 100-104 35.74570000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.755700000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.7299 37.0 37.0 37.0 37.0 37.0 115-119 35.680699999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.6914 37.0 37.0 37.0 37.0 37.0 125-129 35.556200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.4307 37.0 37.0 37.0 37.0 37.0 135-139 35.507099999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.411500000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.432399999999994 37.0 37.0 37.0 37.0 37.0 150-151 34.77625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 6.0 15 2.0 16 3.0 17 2.0 18 1.0 19 1.0 20 1.0 21 2.0 22 5.0 23 4.0 24 6.0 25 8.0 26 6.0 27 13.0 28 18.0 29 22.0 30 26.0 31 42.0 32 57.0 33 98.0 34 237.0 35 550.0 36 2657.0 37 230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.275 27.275 8.325000000000001 26.125 2 27.750000000000004 29.549999999999997 27.35 15.35 3 19.7 29.175 32.574999999999996 18.55 4 23.5 34.825 22.75 18.925 5 25.474999999999998 38.1 20.674999999999997 15.75 6 21.875 40.35 21.3 16.475 7 20.150000000000002 24.45 37.125 18.275 8 23.325000000000003 25.224999999999998 27.55 23.9 9 23.05 27.6 27.125 22.225 10-14 22.895 30.775000000000002 25.724999999999998 20.605 15-19 23.465 29.075 26.479999999999997 20.979999999999997 20-24 22.765 29.335 26.974999999999998 20.925 25-29 22.919999999999998 28.34 27.12 21.62 30-34 22.71 29.054999999999996 26.845000000000002 21.39 35-39 22.55 28.37 28.095 20.985 40-44 22.830000000000002 28.050000000000004 27.834999999999997 21.285 45-49 22.939999999999998 28.735 27.495000000000005 20.830000000000002 50-54 23.075000000000003 28.03 27.529999999999998 21.365000000000002 55-59 23.895 26.955000000000002 27.365000000000002 21.785 60-64 23.09 28.299999999999997 27.37 21.240000000000002 65-69 23.03 28.060000000000002 27.46 21.45 70-74 23.535 27.445000000000004 27.939999999999998 21.08 75-79 23.445 27.985 27.255000000000003 21.315 80-84 23.07 28.48 27.67 20.78 85-89 23.785 28.42 27.295 20.5 90-94 23.43 28.199999999999996 26.72 21.65 95-99 23.695 28.449999999999996 27.325 20.53 100-104 23.16 28.4 27.145000000000003 21.295 105-109 23.735 27.905 27.339999999999996 21.02 110-114 24.07 28.65 27.055 20.225 115-119 24.335 27.900000000000002 27.13 20.635 120-124 23.674999999999997 28.575 27.37 20.380000000000003 125-129 23.615 28.095 27.21 21.08 130-134 24.51 27.860000000000003 27.345000000000002 20.285 135-139 24.365000000000002 28.22 27.089999999999996 20.325 140-144 24.555 27.439999999999998 27.025 20.979999999999997 145-149 24.645 28.000000000000004 26.875 20.48 150-151 23.724999999999998 28.499999999999996 27.700000000000003 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.0 19 0.5 20 1.0 21 0.5 22 2.0 23 3.0 24 2.0 25 2.5 26 4.0 27 3.5 28 2.5 29 5.0 30 13.0 31 27.0 32 30.0 33 36.0 34 51.5 35 70.5 36 86.5 37 107.0 38 132.0 39 160.0 40 193.0 41 227.0 42 249.5 43 247.5 44 257.5 45 273.0 46 279.5 47 245.5 48 221.0 49 216.5 50 167.5 51 125.5 52 113.5 53 100.5 54 74.5 55 63.5 56 56.5 57 35.0 58 25.5 59 26.0 60 17.0 61 7.5 62 7.5 63 6.5 64 4.0 65 1.5 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 94.17553191489361 88.52499999999999 2 5.3989361702127665 10.15 3 0.3191489361702127 0.8999999999999999 4 0.07978723404255318 0.3 5 0.026595744680851064 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGCAATTCACAACGATTATTCTTCAGCAGACGACCAACCAGCAAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.7000000000000002 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.2750000000000004 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTGTA 10 0.006830828 145.0 145 GATTTGA 10 0.006830828 145.0 4 GGCTACT 10 0.006830828 145.0 1 TACTTCC 10 0.006830828 145.0 4 >>END_MODULE Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784628 spots for SRR12161411.sra Written 784628 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra Read 784610 spots for SRR12161411.sra Written 784610 spots for SRR12161411.sra SRR ids: ['SRR12161411.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__b1ke61x SRR12161411.sra spots: 15692218 blocks: [[1, 784610], [784611, 1569220], [1569221, 2353830], [2353831, 3138440], [3138441, 3923050], [3923051, 4707660], [4707661, 5492270], [5492271, 6276880], [6276881, 7061490], [7061491, 7846100], [7846101, 8630710], [8630711, 9415320], [9415321, 10199930], [10199931, 10984540], [10984541, 11769150], [11769151, 12553760], [12553761, 13338370], [13338371, 14122980], [14122981, 14907590], [14907591, 15692218]] SRR12161411 file size 5311201 SRR12161411 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161411 SRR12161411_1.fastq SRR12161411_2.fastq Input file: SRR12161411_1.fastq Paired file: SRR12161411_2.fastq trimmed: SRR12161411-trimmed-pair1.fastq, SRR12161411-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:26:44 2025 >> started Thu Feb 13 21:27:01 2025 >> done (17.788s) 15692218 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 1644 ( 0.01%) empty read pairs filtered out after trimming by size control 15690554 (99.99%) read pairs available; of these: 598902 ( 3.82%) trimmed read pairs available after processing 15091652 (96.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 8 0.00% 22 2 0.00% 23 9 0.00% 24 0 0.00% 25 6 0.00% 26 10 0.00% 27 6 0.00% 28 6 0.00% 29 7 0.00% 30 15 0.00% 31 8 0.00% 32 11 0.00% 33 21 0.00% 34 16 0.00% 35 8 0.00% 36 10 0.00% 37 13 0.00% 38 11 0.00% 39 10 0.00% 40 9 0.00% 41 11 0.00% 42 12 0.00% 43 11 0.00% 44 14 0.00% 45 17 0.00% 46 9 0.00% 47 13 0.00% 48 16 0.00% 49 12 0.00% 50 23 0.00% 51 21 0.00% 52 26 0.00% 53 26 0.00% 54 20 0.00% 55 21 0.00% 56 29 0.00% 57 37 0.00% 58 28 0.00% 59 25 0.00% 60 45 0.00% 61 38 0.00% 62 33 0.00% 63 54 0.00% 64 62 0.00% 65 54 0.00% 66 67 0.00% 67 89 0.00% 68 79 0.00% 69 75 0.00% 70 103 0.00% 71 102 0.00% 72 136 0.00% 73 150 0.00% 74 145 0.00% 75 178 0.00% 76 191 0.00% 77 212 0.00% 78 268 0.00% 79 264 0.00% 80 289 0.00% 81 353 0.00% 82 435 0.00% 83 444 0.00% 84 493 0.00% 85 557 0.00% 86 568 0.00% 87 649 0.00% 88 776 0.00% 89 789 0.01% 90 870 0.01% 91 957 0.01% 92 1079 0.01% 93 1270 0.01% 94 1397 0.01% 95 1514 0.01% 96 1648 0.01% 97 1821 0.01% 98 1932 0.01% 99 2062 0.01% 100 2371 0.02% 101 2481 0.02% 102 2623 0.02% 103 2904 0.02% 104 3109 0.02% 105 3387 0.02% 106 3561 0.02% 107 3851 0.02% 108 4010 0.03% 109 4280 0.03% 110 4633 0.03% 111 4942 0.03% 112 5237 0.03% 113 5461 0.03% 114 5821 0.04% 115 6224 0.04% 116 6408 0.04% 117 6822 0.04% 118 7074 0.05% 119 7594 0.05% 120 7915 0.05% 121 8270 0.05% 122 8619 0.05% 123 9158 0.06% 124 9472 0.06% 125 10044 0.06% 126 10598 0.07% 127 11260 0.07% 128 11614 0.07% 129 11988 0.08% 130 12386 0.08% 131 12922 0.08% 132 13635 0.09% 133 14126 0.09% 134 14665 0.09% 135 15182 0.10% 136 15895 0.10% 137 16089 0.10% 138 16820 0.11% 139 17426 0.11% 140 17804 0.11% 141 18483 0.12% 142 19661 0.13% 143 19826 0.13% 144 20677 0.13% 145 21518 0.14% 146 22326 0.14% 147 22538 0.14% 148 23300 0.15% 149 24087 0.15% 150 24993 0.16% 151 15091652 96.18% 15690554 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=28 prefix-density=0.39 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.24 sequence-density-rank=7 fanout-score=36.73 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=10.2 sequence=TCATCTTCAATCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=32 prefix-density=0.43 prefix-fanout=2.3 sequence=GATCCTTTCTCTCTTGACGTTTGGGACCCTTTAAAGGATTTCCCTTTTCCTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=441.95 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=19.1 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12161411 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:28:04 Started mapping on | Feb 13 21:28:04 Finished on | Feb 13 21:29:40 Mapping speed, Million of reads per hour | 588.40 Number of input reads | 15690554 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14165823 Uniquely mapped reads % | 90.28% Average mapped length | 295.66 Number of splices: Total | 13367112 Number of splices: Annotated (sjdb) | 12965160 Number of splices: GT/AG | 13117451 Number of splices: GC/AG | 202022 Number of splices: AT/AC | 12753 Number of splices: Non-canonical | 34886 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418925 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 147140 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.91% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1105806 1105806 1105806 N_multimapping 418925 418925 418925 N_noFeature 490829 14006071 547951 N_ambiguous 223108 1394 119556 UnstrandedReadsAssigned:13451886 PositiveStrandReadsAssigned:158358 NegativeStrandReadsAssigned:13498316 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161411 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161411-trimmed-pair1.fastq SRR12161411-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,690,554 reads, 14,030,349 reads pseudoaligned [quant] estimated average fragment length: 278.641 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52401 SRR12161411.ke.tsv 34699 SRR12161411.se.tsv 87100 total ==> SRR12161411.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.36 745 26.733 Potri.005G024800.1.v4.1 1035 757.359 330 27.2109 Potri.004G059700.1.v4.1 961 683.556 100 9.13601 Potri.007G009000.2.v4.1 1416 1138.36 0 0 Potri.003G141000.2.v4.1 2943 2665.36 519 12.1603 Potri.016G087400.1.v4.1 270 68.7072 1100 999.819 Potri.015G069301.1.v4.1 564 300.575 0 0 Potri.010G195200.1.v4.1 1773 1495.36 15 0.626436 Potri.012G127500.1.v4.1 977 699.469 355 31.695 ==> SRR12161411.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 393 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 133 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR12161411 completed mapping pipeline successfully