Starting /dee2/code/volunteer_pipeline.sh SRR12161412 current disk space = 3088574763008 free memory = 1582527376 SRR12161412 SRAfilesize df3ef6ded85ac902cc743826ea7650ab SRR12161412.sra SRR12161412.sra file validated SRR12161412 is paired end SRR12161412 is conventional basespace SRR12161412 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161412_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.52725 37.0 37.0 37.0 37.0 37.0 2 36.4955 37.0 37.0 37.0 37.0 37.0 3 36.5395 37.0 37.0 37.0 37.0 37.0 4 36.538 37.0 37.0 37.0 37.0 37.0 5 36.4785 37.0 37.0 37.0 37.0 37.0 6 36.575 37.0 37.0 37.0 37.0 37.0 7 36.501 37.0 37.0 37.0 37.0 37.0 8 36.506 37.0 37.0 37.0 37.0 37.0 9 36.567 37.0 37.0 37.0 37.0 37.0 10-14 36.56379999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5493 37.0 37.0 37.0 37.0 37.0 20-24 36.4975 37.0 37.0 37.0 37.0 37.0 25-29 36.4365 37.0 37.0 37.0 37.0 37.0 30-34 36.437799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.439099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.40769999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.3993 37.0 37.0 37.0 37.0 37.0 50-54 36.3377 37.0 37.0 37.0 37.0 37.0 55-59 36.389599999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.3665 37.0 37.0 37.0 37.0 37.0 65-69 36.3314 37.0 37.0 37.0 37.0 37.0 70-74 36.3826 37.0 37.0 37.0 37.0 37.0 75-79 36.3394 37.0 37.0 37.0 37.0 37.0 80-84 36.327600000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2868 37.0 37.0 37.0 37.0 37.0 90-94 36.306200000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.20550000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.2495 37.0 37.0 37.0 37.0 37.0 105-109 36.160700000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.142799999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.202999999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.102999999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0372 37.0 37.0 37.0 37.0 37.0 130-134 36.081900000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.964099999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.95139999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.923199999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.847 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 4.0 27 13.0 28 10.0 29 20.0 30 32.0 31 30.0 32 42.0 33 64.0 34 112.0 35 305.0 36 2955.0 37 411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.335583895974 12.678169542385595 5.52638159539885 39.45986496624156 2 19.925 13.625000000000002 36.125 30.325000000000003 3 17.325 14.249999999999998 27.700000000000003 40.725 4 21.2 25.874999999999996 22.975 29.95 5 21.8 32.725 24.15 21.325 6 21.349999999999998 34.125 23.45 21.075 7 15.825 28.025 39.625 16.525000000000002 8 17.675 25.85 32.75 23.724999999999998 9 17.925 23.849999999999998 35.099999999999994 23.125 10-14 20.04 29.985 27.779999999999998 22.195 15-19 20.285 27.905 28.34 23.47 20-24 20.505000000000003 28.134999999999998 27.715 23.645 25-29 19.81 28.499999999999996 27.52 24.169999999999998 30-34 19.965 28.515 27.395000000000003 24.125 35-39 20.125 27.74 28.08 24.055 40-44 20.22 28.515 26.935 24.33 45-49 19.91 28.915000000000003 26.965 24.21 50-54 20.14 27.810000000000002 27.884999999999998 24.165 55-59 20.405 28.7 26.729999999999997 24.165 60-64 20.485 28.395 26.810000000000002 24.310000000000002 65-69 20.365 28.67 27.21 23.755000000000003 70-74 21.05 28.645 27.12 23.185 75-79 20.75 28.37 26.840000000000003 24.04 80-84 20.39 28.060000000000002 27.765 23.785 85-89 20.645 28.139999999999997 27.79 23.425 90-94 20.395 28.725 26.76 24.12 95-99 20.51 28.535 27.345000000000002 23.61 100-104 20.595 28.73 27.22 23.455000000000002 105-109 20.3 27.694999999999997 27.91 24.095 110-114 20.474999999999998 27.905 27.445000000000004 24.175 115-119 21.105 28.349999999999998 27.22 23.325000000000003 120-124 20.599999999999998 28.044999999999998 27.435 23.919999999999998 125-129 20.4 28.62 26.93 24.05 130-134 21.09 27.944999999999997 27.644999999999996 23.32 135-139 20.68 28.060000000000002 27.339999999999996 23.919999999999998 140-144 20.95 28.12 27.185 23.745 145-149 20.595 28.994999999999997 27.065 23.345 150-151 20.825 28.575 26.387500000000003 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 3.0 25 3.0 26 5.0 27 6.5 28 10.5 29 14.5 30 16.5 31 21.0 32 29.0 33 39.5 34 46.0 35 60.5 36 82.5 37 103.5 38 122.0 39 145.5 40 175.5 41 199.0 42 217.5 43 230.0 44 266.5 45 285.0 46 255.5 47 248.0 48 257.0 49 236.0 50 185.0 51 151.5 52 139.5 53 116.5 54 90.5 55 64.0 56 47.0 57 34.5 58 21.0 59 20.5 60 21.0 61 11.5 62 2.5 63 2.5 64 3.0 65 3.5 66 2.5 67 0.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.72016895459345 89.7 2 4.963041182682154 9.4 3 0.31678986272439286 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0125 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.075 0.0 0.0 0.025 0.0 90-91 0.0875 0.0 0.0 0.025 0.0 92-93 0.125 0.0 0.0 0.025 0.0 94-95 0.175 0.0 0.0 0.025 0.0 96-97 0.1875 0.0 0.0 0.025 0.0 98-99 0.2375 0.0 0.0 0.025 0.0 100-101 0.275 0.0 0.0 0.025 0.0 102-103 0.3125 0.0 0.0 0.025 0.0 104-105 0.36250000000000004 0.0 0.0 0.025 0.0 106-107 0.425 0.0 0.0 0.025 0.0 108-109 0.525 0.0 0.0 0.025 0.0 110-111 0.575 0.0 0.0 0.025 0.0 112-113 0.6375 0.0 0.0 0.025 0.0 114-115 0.725 0.0 0.0 0.025 0.0 116-117 0.7875 0.0 0.0 0.025 0.0 118-119 0.95 0.0 0.0 0.025 0.0 120-121 1.05 0.0 0.0 0.025 0.0 122-123 1.2375 0.0 0.0 0.025 0.0 124-125 1.3624999999999998 0.0 0.0 0.025 0.0 126-127 1.475 0.0 0.0 0.025 0.0 128-129 1.5375 0.0 0.0 0.025 0.0 130-131 1.725 0.0 0.0 0.025 0.0 132-133 1.8625 0.0 0.0 0.025 0.0 134-135 2.0 0.0 0.0 0.025 0.0 136-137 2.3 0.0 0.0 0.025 0.0 138-139 2.575 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTGCT 10 0.006830828 145.0 145 >>END_MODULE SRR12161412 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161412_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1915 37.0 37.0 37.0 37.0 37.0 2 35.928 37.0 37.0 37.0 37.0 37.0 3 35.9725 37.0 37.0 37.0 37.0 37.0 4 35.997 37.0 37.0 37.0 37.0 37.0 5 36.036 37.0 37.0 37.0 37.0 37.0 6 36.1835 37.0 37.0 37.0 37.0 37.0 7 36.1425 37.0 37.0 37.0 37.0 37.0 8 36.2145 37.0 37.0 37.0 37.0 37.0 9 36.2 37.0 37.0 37.0 37.0 37.0 10-14 36.2111 37.0 37.0 37.0 37.0 37.0 15-19 36.161899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0851 37.0 37.0 37.0 37.0 37.0 25-29 36.0604 37.0 37.0 37.0 37.0 37.0 30-34 36.0647 37.0 37.0 37.0 37.0 37.0 35-39 36.0663 37.0 37.0 37.0 37.0 37.0 40-44 35.941199999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.978300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0056 37.0 37.0 37.0 37.0 37.0 55-59 35.9661 37.0 37.0 37.0 37.0 37.0 60-64 35.8937 37.0 37.0 37.0 37.0 37.0 65-69 35.9349 37.0 37.0 37.0 37.0 37.0 70-74 35.7803 37.0 37.0 37.0 37.0 37.0 75-79 35.7916 37.0 37.0 37.0 37.0 37.0 80-84 35.8742 37.0 37.0 37.0 37.0 37.0 85-89 35.768600000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.7756 37.0 37.0 37.0 37.0 37.0 95-99 35.735 37.0 37.0 37.0 37.0 37.0 100-104 35.7627 37.0 37.0 37.0 37.0 37.0 105-109 35.766400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.658699999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.694599999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.735499999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.5242 37.0 37.0 37.0 37.0 37.0 130-134 35.410199999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.556799999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.466300000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.532 37.0 37.0 37.0 37.0 37.0 150-151 34.8835 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 2.0 15 2.0 16 2.0 17 1.0 18 1.0 19 1.0 20 0.0 21 4.0 22 2.0 23 8.0 24 7.0 25 4.0 26 11.0 27 23.0 28 13.0 29 18.0 30 24.0 31 46.0 32 62.0 33 101.0 34 208.0 35 566.0 36 2650.0 37 239.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.375 26.650000000000002 8.6 26.375 2 27.625 27.925 28.275 16.175 3 19.85 27.900000000000002 31.724999999999998 20.525 4 22.45 34.75 23.075000000000003 19.725 5 25.674999999999997 37.25 20.8 16.275000000000002 6 20.125 39.35 21.75 18.775 7 20.525 23.325000000000003 38.15 18.0 8 21.425 24.725 28.375 25.474999999999998 9 21.325 24.9 29.825000000000003 23.95 10-14 23.119999999999997 30.209999999999997 25.6 21.07 15-19 23.200000000000003 28.655 26.87 21.275 20-24 23.505000000000003 28.785 26.745 20.965 25-29 23.865 28.449999999999996 26.619999999999997 21.065 30-34 22.88 28.275 28.07 20.775 35-39 22.84 28.199999999999996 27.439999999999998 21.52 40-44 23.22 27.925 27.74 21.115000000000002 45-49 22.650000000000002 28.275 28.065 21.01 50-54 23.7 27.76 27.560000000000002 20.979999999999997 55-59 23.375 27.165 28.09 21.37 60-64 23.115 27.865000000000002 27.79 21.23 65-69 23.549999999999997 26.685 28.38 21.385 70-74 23.419999999999998 27.575 27.439999999999998 21.565 75-79 23.14 27.6 27.939999999999998 21.32 80-84 23.665 28.194999999999997 26.875 21.265 85-89 23.21 28.17 27.765 20.855 90-94 23.330000000000002 27.775 27.43 21.465 95-99 23.785 27.650000000000002 27.779999999999998 20.785 100-104 23.355 27.810000000000002 27.810000000000002 21.025 105-109 23.21 27.855 28.050000000000004 20.885 110-114 23.89 27.985 26.805 21.32 115-119 23.965 27.74 27.41 20.885 120-124 23.815 27.965 27.43 20.79 125-129 24.099999999999998 28.28 26.51 21.11 130-134 24.205 28.144999999999996 27.115000000000002 20.535 135-139 23.775 27.68 27.639999999999997 20.905 140-144 24.38 27.925 26.950000000000003 20.745 145-149 24.385 27.284999999999997 27.800000000000004 20.53 150-151 25.25 27.537499999999998 26.424999999999997 20.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 1.0 12 1.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 2.5 24 4.5 25 5.0 26 3.5 27 3.0 28 7.5 29 14.0 30 16.0 31 16.0 32 21.5 33 31.5 34 47.0 35 58.0 36 76.5 37 109.5 38 129.5 39 151.0 40 192.0 41 218.5 42 237.0 43 243.5 44 254.0 45 264.0 46 268.0 47 273.5 48 258.0 49 223.5 50 180.0 51 156.0 52 120.0 53 89.0 54 78.5 55 62.0 56 44.0 57 31.5 58 25.0 59 19.0 60 16.0 61 10.5 62 4.5 63 3.5 64 2.0 65 1.5 66 1.5 67 2.0 68 2.0 69 0.5 70 1.0 71 1.0 72 1.0 73 1.0 74 0.0 75 1.0 76 1.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.73405662873776 89.5 2 4.789626885419422 9.049999999999999 3 0.37046837787774545 1.05 4 0.10584810796507012 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.4874999999999998 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.8375 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.2375 0.0 0.0 0.0 0.0 138-139 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCAG 10 0.006830828 145.0 8 ATTCAAG 10 0.006830828 145.0 1 >>END_MODULE Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799389 spots for SRR12161412.sra Written 799389 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra Read 799378 spots for SRR12161412.sra Written 799378 spots for SRR12161412.sra SRR ids: ['SRR12161412.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1zmwdo0q SRR12161412.sra spots: 15987571 blocks: [[1, 799378], [799379, 1598756], [1598757, 2398134], [2398135, 3197512], [3197513, 3996890], [3996891, 4796268], [4796269, 5595646], [5595647, 6395024], [6395025, 7194402], [7194403, 7993780], [7993781, 8793158], [8793159, 9592536], [9592537, 10391914], [10391915, 11191292], [11191293, 11990670], [11990671, 12790048], [12790049, 13589426], [13589427, 14388804], [14388805, 15188182], [15188183, 15987571]] SRR12161412 file size 5411575 SRR12161412 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161412 SRR12161412_1.fastq SRR12161412_2.fastq Input file: SRR12161412_1.fastq Paired file: SRR12161412_2.fastq trimmed: SRR12161412-trimmed-pair1.fastq, SRR12161412-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:10:08 2025 >> started Thu Feb 13 22:10:27 2025 >> done (18.418s) 15987571 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 735 ( 0.00%) empty read pairs filtered out after trimming by size control 15986822 (100.00%) read pairs available; of these: 742054 ( 4.64%) trimmed read pairs available after processing 15244768 (95.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 2 0.00% 23 1 0.00% 24 4 0.00% 25 5 0.00% 26 12 0.00% 27 6 0.00% 28 6 0.00% 29 2 0.00% 30 6 0.00% 31 6 0.00% 32 13 0.00% 33 6 0.00% 34 7 0.00% 35 2 0.00% 36 11 0.00% 37 8 0.00% 38 7 0.00% 39 11 0.00% 40 5 0.00% 41 13 0.00% 42 8 0.00% 43 13 0.00% 44 14 0.00% 45 13 0.00% 46 17 0.00% 47 17 0.00% 48 15 0.00% 49 16 0.00% 50 13 0.00% 51 26 0.00% 52 17 0.00% 53 13 0.00% 54 29 0.00% 55 27 0.00% 56 23 0.00% 57 32 0.00% 58 31 0.00% 59 35 0.00% 60 56 0.00% 61 50 0.00% 62 60 0.00% 63 67 0.00% 64 60 0.00% 65 74 0.00% 66 60 0.00% 67 91 0.00% 68 92 0.00% 69 114 0.00% 70 119 0.00% 71 132 0.00% 72 178 0.00% 73 161 0.00% 74 200 0.00% 75 240 0.00% 76 246 0.00% 77 244 0.00% 78 312 0.00% 79 341 0.00% 80 426 0.00% 81 457 0.00% 82 469 0.00% 83 610 0.00% 84 600 0.00% 85 666 0.00% 86 762 0.00% 87 858 0.01% 88 991 0.01% 89 1073 0.01% 90 1127 0.01% 91 1239 0.01% 92 1498 0.01% 93 1584 0.01% 94 1870 0.01% 95 2036 0.01% 96 2130 0.01% 97 2401 0.02% 98 2622 0.02% 99 2812 0.02% 100 3088 0.02% 101 3165 0.02% 102 3462 0.02% 103 3979 0.02% 104 4010 0.03% 105 4504 0.03% 106 4862 0.03% 107 5059 0.03% 108 5426 0.03% 109 5661 0.04% 110 6005 0.04% 111 6257 0.04% 112 6831 0.04% 113 7092 0.04% 114 7615 0.05% 115 8214 0.05% 116 8634 0.05% 117 9209 0.06% 118 9486 0.06% 119 9902 0.06% 120 10447 0.07% 121 10871 0.07% 122 11339 0.07% 123 12013 0.08% 124 12449 0.08% 125 12952 0.08% 126 13523 0.08% 127 14242 0.09% 128 14572 0.09% 129 15071 0.09% 130 15744 0.10% 131 16227 0.10% 132 16903 0.11% 133 17439 0.11% 134 18226 0.11% 135 18669 0.12% 136 19067 0.12% 137 19915 0.12% 138 20532 0.13% 139 21287 0.13% 140 21890 0.14% 141 22439 0.14% 142 23042 0.14% 143 23812 0.15% 144 24619 0.15% 145 25156 0.16% 146 26240 0.16% 147 26623 0.17% 148 27622 0.17% 149 27665 0.17% 150 29365 0.18% 151 15244768 95.36% 15986822 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.77 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=11.60 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.9 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.87 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=69.93 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=3.9 sequence=CTCCAGCACACAATACCAGCAAAAACCAGAACAAAAAACCTCTAGAATGGCCACTGTCACCTCTGCTGCTGTTTCAATCCCTTCTTTCACTGGTCTTAAGGCAGGCAGTGCCTCCAATGCTAAAGTCAGTGCCAGTGCCAAGGTCTCAGCCTCTCCACTCCCAAGGCTCAGCATCAAGGCCTCAATGAAAGACGTTGGTGCTGCCGTTGTCGCCACCGCTGCTAGCGCAATGATTGCTAGCAATGCTATGGCCATCGACGTCTTGCTTGGAG SRR12161412 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:11:11 Started mapping on | Feb 13 22:11:11 Finished on | Feb 13 22:12:50 Mapping speed, Million of reads per hour | 581.34 Number of input reads | 15986822 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14953575 Uniquely mapped reads % | 93.54% Average mapped length | 298.97 Number of splices: Total | 14895261 Number of splices: Annotated (sjdb) | 14543224 Number of splices: GT/AG | 14600032 Number of splices: GC/AG | 240919 Number of splices: AT/AC | 13487 Number of splices: Non-canonical | 40823 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 439751 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 116868 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593496 593496 593496 N_multimapping 439751 439751 439751 N_noFeature 528112 14778129 584711 N_ambiguous 214725 909 95348 UnstrandedReadsAssigned:14210738 PositiveStrandReadsAssigned:174537 NegativeStrandReadsAssigned:14273516 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161412 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161412-trimmed-pair1.fastq SRR12161412-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,986,822 reads, 14,362,738 reads pseudoaligned [quant] estimated average fragment length: 281.26 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR12161412.ke.tsv 34699 SRR12161412.se.tsv 87100 total ==> SRR12161412.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.74 355 12.4831 Potri.005G024800.1.v4.1 1035 754.74 142 11.4966 Potri.004G059700.1.v4.1 961 680.916 90 8.07659 Potri.007G009000.2.v4.1 1416 1135.74 0 0 Potri.003G141000.2.v4.1 2943 2662.74 386 8.85804 Potri.016G087400.1.v4.1 270 68.9932 1119 991.066 Potri.015G069301.1.v4.1 564 298.204 0 0 Potri.010G195200.1.v4.1 1773 1492.74 4 0.16374 Potri.012G127500.1.v4.1 977 696.841 4310 377.939 ==> SRR12161412.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 252 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR12161412 completed mapping pipeline successfully