Starting /dee2/code/volunteer_pipeline.sh SRR12161413 current disk space = 3088225087488 free memory = 1431404292 SRR12161413 SRAfilesize 358245b8a9b9b8ad535d3ad5d170739b SRR12161413.sra SRR12161413.sra file validated SRR12161413 is paired end SRR12161413 is conventional basespace SRR12161413 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161413_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.56675 37.0 37.0 37.0 37.0 37.0 2 36.3915 37.0 37.0 37.0 37.0 37.0 3 36.448 37.0 37.0 37.0 37.0 37.0 4 36.472 37.0 37.0 37.0 37.0 37.0 5 36.591 37.0 37.0 37.0 37.0 37.0 6 36.518 37.0 37.0 37.0 37.0 37.0 7 36.5435 37.0 37.0 37.0 37.0 37.0 8 36.465 37.0 37.0 37.0 37.0 37.0 9 36.534 37.0 37.0 37.0 37.0 37.0 10-14 36.551100000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5227 37.0 37.0 37.0 37.0 37.0 20-24 36.482 37.0 37.0 37.0 37.0 37.0 25-29 36.414699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4179 37.0 37.0 37.0 37.0 37.0 35-39 36.390699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.414699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4095 37.0 37.0 37.0 37.0 37.0 50-54 36.33389999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.31510000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.3409 37.0 37.0 37.0 37.0 37.0 65-69 36.284800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.308099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.244 37.0 37.0 37.0 37.0 37.0 80-84 36.2725 37.0 37.0 37.0 37.0 37.0 85-89 36.2139 37.0 37.0 37.0 37.0 37.0 90-94 36.201499999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.177400000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.17620000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.09439999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.115899999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1105 37.0 37.0 37.0 37.0 37.0 120-124 36.063 37.0 37.0 37.0 37.0 37.0 125-129 35.9882 37.0 37.0 37.0 37.0 37.0 130-134 35.9873 37.0 37.0 37.0 37.0 37.0 135-139 35.92139999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.871399999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.8701 37.0 37.0 37.0 37.0 37.0 150-151 35.77775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 1.0 26 8.0 27 11.0 28 9.0 29 19.0 30 27.0 31 39.0 32 49.0 33 81.0 34 133.0 35 291.0 36 2930.0 37 400.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.236059014753685 11.677919479869967 5.401350337584396 38.68467116779195 2 19.1 12.3 34.65 33.95 3 16.5 16.075 30.425 37.0 4 21.575 24.55 24.55 29.325000000000003 5 22.575 31.474999999999998 25.124999999999996 20.825 6 20.525 34.075 23.575 21.825 7 14.625 27.125 41.199999999999996 17.05 8 18.4 25.7 32.875 23.025000000000002 9 17.4 23.35 35.375 23.875 10-14 20.415 29.485 26.865 23.235 15-19 19.38 27.71 28.08 24.83 20-24 19.78 28.29 27.675 24.255 25-29 19.63 28.17 28.575 23.625 30-34 19.845 28.655 26.86 24.64 35-39 20.075000000000003 27.560000000000002 27.87 24.495 40-44 19.99 28.115000000000002 27.96 23.935000000000002 45-49 20.04 28.055000000000003 27.985 23.919999999999998 50-54 20.09 27.485 28.084999999999997 24.34 55-59 20.04 28.634999999999998 27.295 24.03 60-64 20.19 27.51 27.515 24.785 65-69 20.830000000000002 27.689999999999998 27.93 23.549999999999997 70-74 20.095 28.055000000000003 27.52 24.33 75-79 19.755 27.91 27.88 24.455 80-84 20.200000000000003 28.360000000000003 27.839999999999996 23.599999999999998 85-89 19.900000000000002 28.23 27.725 24.145 90-94 19.98 27.46 28.455000000000002 24.104999999999997 95-99 20.07 27.994999999999997 27.72 24.215 100-104 20.349999999999998 27.57 27.77 24.310000000000002 105-109 20.51 27.810000000000002 27.77 23.91 110-114 20.810000000000002 27.450000000000003 27.894999999999996 23.845 115-119 20.695 27.779999999999998 27.79 23.735 120-124 20.8 28.04 27.595 23.565 125-129 20.91 26.705000000000002 28.199999999999996 24.185000000000002 130-134 20.925 28.01 27.525 23.54 135-139 20.82 27.534999999999997 27.834999999999997 23.810000000000002 140-144 21.065 27.935 27.13 23.87 145-149 20.935000000000002 27.93 27.089999999999996 24.044999999999998 150-151 20.8625 27.375 26.474999999999998 25.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 2.0 24 3.0 25 3.0 26 3.5 27 6.5 28 13.0 29 16.0 30 18.0 31 21.0 32 28.0 33 39.0 34 52.0 35 60.5 36 75.0 37 98.5 38 111.0 39 137.5 40 175.0 41 200.0 42 221.5 43 248.0 44 278.5 45 266.0 46 245.5 47 254.0 48 248.0 49 223.5 50 196.0 51 163.5 52 136.5 53 120.0 54 86.5 55 67.0 56 46.5 57 26.0 58 29.0 59 24.5 60 17.0 61 13.0 62 10.5 63 5.0 64 1.0 65 0.5 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.48437910212654 90.925 2 4.148070359674455 7.9 3 0.2625360987135731 0.75 4 0.07876082961407194 0.3 5 0.026253609871357313 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.575 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.725 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.2750000000000004 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACAG 10 0.006830828 145.0 7 GGCGCAG 10 0.006830828 145.0 7 GCGGCGC 10 0.006830828 145.0 5 CGGCGCA 10 0.006830828 145.0 6 ACTTAGT 10 0.006830828 145.0 6 CGCAGAA 10 0.006830828 145.0 9 GCTTGCG 10 0.006830828 145.0 1 CTTGCGG 10 0.006830828 145.0 2 GCGCAGA 10 0.006830828 145.0 8 TTGCGGC 10 0.006830828 145.0 3 >>END_MODULE SRR12161413 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161413_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.385 37.0 37.0 37.0 37.0 37.0 2 35.894 37.0 37.0 37.0 37.0 37.0 3 36.0305 37.0 37.0 37.0 37.0 37.0 4 36.021 37.0 37.0 37.0 37.0 37.0 5 36.1885 37.0 37.0 37.0 37.0 37.0 6 36.1675 37.0 37.0 37.0 37.0 37.0 7 36.212 37.0 37.0 37.0 37.0 37.0 8 36.2875 37.0 37.0 37.0 37.0 37.0 9 36.316 37.0 37.0 37.0 37.0 37.0 10-14 36.2071 37.0 37.0 37.0 37.0 37.0 15-19 36.257099999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.2318 37.0 37.0 37.0 37.0 37.0 25-29 36.183299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.1346 37.0 37.0 37.0 37.0 37.0 35-39 36.122400000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.1111 37.0 37.0 37.0 37.0 37.0 45-49 36.0268 37.0 37.0 37.0 37.0 37.0 50-54 36.0472 37.0 37.0 37.0 37.0 37.0 55-59 36.0437 37.0 37.0 37.0 37.0 37.0 60-64 35.9863 37.0 37.0 37.0 37.0 37.0 65-69 35.973200000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.8583 37.0 37.0 37.0 37.0 37.0 75-79 35.8885 37.0 37.0 37.0 37.0 37.0 80-84 35.8529 37.0 37.0 37.0 37.0 37.0 85-89 35.8277 37.0 37.0 37.0 37.0 37.0 90-94 35.8439 37.0 37.0 37.0 37.0 37.0 95-99 35.83140000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.7731 37.0 37.0 37.0 37.0 37.0 105-109 35.780699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7548 37.0 37.0 37.0 37.0 37.0 115-119 35.7149 37.0 37.0 37.0 37.0 37.0 120-124 35.693799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6379 37.0 37.0 37.0 37.0 37.0 130-134 35.5212 37.0 37.0 37.0 37.0 37.0 135-139 35.5387 37.0 37.0 37.0 37.0 37.0 140-144 35.4856 37.0 37.0 37.0 37.0 37.0 145-149 35.577999999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.102999999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 3.0 16 1.0 17 0.0 18 1.0 19 1.0 20 2.0 21 1.0 22 2.0 23 5.0 24 2.0 25 10.0 26 10.0 27 17.0 28 16.0 29 24.0 30 27.0 31 42.0 32 59.0 33 109.0 34 199.0 35 523.0 36 2686.0 37 257.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.275000000000006 25.724999999999998 7.475 23.525 2 29.475 26.150000000000002 28.4 15.975 3 20.225 29.475 31.75 18.55 4 23.400000000000002 34.9 23.825 17.875 5 24.25 37.7 20.525 17.525 6 21.75 40.8 20.674999999999997 16.775000000000002 7 20.724999999999998 23.775 36.6 18.9 8 20.674999999999997 27.1 28.199999999999996 24.025 9 21.675 25.825 28.349999999999998 24.15 10-14 22.735 30.735 25.82 20.71 15-19 23.05 28.895 27.33 20.724999999999998 20-24 23.305 29.145 26.68 20.87 25-29 22.955000000000002 29.409999999999997 26.945000000000004 20.69 30-34 22.71 28.88 27.279999999999998 21.13 35-39 22.74 28.749999999999996 27.42 21.09 40-44 22.555 28.52 27.425 21.5 45-49 22.98 27.625 27.755000000000003 21.64 50-54 22.6 28.09 27.79 21.52 55-59 23.235 27.529999999999998 28.035 21.2 60-64 23.265 27.985 27.224999999999998 21.525 65-69 23.044999999999998 27.889999999999997 27.85 21.215 70-74 23.369999999999997 27.87 27.325 21.435000000000002 75-79 22.994999999999997 28.389999999999997 27.534999999999997 21.08 80-84 23.54 28.360000000000003 27.275 20.825 85-89 23.745 27.084999999999997 27.474999999999998 21.695 90-94 23.28 28.01 27.18 21.529999999999998 95-99 22.91 28.605000000000004 27.339999999999996 21.145 100-104 23.87 28.02 27.13 20.979999999999997 105-109 23.905 28.325 27.165 20.605 110-114 24.135 27.74 27.47 20.655 115-119 23.855 28.139999999999997 27.334999999999997 20.669999999999998 120-124 23.865 27.965 27.375 20.794999999999998 125-129 23.849999999999998 28.265 26.590000000000003 21.295 130-134 24.59 28.000000000000004 26.19 21.22 135-139 24.185000000000002 27.395000000000003 27.79 20.630000000000003 140-144 24.08 28.060000000000002 27.345000000000002 20.515 145-149 24.765 27.27 27.555000000000003 20.41 150-151 25.2875 27.6125 26.6625 20.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 1.0 23 1.0 24 3.5 25 5.0 26 4.5 27 4.5 28 6.0 29 12.0 30 16.0 31 19.0 32 27.0 33 32.5 34 47.0 35 73.0 36 95.5 37 118.0 38 116.0 39 128.5 40 174.5 41 209.5 42 252.0 43 265.5 44 266.5 45 278.5 46 295.5 47 272.0 48 232.5 49 214.0 50 171.5 51 140.5 52 108.0 53 89.0 54 74.0 55 56.0 56 43.5 57 31.0 58 22.5 59 18.5 60 20.5 61 11.0 62 5.5 63 8.0 64 6.0 65 1.5 66 0.0 67 0.0 68 0.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.11486664906258 90.05 2 4.35701082651175 8.25 3 0.36968576709796674 1.05 4 0.10562450488513335 0.4 5 0.052812252442566675 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTT 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.7125 0.0 0.0 0.0 0.0 134-135 3.0125 0.0 0.0 0.0 0.0 136-137 3.25 0.0 0.0 0.0 0.0 138-139 3.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCATT 10 0.006830828 145.0 2 GAATCTG 10 0.006830828 145.0 9 ATTGAAT 10 0.006830828 145.0 6 AGCATTG 10 0.006830828 145.0 3 TGAATCT 10 0.006830828 145.0 8 >>END_MODULE Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483992 spots for SRR12161413.sra Written 483992 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra Read 483975 spots for SRR12161413.sra Written 483975 spots for SRR12161413.sra SRR ids: ['SRR12161413.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_myv67j72 SRR12161413.sra spots: 9679517 blocks: [[1, 483975], [483976, 967950], [967951, 1451925], [1451926, 1935900], [1935901, 2419875], [2419876, 2903850], [2903851, 3387825], [3387826, 3871800], [3871801, 4355775], [4355776, 4839750], [4839751, 5323725], [5323726, 5807700], [5807701, 6291675], [6291676, 6775650], [6775651, 7259625], [7259626, 7743600], [7743601, 8227575], [8227576, 8711550], [8711551, 9195525], [9195526, 9679517]] SRR12161413 file size 3268448 SRR12161413 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161413 SRR12161413_1.fastq SRR12161413_2.fastq Input file: SRR12161413_1.fastq Paired file: SRR12161413_2.fastq trimmed: SRR12161413-trimmed-pair1.fastq, SRR12161413-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:17:38 2025 >> started Thu Feb 13 21:17:49 2025 >> done (11.036s) 9679517 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 608 ( 0.01%) empty read pairs filtered out after trimming by size control 9678898 (99.99%) read pairs available; of these: 547417 ( 5.66%) trimmed read pairs available after processing 9131481 (94.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 6 0.00% 25 7 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 3 0.00% 30 5 0.00% 31 6 0.00% 32 1 0.00% 33 5 0.00% 34 8 0.00% 35 3 0.00% 36 10 0.00% 37 7 0.00% 38 11 0.00% 39 3 0.00% 40 8 0.00% 41 5 0.00% 42 7 0.00% 43 5 0.00% 44 3 0.00% 45 10 0.00% 46 14 0.00% 47 9 0.00% 48 13 0.00% 49 12 0.00% 50 11 0.00% 51 17 0.00% 52 22 0.00% 53 17 0.00% 54 19 0.00% 55 22 0.00% 56 14 0.00% 57 31 0.00% 58 22 0.00% 59 29 0.00% 60 38 0.00% 61 33 0.00% 62 50 0.00% 63 38 0.00% 64 44 0.00% 65 51 0.00% 66 77 0.00% 67 73 0.00% 68 76 0.00% 69 75 0.00% 70 120 0.00% 71 108 0.00% 72 127 0.00% 73 146 0.00% 74 141 0.00% 75 169 0.00% 76 174 0.00% 77 198 0.00% 78 237 0.00% 79 260 0.00% 80 354 0.00% 81 378 0.00% 82 405 0.00% 83 483 0.00% 84 532 0.01% 85 563 0.01% 86 627 0.01% 87 693 0.01% 88 772 0.01% 89 867 0.01% 90 1012 0.01% 91 1045 0.01% 92 1229 0.01% 93 1359 0.01% 94 1524 0.02% 95 1694 0.02% 96 1832 0.02% 97 1886 0.02% 98 2106 0.02% 99 2213 0.02% 100 2417 0.02% 101 2599 0.03% 102 2872 0.03% 103 3060 0.03% 104 3296 0.03% 105 3609 0.04% 106 3836 0.04% 107 4010 0.04% 108 4189 0.04% 109 4525 0.05% 110 4631 0.05% 111 4980 0.05% 112 5219 0.05% 113 5629 0.06% 114 5856 0.06% 115 6345 0.07% 116 6787 0.07% 117 7004 0.07% 118 7110 0.07% 119 7447 0.08% 120 7610 0.08% 121 8139 0.08% 122 8525 0.09% 123 9049 0.09% 124 9485 0.10% 125 9830 0.10% 126 10199 0.11% 127 10651 0.11% 128 10691 0.11% 129 11017 0.11% 130 11471 0.12% 131 11849 0.12% 132 12368 0.13% 133 12839 0.13% 134 13165 0.14% 135 13691 0.14% 136 14395 0.15% 137 14386 0.15% 138 14801 0.15% 139 14983 0.15% 140 15643 0.16% 141 16233 0.17% 142 16818 0.17% 143 16834 0.17% 144 17769 0.18% 145 18076 0.19% 146 18491 0.19% 147 19167 0.20% 148 19780 0.20% 149 19492 0.20% 150 20360 0.21% 151 9131481 94.34% 9678898 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=14 prefix-density=0.70 prefix-fanout=3.1 sequence=GCATTCTCAGGCAGC criterion=fanout-score sequence-density=0.30 sequence-density-rank=10 fanout-score=21.77 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=7.0 sequence=TCATCTTCAATCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=33 prefix-density=0.62 prefix-fanout=2.0 sequence=GATCCTTTCTCTCTTGAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=343.38 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.9 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12161413 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:18:31 Started mapping on | Feb 13 21:18:31 Finished on | Feb 13 21:19:32 Mapping speed, Million of reads per hour | 571.21 Number of input reads | 9678898 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 9086696 Uniquely mapped reads % | 93.88% Average mapped length | 298.50 Number of splices: Total | 8376140 Number of splices: Annotated (sjdb) | 8117226 Number of splices: GT/AG | 8214954 Number of splices: GC/AG | 130285 Number of splices: AT/AC | 7522 Number of splices: Non-canonical | 23379 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 252364 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 72248 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 339838 339838 339838 N_multimapping 252364 252364 252364 N_noFeature 384736 8970461 427464 N_ambiguous 132096 741 58063 UnstrandedReadsAssigned:8569864 PositiveStrandReadsAssigned:115494 NegativeStrandReadsAssigned:8601169 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161413 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161413-trimmed-pair1.fastq SRR12161413-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,678,898 reads, 8,657,707 reads pseudoaligned [quant] estimated average fragment length: 274.075 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR12161413.ke.tsv 34699 SRR12161413.se.tsv 87100 total ==> SRR12161413.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.92 227 13.3579 Potri.005G024800.1.v4.1 1035 761.925 93 12.5332 Potri.004G059700.1.v4.1 961 688.108 19 2.83522 Potri.007G009000.2.v4.1 1416 1142.92 0 0 Potri.003G141000.2.v4.1 2943 2669.92 264.362 10.1669 Potri.016G087400.1.v4.1 270 71.9312 683 974.974 Potri.015G069301.1.v4.1 564 305.611 0 0 Potri.010G195200.1.v4.1 1773 1499.92 0 0 Potri.012G127500.1.v4.1 977 703.995 138 20.1279 ==> SRR12161413.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 117 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12161413 completed mapping pipeline successfully