Starting /dee2/code/volunteer_pipeline.sh SRR12161414 current disk space = 3088635682816 free memory = 1578523552 SRR12161414 SRAfilesize 6a222654c74d80686e8d2be91e3faa4f SRR12161414.sra SRR12161414.sra file validated SRR12161414 is paired end SRR12161414 is conventional basespace SRR12161414 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161414_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47925 37.0 37.0 37.0 37.0 37.0 2 36.397 37.0 37.0 37.0 37.0 37.0 3 36.496 37.0 37.0 37.0 37.0 37.0 4 36.559 37.0 37.0 37.0 37.0 37.0 5 36.635 37.0 37.0 37.0 37.0 37.0 6 36.591 37.0 37.0 37.0 37.0 37.0 7 36.511 37.0 37.0 37.0 37.0 37.0 8 36.534 37.0 37.0 37.0 37.0 37.0 9 36.4965 37.0 37.0 37.0 37.0 37.0 10-14 36.5734 37.0 37.0 37.0 37.0 37.0 15-19 36.521 37.0 37.0 37.0 37.0 37.0 20-24 36.5175 37.0 37.0 37.0 37.0 37.0 25-29 36.4517 37.0 37.0 37.0 37.0 37.0 30-34 36.4918 37.0 37.0 37.0 37.0 37.0 35-39 36.488099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.457800000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4066 37.0 37.0 37.0 37.0 37.0 50-54 36.3986 37.0 37.0 37.0 37.0 37.0 55-59 36.3824 37.0 37.0 37.0 37.0 37.0 60-64 36.3447 37.0 37.0 37.0 37.0 37.0 65-69 36.3547 37.0 37.0 37.0 37.0 37.0 70-74 36.297900000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.320800000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.327000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.272099999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2977 37.0 37.0 37.0 37.0 37.0 95-99 36.275 37.0 37.0 37.0 37.0 37.0 100-104 36.2281 37.0 37.0 37.0 37.0 37.0 105-109 36.1746 37.0 37.0 37.0 37.0 37.0 110-114 36.219500000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.17979999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.1868 37.0 37.0 37.0 37.0 37.0 125-129 36.1126 37.0 37.0 37.0 37.0 37.0 130-134 36.0535 37.0 37.0 37.0 37.0 37.0 135-139 36.0516 37.0 37.0 37.0 37.0 37.0 140-144 35.9304 37.0 37.0 37.0 37.0 37.0 145-149 35.9703 37.0 37.0 37.0 37.0 37.0 150-151 35.807249999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 2.0 27 7.0 28 9.0 29 27.0 30 18.0 31 35.0 32 52.0 33 77.0 34 118.0 35 251.0 36 2942.0 37 457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.33608402100525 12.653163290822706 5.676419104776194 37.33433358339585 2 21.075 13.5 34.725 30.7 3 18.099999999999998 17.424999999999997 29.275000000000002 35.199999999999996 4 21.7 25.874999999999996 24.625 27.800000000000004 5 21.5 33.324999999999996 22.95 22.225 6 20.849999999999998 36.175000000000004 22.525000000000002 20.45 7 15.15 26.5 41.099999999999994 17.25 8 17.349999999999998 26.625 31.525 24.5 9 17.8 23.95 34.125 24.125 10-14 19.915 29.95 27.060000000000002 23.075000000000003 15-19 19.814999999999998 28.115000000000002 27.894999999999996 24.175 20-24 20.135 28.265 27.51 24.09 25-29 19.485 29.220000000000002 26.915 24.38 30-34 20.135 28.52 27.33 24.015 35-39 20.155 28.535 27.084999999999997 24.224999999999998 40-44 19.96 28.725 26.900000000000002 24.415 45-49 19.759999999999998 28.625 27.13 24.485 50-54 20.375 29.035 26.51 24.08 55-59 20.0 28.765 26.939999999999998 24.295 60-64 20.06 28.22 27.595 24.125 65-69 20.185 28.144999999999996 27.52 24.15 70-74 20.05 28.345 27.13 24.474999999999998 75-79 20.66 27.765 27.485 24.09 80-84 20.71 28.050000000000004 27.47 23.77 85-89 20.485 28.155 27.065 24.295 90-94 20.535 28.52 26.765 24.18 95-99 21.095 27.639999999999997 27.279999999999998 23.985 100-104 20.830000000000002 28.32 27.155 23.695 105-109 20.69 27.47 27.345000000000002 24.495 110-114 21.01 28.444999999999997 27.334999999999997 23.21 115-119 20.945 28.525 27.155 23.375 120-124 20.865000000000002 27.905 27.279999999999998 23.95 125-129 21.605 27.68 27.139999999999997 23.575 130-134 21.615000000000002 28.645 26.474999999999998 23.265 135-139 21.759999999999998 27.735 26.450000000000003 24.055 140-144 21.3 28.144999999999996 26.26 24.295 145-149 21.240000000000002 27.965 26.99 23.805 150-151 21.4375 28.025 27.55 22.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 2.0 26 2.5 27 4.5 28 7.5 29 11.0 30 14.0 31 18.5 32 30.0 33 36.5 34 53.5 35 77.0 36 80.5 37 92.0 38 119.5 39 146.0 40 163.0 41 185.0 42 224.5 43 251.0 44 254.5 45 264.5 46 265.5 47 256.5 48 252.0 49 224.0 50 199.5 51 180.0 52 142.0 53 104.5 54 76.5 55 62.5 56 49.0 57 36.0 58 27.0 59 21.0 60 19.5 61 13.0 62 5.5 63 4.5 64 4.0 65 4.0 66 5.0 67 2.5 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.94343649946639 88.02499999999999 2 5.44290288153682 10.2 3 0.5602988260405549 1.575 4 0.05336179295624333 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.48750000000000004 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.7374999999999998 0.0 0.0 0.0 0.0 134-135 1.825 0.0 0.0 0.0 0.0 136-137 1.925 0.0 0.0 0.0 0.0 138-139 2.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAAGA 10 0.006830828 145.0 145 TTCACTG 10 0.006830828 145.0 7 GGATTGA 10 0.006830828 145.0 4 >>END_MODULE SRR12161414 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161414_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.968 37.0 37.0 37.0 37.0 37.0 2 35.7885 37.0 37.0 37.0 37.0 37.0 3 35.802 37.0 37.0 37.0 37.0 37.0 4 35.9675 37.0 37.0 37.0 37.0 37.0 5 36.085 37.0 37.0 37.0 37.0 37.0 6 36.0145 37.0 37.0 37.0 37.0 37.0 7 35.9145 37.0 37.0 37.0 37.0 37.0 8 36.121 37.0 37.0 37.0 37.0 37.0 9 36.109 37.0 37.0 37.0 37.0 37.0 10-14 36.0991 37.0 37.0 37.0 37.0 37.0 15-19 36.0086 37.0 37.0 37.0 37.0 37.0 20-24 35.967999999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.924499999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.953599999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.9322 37.0 37.0 37.0 37.0 37.0 40-44 35.896 37.0 37.0 37.0 37.0 37.0 45-49 35.75540000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.858000000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.8073 37.0 37.0 37.0 37.0 37.0 60-64 35.752399999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.6845 37.0 37.0 37.0 37.0 37.0 70-74 35.6523 37.0 37.0 37.0 37.0 37.0 75-79 35.626400000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.695 37.0 37.0 37.0 37.0 37.0 85-89 35.6498 37.0 37.0 37.0 37.0 37.0 90-94 35.587399999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.61280000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.6219 37.0 37.0 37.0 37.0 37.0 105-109 35.6065 37.0 37.0 37.0 37.0 37.0 110-114 35.6055 37.0 37.0 37.0 37.0 37.0 115-119 35.560900000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.471900000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4302 37.0 37.0 37.0 37.0 37.0 130-134 35.3118 37.0 37.0 37.0 34.6 37.0 135-139 35.4433 37.0 37.0 37.0 37.0 37.0 140-144 35.2807 37.0 37.0 37.0 29.8 37.0 145-149 35.366699999999994 37.0 37.0 37.0 37.0 37.0 150-151 34.72575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 3.0 15 3.0 16 1.0 17 2.0 18 0.0 19 1.0 20 3.0 21 2.0 22 5.0 23 8.0 24 6.0 25 9.0 26 9.0 27 17.0 28 18.0 29 31.0 30 36.0 31 46.0 32 85.0 33 130.0 34 204.0 35 634.0 36 2545.0 37 196.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.3 24.775 8.5 24.425 2 26.775 27.625 29.575000000000003 16.025 3 20.825 27.275 31.724999999999998 20.175 4 22.25 36.475 22.875 18.4 5 23.025000000000002 37.075 22.475 17.424999999999997 6 20.925 37.574999999999996 23.5 18.0 7 20.424999999999997 22.85 36.95 19.775000000000002 8 21.85 25.7 27.525 24.925 9 21.725 24.75 28.9 24.625 10-14 23.61 29.520000000000003 25.515 21.355 15-19 22.994999999999997 28.265 27.415 21.325 20-24 22.505 28.275 27.705000000000002 21.515 25-29 22.905 28.455000000000002 27.38 21.26 30-34 23.06 28.134999999999998 27.61 21.195 35-39 22.955000000000002 27.485 28.389999999999997 21.17 40-44 22.865 28.345 27.415 21.375 45-49 22.745 27.139999999999997 28.78 21.335 50-54 23.395 27.565 27.425 21.615000000000002 55-59 23.25 27.544999999999998 27.755000000000003 21.45 60-64 23.03 28.285 27.29 21.395 65-69 23.24 27.33 27.815 21.615000000000002 70-74 23.474999999999998 27.439999999999998 27.655 21.43 75-79 22.985 27.400000000000002 27.37 22.245 80-84 23.195 28.134999999999998 27.334999999999997 21.335 85-89 23.419999999999998 28.08 27.134999999999998 21.365000000000002 90-94 23.285 27.474999999999998 27.775 21.465 95-99 23.724999999999998 26.865 27.97 21.44 100-104 23.62 27.435 27.48 21.465 105-109 23.745 27.875 26.945000000000004 21.435000000000002 110-114 23.400000000000002 27.750000000000004 27.375 21.475 115-119 23.849999999999998 27.865000000000002 26.919999999999998 21.365000000000002 120-124 23.765 27.265 27.575 21.395 125-129 23.799999999999997 27.439999999999998 27.48 21.279999999999998 130-134 24.425 27.295 27.405 20.875 135-139 24.099999999999998 27.575 27.150000000000002 21.175 140-144 23.865 27.944999999999997 26.72 21.47 145-149 23.830000000000002 27.339999999999996 27.22 21.61 150-151 24.975 27.6875 27.375 19.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 1.5 22 3.0 23 2.0 24 2.5 25 3.0 26 2.5 27 3.0 28 5.5 29 14.0 30 16.5 31 17.5 32 24.5 33 34.0 34 45.0 35 62.5 36 82.0 37 96.5 38 133.5 39 160.5 40 174.0 41 207.5 42 226.5 43 247.5 44 267.5 45 267.0 46 268.0 47 267.5 48 245.0 49 205.0 50 165.5 51 139.5 52 122.5 53 100.0 54 91.5 55 77.5 56 52.0 57 40.0 58 28.0 59 20.0 60 21.0 61 18.5 62 10.0 63 3.5 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.07051282051282 88.05 2 5.261752136752137 9.85 3 0.5341880341880342 1.5 4 0.02670940170940171 0.1 5 0.10683760683760685 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.48750000000000004 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.8 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATTCC 10 0.006830828 145.0 3 ATATATT 10 0.006830828 145.0 9 >>END_MODULE Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612551 spots for SRR12161414.sra Written 612551 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra Read 612542 spots for SRR12161414.sra Written 612542 spots for SRR12161414.sra SRR ids: ['SRR12161414.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0guau14l SRR12161414.sra spots: 12250849 blocks: [[1, 612542], [612543, 1225084], [1225085, 1837626], [1837627, 2450168], [2450169, 3062710], [3062711, 3675252], [3675253, 4287794], [4287795, 4900336], [4900337, 5512878], [5512879, 6125420], [6125421, 6737962], [6737963, 7350504], [7350505, 7963046], [7963047, 8575588], [8575589, 9188130], [9188131, 9800672], [9800673, 10413214], [10413215, 11025756], [11025757, 11638298], [11638299, 12250849]] SRR12161414 file size 4141674 SRR12161414 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161414 SRR12161414_1.fastq SRR12161414_2.fastq Input file: SRR12161414_1.fastq Paired file: SRR12161414_2.fastq trimmed: SRR12161414-trimmed-pair1.fastq, SRR12161414-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:21:09 2025 >> started Thu Feb 13 22:21:22 2025 >> done (12.793s) 12250849 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 17953 ( 0.15%) empty read pairs filtered out after trimming by size control 12232870 (99.85%) read pairs available; of these: 474679 ( 3.88%) trimmed read pairs available after processing 11758191 (96.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 4 0.00% 21 3 0.00% 22 2 0.00% 23 9 0.00% 24 2 0.00% 25 4 0.00% 26 8 0.00% 27 8 0.00% 28 10 0.00% 29 6 0.00% 30 13 0.00% 31 4 0.00% 32 14 0.00% 33 14 0.00% 34 9 0.00% 35 7 0.00% 36 11 0.00% 37 1 0.00% 38 10 0.00% 39 9 0.00% 40 13 0.00% 41 13 0.00% 42 17 0.00% 43 12 0.00% 44 17 0.00% 45 11 0.00% 46 16 0.00% 47 21 0.00% 48 17 0.00% 49 16 0.00% 50 17 0.00% 51 24 0.00% 52 28 0.00% 53 28 0.00% 54 28 0.00% 55 27 0.00% 56 41 0.00% 57 30 0.00% 58 34 0.00% 59 32 0.00% 60 31 0.00% 61 37 0.00% 62 45 0.00% 63 53 0.00% 64 57 0.00% 65 43 0.00% 66 70 0.00% 67 72 0.00% 68 73 0.00% 69 87 0.00% 70 88 0.00% 71 104 0.00% 72 141 0.00% 73 137 0.00% 74 136 0.00% 75 164 0.00% 76 163 0.00% 77 198 0.00% 78 191 0.00% 79 256 0.00% 80 259 0.00% 81 286 0.00% 82 349 0.00% 83 427 0.00% 84 414 0.00% 85 486 0.00% 86 505 0.00% 87 629 0.01% 88 661 0.01% 89 808 0.01% 90 761 0.01% 91 865 0.01% 92 1047 0.01% 93 1150 0.01% 94 1181 0.01% 95 1369 0.01% 96 1373 0.01% 97 1541 0.01% 98 1634 0.01% 99 1747 0.01% 100 1941 0.02% 101 2155 0.02% 102 2249 0.02% 103 2370 0.02% 104 2651 0.02% 105 2841 0.02% 106 3091 0.03% 107 3172 0.03% 108 3291 0.03% 109 3547 0.03% 110 3686 0.03% 111 3943 0.03% 112 4280 0.03% 113 4470 0.04% 114 4869 0.04% 115 5132 0.04% 116 5350 0.04% 117 5716 0.05% 118 5711 0.05% 119 6101 0.05% 120 6270 0.05% 121 6736 0.06% 122 6978 0.06% 123 7410 0.06% 124 7658 0.06% 125 8008 0.07% 126 8396 0.07% 127 8711 0.07% 128 9038 0.07% 129 9361 0.08% 130 9637 0.08% 131 9927 0.08% 132 10490 0.09% 133 11153 0.09% 134 11667 0.10% 135 11832 0.10% 136 12418 0.10% 137 12658 0.10% 138 12945 0.11% 139 13672 0.11% 140 13891 0.11% 141 14686 0.12% 142 14873 0.12% 143 15594 0.13% 144 16198 0.13% 145 16831 0.14% 146 17326 0.14% 147 17448 0.14% 148 18278 0.15% 149 18377 0.15% 150 19418 0.16% 151 11758191 96.12% 12232870 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=0.80 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=67.23 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=2.0 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=13 prefix-density=1.23 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=45.50 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.5 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR12161414 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:22:08 Started mapping on | Feb 13 22:22:09 Finished on | Feb 13 22:23:30 Mapping speed, Million of reads per hour | 543.68 Number of input reads | 12232870 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11297242 Uniquely mapped reads % | 92.35% Average mapped length | 299.29 Number of splices: Total | 11396664 Number of splices: Annotated (sjdb) | 11194886 Number of splices: GT/AG | 11166370 Number of splices: GC/AG | 194594 Number of splices: AT/AC | 8133 Number of splices: Non-canonical | 27567 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367208 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 81777 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 568420 568420 568420 N_multimapping 367208 367208 367208 N_noFeature 301732 11177225 337728 N_ambiguous 159647 611 75248 UnstrandedReadsAssigned:10835863 PositiveStrandReadsAssigned:119406 NegativeStrandReadsAssigned:10884266 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161414 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161414-trimmed-pair1.fastq SRR12161414-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,232,870 reads, 11,072,994 reads pseudoaligned [quant] estimated average fragment length: 283.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR12161414.ke.tsv 34699 SRR12161414.se.tsv 87100 total ==> SRR12161414.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.91 300 13.6189 Potri.005G024800.1.v4.1 1035 752.909 259 27.1084 Potri.004G059700.1.v4.1 961 679.059 81 9.39991 Potri.007G009000.2.v4.1 1416 1133.91 0 0 Potri.003G141000.2.v4.1 2943 2660.91 167.115 4.94916 Potri.016G087400.1.v4.1 270 67.1864 807 946.538 Potri.015G069301.1.v4.1 564 297.033 0 0 Potri.010G195200.1.v4.1 1773 1490.91 3 0.158568 Potri.012G127500.1.v4.1 977 694.977 394 44.6758 ==> SRR12161414.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 110 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR12161414 completed mapping pipeline successfully