Starting /dee2/code/volunteer_pipeline.sh SRR12161415 current disk space = 3088340389888 free memory = 1478966320 SRR12161415 SRAfilesize ccf584f069981cd3b552d9d77ef9da88 SRR12161415.sra SRR12161415.sra file validated SRR12161415 is paired end SRR12161415 is conventional basespace SRR12161415 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161415_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.53 37.0 37.0 37.0 37.0 37.0 2 36.4375 37.0 37.0 37.0 37.0 37.0 3 36.434 37.0 37.0 37.0 37.0 37.0 4 36.5355 37.0 37.0 37.0 37.0 37.0 5 36.5535 37.0 37.0 37.0 37.0 37.0 6 36.65 37.0 37.0 37.0 37.0 37.0 7 36.444 37.0 37.0 37.0 37.0 37.0 8 36.559 37.0 37.0 37.0 37.0 37.0 9 36.5265 37.0 37.0 37.0 37.0 37.0 10-14 36.568599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5456 37.0 37.0 37.0 37.0 37.0 20-24 36.4685 37.0 37.0 37.0 37.0 37.0 25-29 36.4637 37.0 37.0 37.0 37.0 37.0 30-34 36.466300000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4346 37.0 37.0 37.0 37.0 37.0 40-44 36.381299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.390699999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3289 37.0 37.0 37.0 37.0 37.0 55-59 36.3285 37.0 37.0 37.0 37.0 37.0 60-64 36.304199999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3001 37.0 37.0 37.0 37.0 37.0 70-74 36.288 37.0 37.0 37.0 37.0 37.0 75-79 36.2488 37.0 37.0 37.0 37.0 37.0 80-84 36.313 37.0 37.0 37.0 37.0 37.0 85-89 36.219500000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.24739999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.179100000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2073 37.0 37.0 37.0 37.0 37.0 105-109 36.073699999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1077 37.0 37.0 37.0 37.0 37.0 115-119 36.15769999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.138099999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.00269999999999 37.0 37.0 37.0 37.0 37.0 130-134 36.0522 37.0 37.0 37.0 37.0 37.0 135-139 35.9894 37.0 37.0 37.0 37.0 37.0 140-144 35.8815 37.0 37.0 37.0 37.0 37.0 145-149 35.8445 37.0 37.0 37.0 37.0 37.0 150-151 35.70675 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 0.0 25 1.0 26 5.0 27 4.0 28 13.0 29 14.0 30 24.0 31 40.0 32 60.0 33 76.0 34 134.0 35 277.0 36 2941.0 37 407.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.52326163081541 12.181090545272637 5.952976488244122 35.34267133566784 2 20.0 13.175 34.375 32.45 3 17.125 17.299999999999997 30.675 34.9 4 20.724999999999998 24.55 25.474999999999998 29.25 5 23.150000000000002 30.175 25.05 21.625 6 21.0 33.825 23.95 21.224999999999998 7 15.299999999999999 27.500000000000004 41.125 16.075 8 18.25 26.650000000000002 29.875 25.224999999999998 9 17.025000000000002 24.425 35.0 23.549999999999997 10-14 19.735 29.494999999999997 27.495000000000005 23.275000000000002 15-19 20.255000000000003 28.355000000000004 27.41 23.98 20-24 20.09 28.470000000000002 27.55 23.89 25-29 20.369999999999997 28.294999999999998 27.325 24.01 30-34 20.175 29.220000000000002 26.919999999999998 23.685000000000002 35-39 20.455000000000002 28.465 26.995 24.085 40-44 20.31 29.065 26.575 24.05 45-49 20.669999999999998 28.33 27.065 23.935000000000002 50-54 20.535 27.950000000000003 27.755000000000003 23.76 55-59 20.26 28.310000000000002 27.21 24.22 60-64 20.54 28.175 27.29 23.995 65-69 20.9 27.894999999999996 27.065 24.14 70-74 20.86 28.389999999999997 26.795 23.955000000000002 75-79 20.395 28.07 27.095000000000002 24.44 80-84 20.8 28.299999999999997 27.185 23.715 85-89 21.05 28.88 26.69 23.380000000000003 90-94 21.105 27.465 27.255000000000003 24.175 95-99 21.195 28.15 26.955000000000002 23.7 100-104 20.59 28.58 26.99 23.84 105-109 20.735 27.92 27.605 23.74 110-114 21.175 28.360000000000003 27.315 23.150000000000002 115-119 21.595 27.67 26.584999999999997 24.15 120-124 20.44 28.365000000000002 27.095000000000002 24.099999999999998 125-129 20.76 28.555000000000003 26.665 24.02 130-134 20.465 28.165000000000003 28.025 23.345 135-139 21.445 27.18 27.134999999999998 24.240000000000002 140-144 21.135 28.000000000000004 27.015 23.849999999999998 145-149 20.849999999999998 28.32 26.584999999999997 24.245 150-151 20.4 27.5125 27.55 24.5375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.5 19 2.5 20 2.0 21 0.5 22 0.5 23 0.5 24 0.5 25 2.5 26 6.0 27 7.0 28 10.5 29 17.5 30 21.5 31 20.5 32 20.0 33 31.5 34 49.0 35 63.0 36 70.5 37 90.5 38 123.0 39 141.0 40 157.5 41 192.5 42 214.0 43 232.0 44 241.5 45 244.5 46 263.0 47 278.5 48 267.0 49 237.5 50 215.0 51 175.0 52 134.0 53 114.5 54 90.5 55 64.0 56 51.5 57 35.5 58 24.5 59 27.0 60 20.0 61 11.0 62 9.0 63 6.0 64 4.5 65 1.5 66 0.5 67 1.5 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.36720189523558 90.575 2 4.132666491181889 7.85 3 0.42116346406949196 1.2 4 0.052645433008686494 0.2 5 0.0 0.0 6 0.0 0.0 7 0.026322716504343247 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2374999999999998 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.8875000000000002 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.9625 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.425 0.0 0.0 0.0 0.0 136-137 3.7375 0.0 0.0 0.0 0.0 138-139 4.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTGG 10 0.006830828 145.0 8 >>END_MODULE SRR12161415 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161415_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.153 37.0 37.0 37.0 37.0 37.0 2 35.928 37.0 37.0 37.0 37.0 37.0 3 35.8265 37.0 37.0 37.0 37.0 37.0 4 36.1105 37.0 37.0 37.0 37.0 37.0 5 36.107 37.0 37.0 37.0 37.0 37.0 6 36.08 37.0 37.0 37.0 37.0 37.0 7 35.966 37.0 37.0 37.0 37.0 37.0 8 36.154 37.0 37.0 37.0 37.0 37.0 9 36.041 37.0 37.0 37.0 37.0 37.0 10-14 36.1075 37.0 37.0 37.0 37.0 37.0 15-19 36.0563 37.0 37.0 37.0 37.0 37.0 20-24 35.9991 37.0 37.0 37.0 37.0 37.0 25-29 35.942499999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.9134 37.0 37.0 37.0 37.0 37.0 35-39 35.924600000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.9141 37.0 37.0 37.0 37.0 37.0 45-49 35.8135 37.0 37.0 37.0 37.0 37.0 50-54 35.876599999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.858599999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.73870000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.7288 37.0 37.0 37.0 37.0 37.0 70-74 35.730599999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.727199999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.7526 37.0 37.0 37.0 37.0 37.0 85-89 35.6824 37.0 37.0 37.0 37.0 37.0 90-94 35.5591 37.0 37.0 37.0 37.0 37.0 95-99 35.673700000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.6749 37.0 37.0 37.0 37.0 37.0 105-109 35.701100000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6558 37.0 37.0 37.0 37.0 37.0 115-119 35.546 37.0 37.0 37.0 37.0 37.0 120-124 35.5594 37.0 37.0 37.0 37.0 37.0 125-129 35.4414 37.0 37.0 37.0 37.0 37.0 130-134 35.3326 37.0 37.0 37.0 34.6 37.0 135-139 35.430499999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3206 37.0 37.0 37.0 32.2 37.0 145-149 35.3726 37.0 37.0 37.0 37.0 37.0 150-151 34.923 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 9.0 15 9.0 16 5.0 17 3.0 18 1.0 19 0.0 20 3.0 21 4.0 22 6.0 23 12.0 24 13.0 25 9.0 26 11.0 27 4.0 28 20.0 29 15.0 30 31.0 31 41.0 32 56.0 33 123.0 34 188.0 35 537.0 36 2634.0 37 264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.9 26.1 7.324999999999999 21.675 2 28.15 25.75 28.499999999999996 17.599999999999998 3 20.25 29.2 31.7 18.85 4 23.200000000000003 33.725 23.35 19.725 5 24.25 37.925 20.025000000000002 17.8 6 21.099999999999998 38.85 22.075 17.974999999999998 7 20.925 23.474999999999998 37.15 18.45 8 21.875 26.924999999999997 27.250000000000004 23.95 9 22.175 24.725 28.9 24.2 10-14 23.53 29.64 26.064999999999998 20.765 15-19 23.04 28.395 26.86 21.705 20-24 22.955000000000002 28.82 27.27 20.955 25-29 23.54 28.189999999999998 27.139999999999997 21.13 30-34 22.5 28.15 27.46 21.89 35-39 23.169999999999998 28.01 28.03 20.79 40-44 23.445 27.405 27.76 21.39 45-49 23.13 28.265 27.334999999999997 21.27 50-54 23.32 27.779999999999998 27.365000000000002 21.535 55-59 23.09 27.445000000000004 27.85 21.615000000000002 60-64 23.415 27.939999999999998 27.450000000000003 21.195 65-69 23.305 27.655 28.005000000000003 21.035 70-74 23.21 27.83 27.41 21.55 75-79 22.775000000000002 28.560000000000002 27.115000000000002 21.55 80-84 23.285 28.235 27.265 21.215 85-89 23.135 28.155 26.99 21.72 90-94 23.845 28.415000000000003 26.3 21.44 95-99 23.225 27.700000000000003 27.615000000000002 21.46 100-104 23.695 28.16 26.57 21.575 105-109 23.855 27.625 27.155 21.365000000000002 110-114 23.385 28.26 27.205000000000002 21.15 115-119 23.445 27.834999999999997 27.58 21.14 120-124 24.185000000000002 27.365000000000002 27.485 20.965 125-129 24.51 27.73 27.26 20.5 130-134 24.66 27.685 27.139999999999997 20.515 135-139 24.474999999999998 27.57 26.915 21.04 140-144 25.345000000000002 27.544999999999998 26.63 20.48 145-149 24.435000000000002 27.950000000000003 26.884999999999998 20.73 150-151 25.0625 28.4125 26.5375 19.9875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 1.0 9 1.0 10 1.0 11 1.5 12 1.5 13 1.0 14 1.0 15 1.0 16 1.5 17 1.5 18 1.0 19 2.0 20 2.5 21 1.0 22 1.5 23 3.0 24 3.0 25 2.5 26 2.5 27 5.5 28 10.5 29 11.5 30 14.5 31 23.0 32 24.5 33 26.5 34 40.0 35 57.0 36 76.5 37 110.5 38 141.5 39 161.5 40 179.5 41 200.0 42 225.0 43 245.5 44 266.0 45 267.5 46 256.5 47 252.0 48 234.5 49 210.0 50 186.0 51 147.5 52 117.5 53 106.5 54 91.5 55 67.0 56 47.0 57 40.0 58 28.5 59 20.5 60 19.5 61 14.0 62 10.0 63 6.0 64 2.0 65 0.5 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 1.0 88 1.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 1.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.3125 89.97500000000001 2 4.1048728813559325 7.75 3 0.3707627118644068 1.05 4 0.07944915254237289 0.3 5 0.05296610169491525 0.25 6 0.026483050847457626 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05296610169491525 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 10 0.25 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit GTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCT 5 0.125 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2374999999999998 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.5875 0.0 0.0 0.0 0.0 130-131 2.975 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.4625 0.0 0.0 0.0 0.0 136-137 3.7375 0.0 0.0 0.0 0.0 138-139 4.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080896 spots for SRR12161415.sra Written 1080896 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra Read 1080894 spots for SRR12161415.sra Written 1080894 spots for SRR12161415.sra SRR ids: ['SRR12161415.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9kdt8dxi SRR12161415.sra spots: 21617882 blocks: [[1, 1080894], [1080895, 2161788], [2161789, 3242682], [3242683, 4323576], [4323577, 5404470], [5404471, 6485364], [6485365, 7566258], [7566259, 8647152], [8647153, 9728046], [9728047, 10808940], [10808941, 11889834], [11889835, 12970728], [12970729, 14051622], [14051623, 15132516], [15132517, 16213410], [16213411, 17294304], [17294305, 18375198], [18375199, 19456092], [19456093, 20536986], [20536987, 21617882]] SRR12161415 file size 7325001 SRR12161415 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161415 SRR12161415_1.fastq SRR12161415_2.fastq Input file: SRR12161415_1.fastq Paired file: SRR12161415_2.fastq trimmed: SRR12161415-trimmed-pair1.fastq, SRR12161415-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:39:03 2025 >> started Thu Feb 13 21:39:30 2025 >> done (26.663s) 21617882 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 12912 ( 0.06%) empty read pairs filtered out after trimming by size control 21604940 (99.94%) read pairs available; of these: 1517528 ( 7.02%) trimmed read pairs available after processing 20087412 (92.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 9 0.00% 21 12 0.00% 22 10 0.00% 23 12 0.00% 24 13 0.00% 25 12 0.00% 26 14 0.00% 27 15 0.00% 28 18 0.00% 29 27 0.00% 30 25 0.00% 31 20 0.00% 32 17 0.00% 33 20 0.00% 34 28 0.00% 35 21 0.00% 36 24 0.00% 37 21 0.00% 38 18 0.00% 39 43 0.00% 40 26 0.00% 41 24 0.00% 42 25 0.00% 43 31 0.00% 44 18 0.00% 45 83 0.00% 46 41 0.00% 47 32 0.00% 48 46 0.00% 49 126 0.00% 50 31 0.00% 51 50 0.00% 52 55 0.00% 53 57 0.00% 54 64 0.00% 55 60 0.00% 56 77 0.00% 57 64 0.00% 58 84 0.00% 59 113 0.00% 60 125 0.00% 61 132 0.00% 62 129 0.00% 63 149 0.00% 64 174 0.00% 65 204 0.00% 66 204 0.00% 67 263 0.00% 68 233 0.00% 69 303 0.00% 70 354 0.00% 71 419 0.00% 72 474 0.00% 73 515 0.00% 74 587 0.00% 75 562 0.00% 76 778 0.00% 77 746 0.00% 78 919 0.00% 79 1013 0.00% 80 1083 0.01% 81 1313 0.01% 82 1492 0.01% 83 1635 0.01% 84 1861 0.01% 85 2008 0.01% 86 2237 0.01% 87 2548 0.01% 88 2753 0.01% 89 2970 0.01% 90 3268 0.02% 91 3693 0.02% 92 4219 0.02% 93 4635 0.02% 94 4986 0.02% 95 5511 0.03% 96 5832 0.03% 97 6189 0.03% 98 6711 0.03% 99 7406 0.03% 100 7771 0.04% 101 8387 0.04% 102 9145 0.04% 103 9954 0.05% 104 10466 0.05% 105 11184 0.05% 106 11633 0.05% 107 12279 0.06% 108 12872 0.06% 109 13700 0.06% 110 14034 0.06% 111 14907 0.07% 112 15859 0.07% 113 16928 0.08% 114 17503 0.08% 115 18389 0.09% 116 19268 0.09% 117 20166 0.09% 118 20763 0.10% 119 21286 0.10% 120 22163 0.10% 121 23179 0.11% 122 24238 0.11% 123 25340 0.12% 124 26581 0.12% 125 27436 0.13% 126 28916 0.13% 127 29033 0.13% 128 29997 0.14% 129 30585 0.14% 130 31815 0.15% 131 32342 0.15% 132 33282 0.15% 133 34827 0.16% 134 36224 0.17% 135 36884 0.17% 136 38345 0.18% 137 38663 0.18% 138 39951 0.18% 139 40785 0.19% 140 41717 0.19% 141 42164 0.20% 142 43976 0.20% 143 44902 0.21% 144 46307 0.21% 145 47843 0.22% 146 48675 0.23% 147 49405 0.23% 148 50193 0.23% 149 50814 0.24% 150 52324 0.24% 151 20087412 92.98% 21604940 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.84 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.21 sequence-density-rank=19 fanout-score=5.63 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=3.9 sequence=TGGGCTTCCTTCCAGATGCATCTAACCC criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=24 prefix-density=1.11 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=20.55 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.3 sequence=ACTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR12161415 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:40:18 Started mapping on | Feb 13 21:40:18 Finished on | Feb 13 21:43:20 Mapping speed, Million of reads per hour | 427.35 Number of input reads | 21604940 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19713154 Uniquely mapped reads % | 91.24% Average mapped length | 297.72 Number of splices: Total | 19802403 Number of splices: Annotated (sjdb) | 19428895 Number of splices: GT/AG | 19403965 Number of splices: GC/AG | 335618 Number of splices: AT/AC | 14439 Number of splices: Non-canonical | 48381 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 525908 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 172906 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.24% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1365878 1365878 1365878 N_multimapping 525908 525908 525908 N_noFeature 549162 19480355 627965 N_ambiguous 312539 1146 157764 UnstrandedReadsAssigned:18851453 PositiveStrandReadsAssigned:231653 NegativeStrandReadsAssigned:18927425 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161415 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161415-trimmed-pair1.fastq SRR12161415-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,604,940 reads, 19,305,949 reads pseudoaligned [quant] estimated average fragment length: 270.141 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR12161415.ke.tsv 34699 SRR12161415.se.tsv 87100 total ==> SRR12161415.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.86 403 10.4421 Potri.005G024800.1.v4.1 1035 765.859 625 36.9803 Potri.004G059700.1.v4.1 961 692.042 177 11.5899 Potri.007G009000.2.v4.1 1416 1146.86 0 0 Potri.003G141000.2.v4.1 2943 2673.86 607 10.287 Potri.016G087400.1.v4.1 270 77.2742 1133.4 664.645 Potri.015G069301.1.v4.1 564 310.248 0 0 Potri.010G195200.1.v4.1 1773 1503.86 13 0.39172 Potri.012G127500.1.v4.1 977 707.975 1428 91.4007 ==> SRR12161415.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 148 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 143 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR12161415 completed mapping pipeline successfully