Starting /dee2/code/volunteer_pipeline.sh SRR12161416 current disk space = 3088775704576 free memory = 1456863308 SRR12161416 SRAfilesize a71fcff23b9e4353b67ac98595c48da5 SRR12161416.sra SRR12161416.sra file validated SRR12161416 is paired end SRR12161416 is conventional basespace SRR12161416 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161416_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5465 37.0 37.0 37.0 37.0 37.0 2 36.3515 37.0 37.0 37.0 37.0 37.0 3 36.422 37.0 37.0 37.0 37.0 37.0 4 36.5145 37.0 37.0 37.0 37.0 37.0 5 36.643 37.0 37.0 37.0 37.0 37.0 6 36.5225 37.0 37.0 37.0 37.0 37.0 7 36.549 37.0 37.0 37.0 37.0 37.0 8 36.513 37.0 37.0 37.0 37.0 37.0 9 36.448 37.0 37.0 37.0 37.0 37.0 10-14 36.5669 37.0 37.0 37.0 37.0 37.0 15-19 36.5588 37.0 37.0 37.0 37.0 37.0 20-24 36.5099 37.0 37.0 37.0 37.0 37.0 25-29 36.48819999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.473699999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.3991 37.0 37.0 37.0 37.0 37.0 40-44 36.4139 37.0 37.0 37.0 37.0 37.0 45-49 36.3882 37.0 37.0 37.0 37.0 37.0 50-54 36.34609999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.3607 37.0 37.0 37.0 37.0 37.0 60-64 36.3019 37.0 37.0 37.0 37.0 37.0 65-69 36.3481 37.0 37.0 37.0 37.0 37.0 70-74 36.2875 37.0 37.0 37.0 37.0 37.0 75-79 36.27329999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.29 37.0 37.0 37.0 37.0 37.0 85-89 36.2041 37.0 37.0 37.0 37.0 37.0 90-94 36.249900000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.204600000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.2105 37.0 37.0 37.0 37.0 37.0 105-109 36.1353 37.0 37.0 37.0 37.0 37.0 110-114 36.1597 37.0 37.0 37.0 37.0 37.0 115-119 36.1254 37.0 37.0 37.0 37.0 37.0 120-124 36.1055 37.0 37.0 37.0 37.0 37.0 125-129 36.069 37.0 37.0 37.0 37.0 37.0 130-134 36.058 37.0 37.0 37.0 37.0 37.0 135-139 35.9516 37.0 37.0 37.0 37.0 37.0 140-144 35.9116 37.0 37.0 37.0 37.0 37.0 145-149 35.8694 37.0 37.0 37.0 37.0 37.0 150-151 35.755250000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 9.0 28 10.0 29 20.0 30 28.0 31 26.0 32 60.0 33 68.0 34 129.0 35 304.0 36 2999.0 37 345.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.5 11.825 5.1499999999999995 33.525 2 19.35 12.2 34.575 33.875 3 16.150000000000002 16.175 30.65 37.025000000000006 4 20.525 25.05 24.8 29.625 5 22.075 33.074999999999996 23.400000000000002 21.45 6 20.549999999999997 34.4 23.325000000000003 21.725 7 14.924999999999999 28.199999999999996 40.675 16.2 8 16.325 27.05 31.075000000000003 25.55 9 16.975 24.8 34.375 23.849999999999998 10-14 19.395 29.685 27.310000000000002 23.61 15-19 19.62 28.435 28.065 23.880000000000003 20-24 19.575 27.575 28.485 24.365000000000002 25-29 19.52 28.82 27.46 24.2 30-34 19.105 28.475 27.839999999999996 24.58 35-39 19.79 28.075 27.87 24.265 40-44 19.85 28.655 27.63 23.865 45-49 20.11 28.065 27.334999999999997 24.490000000000002 50-54 19.765 28.24 27.705000000000002 24.29 55-59 19.915 28.605000000000004 27.29 24.19 60-64 19.585 28.73 27.529999999999998 24.154999999999998 65-69 20.315 28.49 26.91 24.285 70-74 19.869999999999997 28.205000000000002 27.92 24.005000000000003 75-79 19.675 27.839999999999996 28.02 24.465 80-84 20.369999999999997 27.57 27.905 24.154999999999998 85-89 20.405 28.315 27.575 23.705000000000002 90-94 20.47 27.205000000000002 28.084999999999997 24.240000000000002 95-99 19.994999999999997 27.495000000000005 28.720000000000002 23.79 100-104 20.544999999999998 28.384999999999998 26.950000000000003 24.12 105-109 20.32 28.305000000000003 27.845 23.53 110-114 20.915 28.34 27.224999999999998 23.52 115-119 20.9 28.000000000000004 27.355 23.745 120-124 20.865000000000002 28.63 26.815 23.69 125-129 20.955 27.71 27.43 23.905 130-134 21.21 27.955000000000002 26.945000000000004 23.89 135-139 21.21 27.67 27.155 23.965 140-144 21.029999999999998 27.77 27.195000000000004 24.005000000000003 145-149 20.785 28.115000000000002 27.18 23.919999999999998 150-151 20.8 28.7 26.8625 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.5 19 2.0 20 0.5 21 0.5 22 0.5 23 2.5 24 3.5 25 4.5 26 5.5 27 5.5 28 7.0 29 13.0 30 17.0 31 19.0 32 29.5 33 41.0 34 50.0 35 72.0 36 92.0 37 101.5 38 122.5 39 146.5 40 178.5 41 204.0 42 217.5 43 237.5 44 256.0 45 269.5 46 281.0 47 263.0 48 223.5 49 227.0 50 201.0 51 148.0 52 126.0 53 95.5 54 76.5 55 69.0 56 50.5 57 31.0 58 27.0 59 25.5 60 18.0 61 11.5 62 6.0 63 3.0 64 2.5 65 2.5 66 2.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 93.99734395750332 88.47500000000001 2 5.816733067729084 10.95 3 0.13280212483399734 0.375 4 0.05312084993359894 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2000000000000002 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.5750000000000002 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.775 0.0 0.0 0.0 0.0 138-139 1.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161416 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161416_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.357 37.0 37.0 37.0 37.0 37.0 2 36.0285 37.0 37.0 37.0 37.0 37.0 3 35.9675 37.0 37.0 37.0 37.0 37.0 4 36.073 37.0 37.0 37.0 37.0 37.0 5 36.2885 37.0 37.0 37.0 37.0 37.0 6 36.11 37.0 37.0 37.0 37.0 37.0 7 36.0935 37.0 37.0 37.0 37.0 37.0 8 36.195 37.0 37.0 37.0 37.0 37.0 9 36.22 37.0 37.0 37.0 37.0 37.0 10-14 36.192899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.1734 37.0 37.0 37.0 37.0 37.0 20-24 36.0954 37.0 37.0 37.0 37.0 37.0 25-29 36.039699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0173 37.0 37.0 37.0 37.0 37.0 35-39 35.9952 37.0 37.0 37.0 37.0 37.0 40-44 36.0062 37.0 37.0 37.0 37.0 37.0 45-49 35.9474 37.0 37.0 37.0 37.0 37.0 50-54 35.9144 37.0 37.0 37.0 37.0 37.0 55-59 35.8605 37.0 37.0 37.0 37.0 37.0 60-64 35.8576 37.0 37.0 37.0 37.0 37.0 65-69 35.785999999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.763099999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.738 37.0 37.0 37.0 37.0 37.0 80-84 35.8115 37.0 37.0 37.0 37.0 37.0 85-89 35.750299999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.6759 37.0 37.0 37.0 37.0 37.0 95-99 35.6976 37.0 37.0 37.0 37.0 37.0 100-104 35.6555 37.0 37.0 37.0 37.0 37.0 105-109 35.5995 37.0 37.0 37.0 37.0 37.0 110-114 35.5755 37.0 37.0 37.0 37.0 37.0 115-119 35.5859 37.0 37.0 37.0 37.0 37.0 120-124 35.562599999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.489900000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.3842 37.0 37.0 37.0 37.0 37.0 135-139 35.462199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.348200000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.443400000000004 37.0 37.0 37.0 37.0 37.0 150-151 34.8845 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 6.0 16 2.0 17 2.0 18 1.0 19 4.0 20 2.0 21 11.0 22 5.0 23 6.0 24 7.0 25 14.0 26 7.0 27 11.0 28 12.0 29 20.0 30 33.0 31 45.0 32 59.0 33 110.0 34 172.0 35 561.0 36 2671.0 37 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.074999999999996 27.450000000000003 7.375 20.1 2 27.150000000000002 26.950000000000003 28.499999999999996 17.4 3 21.875 27.85 31.674999999999997 18.6 4 22.375 35.725 23.225 18.675 5 24.875 38.475 19.7 16.950000000000003 6 20.674999999999997 40.45 20.674999999999997 18.2 7 20.075000000000003 23.974999999999998 38.800000000000004 17.150000000000002 8 20.75 26.974999999999998 28.15 24.125 9 23.425 23.325000000000003 29.5 23.75 10-14 23.02 29.255 26.224999999999998 21.5 15-19 23.175 28.415000000000003 27.095000000000002 21.315 20-24 22.830000000000002 29.04 27.3 20.830000000000002 25-29 22.615 27.99 27.779999999999998 21.615000000000002 30-34 22.13 28.384999999999998 28.134999999999998 21.349999999999998 35-39 22.564999999999998 27.3 28.235 21.9 40-44 22.745 27.765 28.15 21.34 45-49 22.845 27.66 27.860000000000003 21.634999999999998 50-54 22.75 27.735 28.01 21.505 55-59 22.689999999999998 27.79 27.860000000000003 21.66 60-64 22.759999999999998 27.87 27.950000000000003 21.42 65-69 22.720000000000002 27.41 28.12 21.75 70-74 23.53 27.755000000000003 27.54 21.175 75-79 23.015 28.24 27.305 21.44 80-84 22.97 28.22 26.965 21.845 85-89 23.080000000000002 27.544999999999998 27.779999999999998 21.595 90-94 23.09 28.185 27.47 21.255 95-99 23.494999999999997 27.375 27.615000000000002 21.515 100-104 23.98 27.595 26.985 21.44 105-109 24.13 27.994999999999997 26.884999999999998 20.990000000000002 110-114 23.36 27.74 27.584999999999997 21.315 115-119 23.47 28.044999999999998 27.57 20.915 120-124 23.48 27.905 27.565 21.05 125-129 23.595 28.04 27.1 21.265 130-134 23.655 28.065 27.21 21.07 135-139 23.46 28.035 27.49 21.015 140-144 23.9 27.525 27.744999999999997 20.830000000000002 145-149 23.835 28.04 26.82 21.305 150-151 23.65 29.2 26.987499999999997 20.1625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.5 17 1.5 18 1.0 19 1.5 20 1.5 21 1.0 22 1.0 23 1.0 24 3.5 25 4.0 26 4.5 27 7.0 28 8.5 29 14.0 30 15.0 31 18.0 32 25.5 33 27.5 34 42.5 35 66.5 36 88.5 37 113.5 38 138.0 39 153.0 40 182.5 41 228.5 42 248.0 43 261.5 44 275.0 45 276.0 46 272.0 47 242.0 48 203.5 49 196.5 50 173.0 51 137.0 52 123.5 53 97.5 54 76.5 55 59.5 56 46.0 57 33.5 58 19.0 59 21.0 60 19.0 61 14.0 62 13.5 63 8.5 64 3.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 1.0 74 1.0 75 2.0 76 1.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 1.5 98 1.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.525 #Duplication Level Percentage of deduplicated Percentage of total 1 93.95883453622027 87.875 2 5.560010692328254 10.4 3 0.2673082063619353 0.75 4 0.16038492381716118 0.6 5 0.0 0.0 6 0.02673082063619353 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02673082063619353 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2000000000000002 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.5750000000000002 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.775 0.0 0.0 0.0 0.0 138-139 1.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345797 spots for SRR12161416.sra Written 345797 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra Read 345782 spots for SRR12161416.sra Written 345782 spots for SRR12161416.sra SRR ids: ['SRR12161416.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s7_fks0o SRR12161416.sra spots: 6915655 blocks: [[1, 345782], [345783, 691564], [691565, 1037346], [1037347, 1383128], [1383129, 1728910], [1728911, 2074692], [2074693, 2420474], [2420475, 2766256], [2766257, 3112038], [3112039, 3457820], [3457821, 3803602], [3803603, 4149384], [4149385, 4495166], [4495167, 4840948], [4840949, 5186730], [5186731, 5532512], [5532513, 5878294], [5878295, 6224076], [6224077, 6569858], [6569859, 6915655]] SRR12161416 file size 2334565 SRR12161416 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161416 SRR12161416_1.fastq SRR12161416_2.fastq Input file: SRR12161416_1.fastq Paired file: SRR12161416_2.fastq trimmed: SRR12161416-trimmed-pair1.fastq, SRR12161416-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:27:36 2025 >> started Thu Feb 13 16:27:44 2025 >> done (7.890s) 6915655 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 1112 ( 0.02%) empty read pairs filtered out after trimming by size control 6914530 (99.98%) read pairs available; of these: 195387 ( 2.83%) trimmed read pairs available after processing 6719143 (97.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 7 0.00% 22 5 0.00% 23 7 0.00% 24 4 0.00% 25 8 0.00% 26 7 0.00% 27 9 0.00% 28 11 0.00% 29 7 0.00% 30 13 0.00% 31 7 0.00% 32 11 0.00% 33 8 0.00% 34 6 0.00% 35 11 0.00% 36 8 0.00% 37 6 0.00% 38 7 0.00% 39 13 0.00% 40 7 0.00% 41 5 0.00% 42 10 0.00% 43 6 0.00% 44 4 0.00% 45 11 0.00% 46 14 0.00% 47 7 0.00% 48 6 0.00% 49 14 0.00% 50 16 0.00% 51 9 0.00% 52 9 0.00% 53 10 0.00% 54 18 0.00% 55 13 0.00% 56 23 0.00% 57 21 0.00% 58 20 0.00% 59 31 0.00% 60 20 0.00% 61 31 0.00% 62 19 0.00% 63 34 0.00% 64 29 0.00% 65 32 0.00% 66 35 0.00% 67 32 0.00% 68 40 0.00% 69 33 0.00% 70 57 0.00% 71 49 0.00% 72 54 0.00% 73 77 0.00% 74 87 0.00% 75 73 0.00% 76 100 0.00% 77 100 0.00% 78 99 0.00% 79 128 0.00% 80 140 0.00% 81 142 0.00% 82 177 0.00% 83 185 0.00% 84 211 0.00% 85 261 0.00% 86 269 0.00% 87 270 0.00% 88 266 0.00% 89 294 0.00% 90 352 0.01% 91 392 0.01% 92 480 0.01% 93 480 0.01% 94 573 0.01% 95 586 0.01% 96 633 0.01% 97 661 0.01% 98 748 0.01% 99 774 0.01% 100 760 0.01% 101 858 0.01% 102 956 0.01% 103 1054 0.02% 104 1127 0.02% 105 1199 0.02% 106 1296 0.02% 107 1413 0.02% 108 1446 0.02% 109 1449 0.02% 110 1636 0.02% 111 1638 0.02% 112 1765 0.03% 113 1963 0.03% 114 2013 0.03% 115 2103 0.03% 116 2188 0.03% 117 2263 0.03% 118 2388 0.03% 119 2411 0.03% 120 2659 0.04% 121 2692 0.04% 122 2872 0.04% 123 2980 0.04% 124 3200 0.05% 125 3341 0.05% 126 3567 0.05% 127 3676 0.05% 128 3696 0.05% 129 3956 0.06% 130 3995 0.06% 131 4122 0.06% 132 4274 0.06% 133 4297 0.06% 134 4730 0.07% 135 4888 0.07% 136 5035 0.07% 137 5048 0.07% 138 5362 0.08% 139 5492 0.08% 140 5684 0.08% 141 5933 0.09% 142 6032 0.09% 143 6169 0.09% 144 6527 0.09% 145 6754 0.10% 146 6898 0.10% 147 7235 0.10% 148 7319 0.11% 149 7662 0.11% 150 7930 0.11% 151 6719143 97.17% 6914530 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.83 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=11.29 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=3.1 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGAT criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=26 prefix-density=1.04 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=365.71 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=16.7 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGG SRR12161416 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:28:31 Started mapping on | Feb 13 16:28:31 Finished on | Feb 13 16:29:17 Mapping speed, Million of reads per hour | 541.14 Number of input reads | 6914530 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 6492177 Uniquely mapped reads % | 93.89% Average mapped length | 299.64 Number of splices: Total | 6354009 Number of splices: Annotated (sjdb) | 6175956 Number of splices: GT/AG | 6226888 Number of splices: GC/AG | 104362 Number of splices: AT/AC | 5268 Number of splices: Non-canonical | 17491 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 154380 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 44108 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 267973 267973 267973 N_multimapping 154380 154380 154380 N_noFeature 242353 6409875 271111 N_ambiguous 95028 490 41131 UnstrandedReadsAssigned:6154796 PositiveStrandReadsAssigned:81812 NegativeStrandReadsAssigned:6179935 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161416 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161416-trimmed-pair1.fastq SRR12161416-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,914,530 reads, 6,225,851 reads pseudoaligned [quant] estimated average fragment length: 302.645 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 944 rounds 52401 SRR12161416.ke.tsv 34699 SRR12161416.se.tsv 87100 total ==> SRR12161416.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1716.36 235 19.007 Potri.005G024800.1.v4.1 1035 733.355 107 20.2545 Potri.004G059700.1.v4.1 961 659.513 2 0.420979 Potri.007G009000.2.v4.1 1416 1114.36 0 0 Potri.003G141000.2.v4.1 2943 2641.36 285 14.9786 Potri.016G087400.1.v4.1 270 62.9075 423 933.451 Potri.015G069301.1.v4.1 564 282.352 0 0 Potri.010G195200.1.v4.1 1773 1471.36 0 0 Potri.012G127500.1.v4.1 977 675.445 133 27.3347 ==> SRR12161416.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 60 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12161416 completed mapping pipeline successfully