Starting /dee2/code/volunteer_pipeline.sh SRR12161417 current disk space = 3088397447168 free memory = 1449928364 SRR12161417 SRAfilesize f6c440ae4da4274f94d5ade4e09b1350 SRR12161417.sra SRR12161417.sra file validated SRR12161417 is paired end SRR12161417 is conventional basespace SRR12161417 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161417_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.543 37.0 37.0 37.0 37.0 37.0 2 36.3805 37.0 37.0 37.0 37.0 37.0 3 36.5375 37.0 37.0 37.0 37.0 37.0 4 36.572 37.0 37.0 37.0 37.0 37.0 5 36.679 37.0 37.0 37.0 37.0 37.0 6 36.529 37.0 37.0 37.0 37.0 37.0 7 36.4665 37.0 37.0 37.0 37.0 37.0 8 36.5595 37.0 37.0 37.0 37.0 37.0 9 36.4665 37.0 37.0 37.0 37.0 37.0 10-14 36.581 37.0 37.0 37.0 37.0 37.0 15-19 36.5467 37.0 37.0 37.0 37.0 37.0 20-24 36.45 37.0 37.0 37.0 37.0 37.0 25-29 36.489 37.0 37.0 37.0 37.0 37.0 30-34 36.4369 37.0 37.0 37.0 37.0 37.0 35-39 36.4534 37.0 37.0 37.0 37.0 37.0 40-44 36.4191 37.0 37.0 37.0 37.0 37.0 45-49 36.4385 37.0 37.0 37.0 37.0 37.0 50-54 36.3352 37.0 37.0 37.0 37.0 37.0 55-59 36.381099999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3374 37.0 37.0 37.0 37.0 37.0 65-69 36.3 37.0 37.0 37.0 37.0 37.0 70-74 36.333400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.304700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2872 37.0 37.0 37.0 37.0 37.0 85-89 36.29750000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.303999999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.211400000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2156 37.0 37.0 37.0 37.0 37.0 105-109 36.148399999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1923 37.0 37.0 37.0 37.0 37.0 115-119 36.1245 37.0 37.0 37.0 37.0 37.0 120-124 36.1693 37.0 37.0 37.0 37.0 37.0 125-129 36.075700000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.084700000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.00189999999999 37.0 37.0 37.0 37.0 37.0 140-144 36.000800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8963 37.0 37.0 37.0 37.0 37.0 150-151 35.783249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 4.0 27 11.0 28 11.0 29 15.0 30 20.0 31 30.0 32 47.0 33 83.0 34 120.0 35 307.0 36 2905.0 37 445.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.375 11.85 7.5249999999999995 38.25 2 20.4 12.65 35.225 31.724999999999998 3 16.2 16.2 27.200000000000003 40.400000000000006 4 20.875 24.675 24.925 29.525000000000002 5 23.025000000000002 30.75 24.125 22.1 6 20.05 34.525 25.074999999999996 20.349999999999998 7 15.25 26.35 41.425 16.975 8 17.625 25.85 32.225 24.3 9 17.45 24.85 34.150000000000006 23.549999999999997 10-14 18.945 29.485 27.705000000000002 23.865 15-19 19.88 28.144999999999996 27.955000000000002 24.02 20-24 19.775000000000002 28.685 27.735 23.805 25-29 19.57 28.28 27.615000000000002 24.535 30-34 19.74 28.825 28.095 23.34 35-39 20.155 28.34 27.705000000000002 23.799999999999997 40-44 19.8 29.415000000000003 26.915 23.87 45-49 20.62 28.199999999999996 27.48 23.7 50-54 20.125 28.610000000000003 27.38 23.885 55-59 19.37 28.165000000000003 27.935 24.529999999999998 60-64 20.474999999999998 27.889999999999997 26.99 24.645 65-69 19.805 28.144999999999996 27.839999999999996 24.21 70-74 19.875 28.199999999999996 28.005000000000003 23.919999999999998 75-79 20.169999999999998 28.435 27.1 24.295 80-84 20.244999999999997 28.749999999999996 27.3 23.705000000000002 85-89 20.415 27.825 27.700000000000003 24.060000000000002 90-94 20.49 27.775 28.22 23.515 95-99 20.575 27.79 27.834999999999997 23.799999999999997 100-104 20.44 29.125 27.27 23.165 105-109 20.07 28.16 28.205000000000002 23.565 110-114 20.8 28.275 27.015 23.91 115-119 20.455000000000002 28.335 27.37 23.84 120-124 20.419999999999998 28.15 27.295 24.135 125-129 20.44 27.994999999999997 27.525 24.04 130-134 20.3 28.62 27.425 23.655 135-139 20.95 28.77 26.889999999999997 23.39 140-144 20.815 28.77 26.979999999999997 23.435 145-149 20.380000000000003 28.765 27.08 23.775 150-151 20.45 27.9375 27.85 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 3.0 26 5.0 27 8.0 28 8.0 29 7.0 30 16.0 31 24.5 32 22.5 33 40.5 34 59.5 35 71.0 36 80.5 37 99.5 38 122.0 39 141.5 40 176.5 41 215.5 42 248.0 43 250.0 44 235.5 45 263.0 46 287.5 47 253.5 48 239.0 49 236.5 50 190.5 51 149.0 52 137.5 53 115.0 54 83.5 55 58.0 56 45.5 57 34.5 58 21.5 59 14.5 60 9.0 61 6.5 62 5.0 63 5.0 64 2.0 65 1.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.40021231422506 88.925 2 5.095541401273886 9.6 3 0.45116772823779194 1.275 4 0.05307855626326964 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1124999999999998 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.3 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGGGGT 10 0.006830828 145.0 1 >>END_MODULE SRR12161417 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161417_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.219 37.0 37.0 37.0 37.0 37.0 2 36.0785 37.0 37.0 37.0 37.0 37.0 3 35.9855 37.0 37.0 37.0 37.0 37.0 4 36.047 37.0 37.0 37.0 37.0 37.0 5 36.218 37.0 37.0 37.0 37.0 37.0 6 36.085 37.0 37.0 37.0 37.0 37.0 7 36.118 37.0 37.0 37.0 37.0 37.0 8 36.1315 37.0 37.0 37.0 37.0 37.0 9 36.177 37.0 37.0 37.0 37.0 37.0 10-14 36.210300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.164699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.132600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0707 37.0 37.0 37.0 37.0 37.0 30-34 36.050200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.007999999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9748 37.0 37.0 37.0 37.0 37.0 45-49 35.959 37.0 37.0 37.0 37.0 37.0 50-54 36.0034 37.0 37.0 37.0 37.0 37.0 55-59 35.9033 37.0 37.0 37.0 37.0 37.0 60-64 35.8937 37.0 37.0 37.0 37.0 37.0 65-69 35.9034 37.0 37.0 37.0 37.0 37.0 70-74 35.7801 37.0 37.0 37.0 37.0 37.0 75-79 35.7651 37.0 37.0 37.0 37.0 37.0 80-84 35.85209999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.755700000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.7084 37.0 37.0 37.0 37.0 37.0 95-99 35.754200000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7394 37.0 37.0 37.0 37.0 37.0 105-109 35.7073 37.0 37.0 37.0 37.0 37.0 110-114 35.6116 37.0 37.0 37.0 37.0 37.0 115-119 35.621 37.0 37.0 37.0 37.0 37.0 120-124 35.6214 37.0 37.0 37.0 37.0 37.0 125-129 35.4672 37.0 37.0 37.0 37.0 37.0 130-134 35.39229999999999 37.0 37.0 37.0 32.2 37.0 135-139 35.4665 37.0 37.0 37.0 37.0 37.0 140-144 35.4005 37.0 37.0 37.0 34.6 37.0 145-149 35.4052 37.0 37.0 37.0 37.0 37.0 150-151 34.890249999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 1.0 15 2.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 1.0 22 4.0 23 6.0 24 8.0 25 8.0 26 9.0 27 12.0 28 14.0 29 31.0 30 32.0 31 33.0 32 64.0 33 121.0 34 256.0 35 573.0 36 2596.0 37 219.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.900000000000006 24.825 10.35 24.925 2 27.200000000000003 27.650000000000002 28.9 16.25 3 19.575 29.275000000000002 32.675 18.475 4 22.925 33.300000000000004 25.4 18.375 5 24.675 35.75 23.875 15.7 6 20.275000000000002 38.75 21.75 19.225 7 19.45 23.549999999999997 38.625 18.375 8 21.775 26.025 27.075 25.124999999999996 9 21.325 24.725 30.525000000000002 23.425 10-14 22.965 29.925 26.06 21.05 15-19 22.685 28.975 27.185 21.154999999999998 20-24 22.634999999999998 28.88 27.26 21.224999999999998 25-29 22.825 28.599999999999998 27.889999999999997 20.685000000000002 30-34 22.46 28.28 28.27 20.990000000000002 35-39 22.74 28.515 27.685 21.060000000000002 40-44 22.785 28.48 27.644999999999996 21.09 45-49 22.465 27.96 28.23 21.345 50-54 23.025000000000002 27.54 28.375 21.060000000000002 55-59 23.23 27.38 27.805000000000003 21.584999999999997 60-64 21.985 28.125 28.365000000000002 21.525 65-69 23.115 28.005000000000003 27.465 21.415 70-74 22.605 28.16 28.084999999999997 21.15 75-79 22.645 28.299999999999997 27.915 21.14 80-84 22.6 27.74 28.175 21.485000000000003 85-89 23.34 27.685 27.57 21.404999999999998 90-94 23.175 28.005000000000003 27.735 21.085 95-99 23.29 27.825 27.485 21.4 100-104 23.27 27.275 28.025 21.43 105-109 23.425 28.26 27.875 20.44 110-114 23.674999999999997 28.23 27.49 20.605 115-119 23.755000000000003 28.125 27.43 20.69 120-124 23.635 27.834999999999997 27.900000000000002 20.630000000000003 125-129 24.075 27.534999999999997 27.435 20.955 130-134 24.104999999999997 28.060000000000002 27.91 19.925 135-139 23.685000000000002 27.72 27.634999999999998 20.96 140-144 24.23 28.22 27.48 20.07 145-149 24.015 27.735 27.265 20.985 150-151 25.1875 27.987499999999997 27.125 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.5 19 2.5 20 1.0 21 1.5 22 2.5 23 1.5 24 2.5 25 4.0 26 7.0 27 8.0 28 8.0 29 11.0 30 15.5 31 21.5 32 28.5 33 38.5 34 47.0 35 61.0 36 86.5 37 109.5 38 135.0 39 171.5 40 208.0 41 239.0 42 241.5 43 246.5 44 277.5 45 282.0 46 259.0 47 244.5 48 237.0 49 211.0 50 167.0 51 130.5 52 108.0 53 84.5 54 71.5 55 68.0 56 46.0 57 25.5 58 21.5 59 16.5 60 12.0 61 7.0 62 4.0 63 5.5 64 3.5 65 2.5 66 2.0 67 0.0 68 0.0 69 0.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.25 #Duplication Level Percentage of deduplicated Percentage of total 1 94.58885941644563 89.14999999999999 2 4.93368700265252 9.3 3 0.3713527851458886 1.05 4 0.05305039787798408 0.2 5 0.02652519893899204 0.125 6 0.0 0.0 7 0.02652519893899204 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCATTCTCTGAAAGAACATCAATATGGCTCCTAAACTTTCCTGTC 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.275 0.0 0.0 0.0 0.0 134-135 2.4000000000000004 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598287 spots for SRR12161417.sra Written 598287 spots for SRR12161417.sra Read 598303 spots for SRR12161417.sra Written 598303 spots for SRR12161417.sra SRR ids: ['SRR12161417.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9nvczlf6 SRR12161417.sra spots: 11965756 blocks: [[1, 598287], [598288, 1196574], [1196575, 1794861], [1794862, 2393148], [2393149, 2991435], [2991436, 3589722], [3589723, 4188009], [4188010, 4786296], [4786297, 5384583], [5384584, 5982870], [5982871, 6581157], [6581158, 7179444], [7179445, 7777731], [7777732, 8376018], [8376019, 8974305], [8974306, 9572592], [9572593, 10170879], [10170880, 10769166], [10769167, 11367453], [11367454, 11965756]] SRR12161417 file size 4044787 SRR12161417 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161417 SRR12161417_1.fastq SRR12161417_2.fastq Input file: SRR12161417_1.fastq Paired file: SRR12161417_2.fastq trimmed: SRR12161417-trimmed-pair1.fastq, SRR12161417-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:41:44 2025 >> started Thu Feb 13 21:42:03 2025 >> done (19.513s) 11965756 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 2462 ( 0.02%) empty read pairs filtered out after trimming by size control 11963271 (99.98%) read pairs available; of these: 646448 ( 5.40%) trimmed read pairs available after processing 11316823 (94.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 6 0.00% 27 6 0.00% 28 6 0.00% 29 3 0.00% 30 9 0.00% 31 11 0.00% 32 7 0.00% 33 9 0.00% 34 7 0.00% 35 9 0.00% 36 11 0.00% 37 5 0.00% 38 9 0.00% 39 13 0.00% 40 16 0.00% 41 12 0.00% 42 12 0.00% 43 8 0.00% 44 14 0.00% 45 4 0.00% 46 16 0.00% 47 12 0.00% 48 8 0.00% 49 14 0.00% 50 24 0.00% 51 20 0.00% 52 27 0.00% 53 26 0.00% 54 16 0.00% 55 21 0.00% 56 28 0.00% 57 34 0.00% 58 37 0.00% 59 34 0.00% 60 39 0.00% 61 46 0.00% 62 55 0.00% 63 68 0.00% 64 69 0.00% 65 54 0.00% 66 75 0.00% 67 88 0.00% 68 84 0.00% 69 105 0.00% 70 131 0.00% 71 128 0.00% 72 146 0.00% 73 180 0.00% 74 177 0.00% 75 166 0.00% 76 237 0.00% 77 274 0.00% 78 311 0.00% 79 353 0.00% 80 419 0.00% 81 420 0.00% 82 472 0.00% 83 566 0.00% 84 600 0.01% 85 682 0.01% 86 797 0.01% 87 859 0.01% 88 933 0.01% 89 951 0.01% 90 1197 0.01% 91 1274 0.01% 92 1388 0.01% 93 1559 0.01% 94 1689 0.01% 95 1870 0.02% 96 2090 0.02% 97 2317 0.02% 98 2451 0.02% 99 2647 0.02% 100 2823 0.02% 101 3128 0.03% 102 3259 0.03% 103 3579 0.03% 104 3954 0.03% 105 4203 0.04% 106 4380 0.04% 107 4629 0.04% 108 4990 0.04% 109 5155 0.04% 110 5452 0.05% 111 5730 0.05% 112 6174 0.05% 113 6279 0.05% 114 6826 0.06% 115 7297 0.06% 116 7558 0.06% 117 8091 0.07% 118 8416 0.07% 119 8663 0.07% 120 9171 0.08% 121 9679 0.08% 122 10186 0.09% 123 10279 0.09% 124 10919 0.09% 125 11353 0.09% 126 11780 0.10% 127 12055 0.10% 128 12798 0.11% 129 12963 0.11% 130 13298 0.11% 131 13756 0.11% 132 14315 0.12% 133 15153 0.13% 134 15501 0.13% 135 16240 0.14% 136 16696 0.14% 137 17168 0.14% 138 17400 0.15% 139 18606 0.16% 140 18815 0.16% 141 19021 0.16% 142 19940 0.17% 143 20413 0.17% 144 21289 0.18% 145 21879 0.18% 146 22411 0.19% 147 22763 0.19% 148 23466 0.20% 149 23773 0.20% 150 24303 0.20% 151 11316823 94.60% 11963271 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=18 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=8.77 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.8 sequence=TAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=14 prefix-density=0.91 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=29.36 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12161417 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:42:47 Started mapping on | Feb 13 21:42:47 Finished on | Feb 13 21:44:06 Mapping speed, Million of reads per hour | 545.16 Number of input reads | 11963271 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11350685 Uniquely mapped reads % | 94.88% Average mapped length | 298.62 Number of splices: Total | 11418495 Number of splices: Annotated (sjdb) | 11168063 Number of splices: GT/AG | 11186997 Number of splices: GC/AG | 191016 Number of splices: AT/AC | 8863 Number of splices: Non-canonical | 31619 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281491 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 55303 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.18% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 331095 331095 331095 N_multimapping 281491 281491 281491 N_noFeature 398791 11217311 444850 N_ambiguous 165937 660 78201 UnstrandedReadsAssigned:10785957 PositiveStrandReadsAssigned:132714 NegativeStrandReadsAssigned:10827634 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161417 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161417-trimmed-pair1.fastq SRR12161417-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,963,271 reads, 10,886,963 reads pseudoaligned [quant] estimated average fragment length: 281.992 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR12161417.ke.tsv 34699 SRR12161417.se.tsv 87100 total ==> SRR12161417.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.01 453 22.5629 Potri.005G024800.1.v4.1 1035 754.008 458 52.5519 Potri.004G059700.1.v4.1 961 680.23 54 6.8681 Potri.007G009000.2.v4.1 1416 1135.01 0 0 Potri.003G141000.2.v4.1 2943 2662.01 365 11.8627 Potri.016G087400.1.v4.1 270 72.6517 552 657.342 Potri.015G069301.1.v4.1 564 301.327 0 0 Potri.010G195200.1.v4.1 1773 1492.01 6 0.347919 Potri.012G127500.1.v4.1 977 696.144 271 33.6798 ==> SRR12161417.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 344 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 165 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR12161417 completed mapping pipeline successfully