Starting /dee2/code/volunteer_pipeline.sh SRR12161418 current disk space = 3088626626560 free memory = 1581930312 SRR12161418 SRAfilesize d3ca8390ed59313f3cc2ff9aeba2725f SRR12161418.sra SRR12161418.sra file validated SRR12161418 is paired end SRR12161418 is conventional basespace SRR12161418 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161418_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.52075 37.0 37.0 37.0 37.0 37.0 2 36.521 37.0 37.0 37.0 37.0 37.0 3 36.4745 37.0 37.0 37.0 37.0 37.0 4 36.5135 37.0 37.0 37.0 37.0 37.0 5 36.625 37.0 37.0 37.0 37.0 37.0 6 36.586 37.0 37.0 37.0 37.0 37.0 7 36.524 37.0 37.0 37.0 37.0 37.0 8 36.539 37.0 37.0 37.0 37.0 37.0 9 36.504 37.0 37.0 37.0 37.0 37.0 10-14 36.5399 37.0 37.0 37.0 37.0 37.0 15-19 36.5241 37.0 37.0 37.0 37.0 37.0 20-24 36.494299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.47619999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.44250000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.435500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3961 37.0 37.0 37.0 37.0 37.0 45-49 36.382999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.393699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.359399999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.30159999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.2701 37.0 37.0 37.0 37.0 37.0 70-74 36.277699999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.239999999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.231700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2684 37.0 37.0 37.0 37.0 37.0 90-94 36.2405 37.0 37.0 37.0 37.0 37.0 95-99 36.2063 37.0 37.0 37.0 37.0 37.0 100-104 36.176300000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1313 37.0 37.0 37.0 37.0 37.0 110-114 36.151 37.0 37.0 37.0 37.0 37.0 115-119 36.1345 37.0 37.0 37.0 37.0 37.0 120-124 36.0874 37.0 37.0 37.0 37.0 37.0 125-129 36.0652 37.0 37.0 37.0 37.0 37.0 130-134 36.054700000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.0187 37.0 37.0 37.0 37.0 37.0 140-144 36.004200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.919700000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.79325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 0.0 24 2.0 25 2.0 26 4.0 27 5.0 28 16.0 29 20.0 30 25.0 31 35.0 32 40.0 33 81.0 34 140.0 35 277.0 36 2906.0 37 445.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.23529411764706 13.141426783479348 5.581977471839799 33.04130162703379 2 21.65 12.049999999999999 33.900000000000006 32.4 3 17.275 17.275 31.225 34.225 4 21.375 25.25 24.975 28.4 5 22.900000000000002 30.0 24.8 22.3 6 21.425 34.625 22.6 21.349999999999998 7 14.875 27.625 39.574999999999996 17.925 8 17.925 27.35 30.575000000000003 24.15 9 16.875 24.95 34.599999999999994 23.575 10-14 19.82 29.915000000000003 27.51 22.755 15-19 20.665 28.139999999999997 27.139999999999997 24.055 20-24 20.39 28.27 27.634999999999998 23.705000000000002 25-29 20.43 28.73 27.415 23.425 30-34 20.8 28.235 26.900000000000002 24.065 35-39 20.53 28.76 27.105 23.605 40-44 20.235 28.9 26.840000000000003 24.025 45-49 19.985 28.939999999999998 27.325 23.75 50-54 20.665 28.060000000000002 27.435 23.84 55-59 19.685 28.794999999999998 27.644999999999996 23.875 60-64 20.21 28.544999999999998 27.42 23.825 65-69 20.47 28.225 27.639999999999997 23.665 70-74 20.52 28.389999999999997 27.689999999999998 23.400000000000002 75-79 20.485 27.97 27.655 23.89 80-84 20.575 28.794999999999998 27.189999999999998 23.44 85-89 20.54 28.57 26.96 23.93 90-94 20.724999999999998 28.599999999999998 27.139999999999997 23.535 95-99 20.665 28.09 27.595 23.65 100-104 20.76 28.194999999999997 27.534999999999997 23.51 105-109 21.07 27.91 27.12 23.9 110-114 20.68 28.015 27.169999999999998 24.135 115-119 21.044999999999998 28.46 27.145000000000003 23.35 120-124 21.005 27.839999999999996 27.025 24.13 125-129 21.060000000000002 28.095 27.229999999999997 23.615 130-134 20.990000000000002 27.85 27.38 23.78 135-139 21.065 28.365000000000002 27.275 23.294999999999998 140-144 21.305 27.405 26.889999999999997 24.4 145-149 21.17 27.589999999999996 26.85 24.39 150-151 21.175 28.287499999999998 26.700000000000003 23.8375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 2.5 21 2.0 22 2.5 23 2.5 24 2.5 25 4.5 26 7.5 27 11.5 28 12.5 29 10.5 30 12.5 31 19.5 32 29.5 33 43.5 34 52.5 35 59.5 36 79.5 37 110.0 38 140.0 39 156.0 40 179.5 41 209.0 42 211.0 43 223.0 44 234.0 45 241.5 46 262.0 47 252.0 48 243.5 49 227.5 50 180.0 51 153.0 52 139.0 53 108.0 54 90.0 55 81.0 56 53.0 57 32.5 58 30.5 59 27.5 60 21.0 61 12.5 62 5.5 63 4.5 64 4.5 65 3.0 66 1.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.62962962962963 89.425 2 5.0 9.45 3 0.31746031746031744 0.8999999999999999 4 0.026455026455026457 0.1 5 0.026455026455026457 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.5125 0.0 0.0 0.0 0.0 120-121 1.7375 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.1624999999999996 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.875 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.65 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.2375 0.0 0.0 0.0 0.0 138-139 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGATT 10 0.006830828 145.0 2 GTTAGAT 10 0.006830828 145.0 1 TAGATTT 10 0.006830828 145.0 3 TTAGATT 10 0.006830828 145.0 2 >>END_MODULE SRR12161418 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161418_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.998 37.0 37.0 37.0 37.0 37.0 2 35.6795 37.0 37.0 37.0 37.0 37.0 3 35.6825 37.0 37.0 37.0 37.0 37.0 4 35.8185 37.0 37.0 37.0 37.0 37.0 5 35.9835 37.0 37.0 37.0 37.0 37.0 6 35.903 37.0 37.0 37.0 37.0 37.0 7 35.7815 37.0 37.0 37.0 37.0 37.0 8 36.051 37.0 37.0 37.0 37.0 37.0 9 35.9985 37.0 37.0 37.0 37.0 37.0 10-14 35.9846 37.0 37.0 37.0 37.0 37.0 15-19 36.01 37.0 37.0 37.0 37.0 37.0 20-24 35.942699999999995 37.0 37.0 37.0 37.0 37.0 25-29 35.8777 37.0 37.0 37.0 37.0 37.0 30-34 35.9457 37.0 37.0 37.0 37.0 37.0 35-39 35.8719 37.0 37.0 37.0 37.0 37.0 40-44 35.87220000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.85979999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.806400000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.7118 37.0 37.0 37.0 37.0 37.0 60-64 35.6888 37.0 37.0 37.0 37.0 37.0 65-69 35.7025 37.0 37.0 37.0 37.0 37.0 70-74 35.588300000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.6189 37.0 37.0 37.0 37.0 37.0 80-84 35.7214 37.0 37.0 37.0 37.0 37.0 85-89 35.5512 37.0 37.0 37.0 37.0 37.0 90-94 35.5624 37.0 37.0 37.0 37.0 37.0 95-99 35.5398 37.0 37.0 37.0 37.0 37.0 100-104 35.6059 37.0 37.0 37.0 37.0 37.0 105-109 35.5392 37.0 37.0 37.0 37.0 37.0 110-114 35.575900000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.5218 37.0 37.0 37.0 37.0 37.0 120-124 35.4486 37.0 37.0 37.0 34.6 37.0 125-129 35.4246 37.0 37.0 37.0 37.0 37.0 130-134 35.27850000000001 37.0 37.0 37.0 32.2 37.0 135-139 35.27739999999999 37.0 37.0 37.0 29.8 37.0 140-144 35.1613 37.0 37.0 37.0 25.0 37.0 145-149 35.280100000000004 37.0 37.0 37.0 29.8 37.0 150-151 34.60925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 3.0 15 4.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 1.0 22 6.0 23 7.0 24 7.0 25 15.0 26 13.0 27 7.0 28 28.0 29 22.0 30 36.0 31 71.0 32 57.0 33 140.0 34 253.0 35 631.0 36 2502.0 37 186.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.475 26.625 8.924999999999999 20.974999999999998 2 28.299999999999997 27.275 27.200000000000003 17.224999999999998 3 21.5 27.625 31.874999999999996 19.0 4 22.925 35.099999999999994 24.025 17.95 5 23.599999999999998 38.15 21.375 16.875 6 22.7 39.825 20.275000000000002 17.2 7 22.025 23.875 35.15 18.95 8 20.75 27.825 26.724999999999998 24.7 9 21.8 25.15 29.075 23.974999999999998 10-14 23.919999999999998 29.604999999999997 25.485000000000003 20.990000000000002 15-19 23.48 28.7 27.05 20.77 20-24 23.585 28.189999999999998 27.315 20.91 25-29 22.869999999999997 28.65 27.295 21.185000000000002 30-34 23.419999999999998 28.095 27.529999999999998 20.955 35-39 22.900000000000002 27.815 27.939999999999998 21.345 40-44 23.025000000000002 27.750000000000004 27.82 21.404999999999998 45-49 23.45 27.68 27.515 21.355 50-54 22.975 28.04 27.775 21.21 55-59 23.72 27.584999999999997 27.355 21.34 60-64 23.435 27.665 27.439999999999998 21.46 65-69 23.515 27.560000000000002 27.915 21.01 70-74 23.830000000000002 27.97 26.69 21.51 75-79 23.724999999999998 27.74 27.105 21.43 80-84 23.41 27.3 27.665 21.625 85-89 23.35 28.175 26.790000000000003 21.685 90-94 23.735 27.6 26.919999999999998 21.745 95-99 23.615 26.945000000000004 28.249999999999996 21.19 100-104 23.69 27.77 27.175 21.365000000000002 105-109 23.405 28.139999999999997 27.445000000000004 21.01 110-114 24.01 27.339999999999996 27.845 20.805 115-119 24.610000000000003 27.939999999999998 26.5 20.95 120-124 24.185000000000002 27.91 26.834999999999997 21.07 125-129 24.385 27.555000000000003 27.125 20.935000000000002 130-134 24.94 27.13 27.205000000000002 20.724999999999998 135-139 24.435000000000002 27.060000000000002 28.02 20.485 140-144 24.94 27.775 26.695 20.59 145-149 25.16 26.82 27.500000000000004 20.52 150-151 25.4875 28.0625 26.2625 20.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 2.0 17 1.5 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 1.0 24 1.5 25 2.5 26 2.0 27 4.0 28 6.5 29 10.0 30 16.0 31 19.5 32 22.5 33 21.5 34 35.5 35 55.0 36 67.0 37 108.0 38 138.0 39 149.0 40 175.5 41 207.0 42 231.0 43 247.5 44 277.0 45 278.0 46 263.0 47 257.5 48 242.0 49 227.5 50 189.0 51 149.0 52 120.5 53 97.0 54 86.5 55 74.5 56 51.5 57 39.5 58 34.0 59 23.5 60 18.0 61 9.0 62 9.0 63 6.5 64 1.5 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.82439926062847 89.775 2 4.753102719831001 9.0 3 0.39609189331925004 1.125 4 0.026406126221283337 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.2125000000000004 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.7 0.0 0.0 0.0 0.0 134-135 3.9749999999999996 0.0 0.0 0.0 0.0 136-137 4.3 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGGC 10 0.006830828 145.0 8 >>END_MODULE Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710670 spots for SRR12161418.sra Written 710670 spots for SRR12161418.sra Read 710683 spots for SRR12161418.sra Written 710683 spots for SRR12161418.sra SRR ids: ['SRR12161418.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_glp0wm6j SRR12161418.sra spots: 14213413 blocks: [[1, 710670], [710671, 1421340], [1421341, 2132010], [2132011, 2842680], [2842681, 3553350], [3553351, 4264020], [4264021, 4974690], [4974691, 5685360], [5685361, 6396030], [6396031, 7106700], [7106701, 7817370], [7817371, 8528040], [8528041, 9238710], [9238711, 9949380], [9949381, 10660050], [10660051, 11370720], [11370721, 12081390], [12081391, 12792060], [12792061, 13502730], [13502731, 14213413]] SRR12161418 file size 4808639 SRR12161418 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161418 SRR12161418_1.fastq SRR12161418_2.fastq Input file: SRR12161418_1.fastq Paired file: SRR12161418_2.fastq trimmed: SRR12161418-trimmed-pair1.fastq, SRR12161418-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:22:30 2025 >> started Thu Feb 13 22:22:46 2025 >> done (15.890s) 14213413 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 3894 ( 0.03%) empty read pairs filtered out after trimming by size control 14209500 (99.97%) read pairs available; of these: 972041 ( 6.84%) trimmed read pairs available after processing 13237459 (93.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 8 0.00% 21 1 0.00% 22 5 0.00% 23 10 0.00% 24 6 0.00% 25 13 0.00% 26 9 0.00% 27 10 0.00% 28 16 0.00% 29 13 0.00% 30 18 0.00% 31 13 0.00% 32 7 0.00% 33 13 0.00% 34 15 0.00% 35 12 0.00% 36 18 0.00% 37 17 0.00% 38 27 0.00% 39 16 0.00% 40 13 0.00% 41 15 0.00% 42 24 0.00% 43 20 0.00% 44 23 0.00% 45 27 0.00% 46 16 0.00% 47 18 0.00% 48 21 0.00% 49 30 0.00% 50 24 0.00% 51 31 0.00% 52 35 0.00% 53 26 0.00% 54 40 0.00% 55 34 0.00% 56 41 0.00% 57 59 0.00% 58 59 0.00% 59 68 0.00% 60 70 0.00% 61 79 0.00% 62 84 0.00% 63 99 0.00% 64 114 0.00% 65 100 0.00% 66 124 0.00% 67 132 0.00% 68 133 0.00% 69 190 0.00% 70 213 0.00% 71 232 0.00% 72 269 0.00% 73 305 0.00% 74 297 0.00% 75 368 0.00% 76 400 0.00% 77 437 0.00% 78 517 0.00% 79 580 0.00% 80 703 0.00% 81 782 0.01% 82 842 0.01% 83 982 0.01% 84 1152 0.01% 85 1252 0.01% 86 1335 0.01% 87 1478 0.01% 88 1605 0.01% 89 1759 0.01% 90 1943 0.01% 91 2192 0.02% 92 2531 0.02% 93 2738 0.02% 94 3011 0.02% 95 3281 0.02% 96 3361 0.02% 97 3810 0.03% 98 4146 0.03% 99 4331 0.03% 100 4828 0.03% 101 5057 0.04% 102 5724 0.04% 103 5977 0.04% 104 6459 0.05% 105 7060 0.05% 106 7167 0.05% 107 7750 0.05% 108 7780 0.05% 109 8497 0.06% 110 8832 0.06% 111 9163 0.06% 112 10208 0.07% 113 10583 0.07% 114 11274 0.08% 115 11975 0.08% 116 12492 0.09% 117 12700 0.09% 118 13187 0.09% 119 13602 0.10% 120 14174 0.10% 121 14975 0.11% 122 15483 0.11% 123 16371 0.12% 124 17309 0.12% 125 17959 0.13% 126 18702 0.13% 127 18876 0.13% 128 19054 0.13% 129 19687 0.14% 130 20138 0.14% 131 20724 0.15% 132 21630 0.15% 133 22788 0.16% 134 23548 0.17% 135 24077 0.17% 136 25038 0.18% 137 25088 0.18% 138 25733 0.18% 139 26181 0.18% 140 26626 0.19% 141 26921 0.19% 142 28450 0.20% 143 29153 0.21% 144 30398 0.21% 145 31025 0.22% 146 31379 0.22% 147 32105 0.23% 148 32552 0.23% 149 33054 0.23% 150 33670 0.24% 151 13237459 93.16% 14209500 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.79 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.27 sequence-density-rank=16 fanout-score=7.03 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=3.7 sequence=TTGCAGCCATTCTC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=10 prefix-density=0.79 prefix-fanout=2.3 sequence=CTAGCAGAAGCTGCCATCTCATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=78.89 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.6 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR12161418 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:23:29 Started mapping on | Feb 13 22:23:29 Finished on | Feb 13 22:25:19 Mapping speed, Million of reads per hour | 465.04 Number of input reads | 14209500 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12956966 Uniquely mapped reads % | 91.19% Average mapped length | 297.76 Number of splices: Total | 13083652 Number of splices: Annotated (sjdb) | 12832540 Number of splices: GT/AG | 12807415 Number of splices: GC/AG | 231419 Number of splices: AT/AC | 10189 Number of splices: Non-canonical | 34629 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 335556 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 91941 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.55% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 916978 916978 916978 N_multimapping 335556 335556 335556 N_noFeature 358443 12795389 405327 N_ambiguous 215417 679 100329 UnstrandedReadsAssigned:12383106 PositiveStrandReadsAssigned:160898 NegativeStrandReadsAssigned:12451310 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161418 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161418-trimmed-pair1.fastq SRR12161418-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,209,500 reads, 12,640,939 reads pseudoaligned [quant] estimated average fragment length: 271.291 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR12161418.ke.tsv 34699 SRR12161418.se.tsv 87100 total ==> SRR12161418.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.71 310 12.1763 Potri.005G024800.1.v4.1 1035 764.709 349 31.3293 Potri.004G059700.1.v4.1 961 690.971 26 2.58306 Potri.007G009000.2.v4.1 1416 1145.71 0 0 Potri.003G141000.2.v4.1 2943 2672.71 392 10.0683 Potri.016G087400.1.v4.1 270 76.8996 773 690.044 Potri.015G069301.1.v4.1 564 309.119 0 0 Potri.010G195200.1.v4.1 1773 1502.71 14 0.63955 Potri.012G127500.1.v4.1 977 706.845 445 43.2173 ==> SRR12161418.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 101 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12161418 completed mapping pipeline successfully