Starting /dee2/code/volunteer_pipeline.sh SRR12161419 current disk space = 3088650489856 free memory = 1582397012 SRR12161419 SRAfilesize 3bb9fa55ba529708aa3f430b11c66f8c SRR12161419.sra SRR12161419.sra file validated SRR12161419 is paired end SRR12161419 is conventional basespace SRR12161419 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161419_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42375 37.0 37.0 37.0 37.0 37.0 2 36.36 37.0 37.0 37.0 37.0 37.0 3 36.523 37.0 37.0 37.0 37.0 37.0 4 36.491 37.0 37.0 37.0 37.0 37.0 5 36.5385 37.0 37.0 37.0 37.0 37.0 6 36.5665 37.0 37.0 37.0 37.0 37.0 7 36.4825 37.0 37.0 37.0 37.0 37.0 8 36.5305 37.0 37.0 37.0 37.0 37.0 9 36.526 37.0 37.0 37.0 37.0 37.0 10-14 36.5302 37.0 37.0 37.0 37.0 37.0 15-19 36.5006 37.0 37.0 37.0 37.0 37.0 20-24 36.4535 37.0 37.0 37.0 37.0 37.0 25-29 36.413599999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3869 37.0 37.0 37.0 37.0 37.0 35-39 36.385400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.375299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.408500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.292899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3235 37.0 37.0 37.0 37.0 37.0 60-64 36.3279 37.0 37.0 37.0 37.0 37.0 65-69 36.2675 37.0 37.0 37.0 37.0 37.0 70-74 36.3082 37.0 37.0 37.0 37.0 37.0 75-79 36.2402 37.0 37.0 37.0 37.0 37.0 80-84 36.2248 37.0 37.0 37.0 37.0 37.0 85-89 36.1893 37.0 37.0 37.0 37.0 37.0 90-94 36.180499999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1536 37.0 37.0 37.0 37.0 37.0 100-104 36.1575 37.0 37.0 37.0 37.0 37.0 105-109 36.1055 37.0 37.0 37.0 37.0 37.0 110-114 36.0772 37.0 37.0 37.0 37.0 37.0 115-119 36.0679 37.0 37.0 37.0 37.0 37.0 120-124 36.0176 37.0 37.0 37.0 37.0 37.0 125-129 35.9938 37.0 37.0 37.0 37.0 37.0 130-134 35.97709999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.88440000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.8789 37.0 37.0 37.0 37.0 37.0 145-149 35.8075 37.0 37.0 37.0 37.0 37.0 150-151 35.7055 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 5.0 26 4.0 27 5.0 28 10.0 29 22.0 30 37.0 31 48.0 32 49.0 33 78.0 34 111.0 35 317.0 36 2923.0 37 391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.18404601150287 12.228057014253563 6.876719179794949 44.711177794448616 2 17.325 13.875000000000002 36.925000000000004 31.874999999999996 3 16.525000000000002 15.35 28.15 39.975 4 22.35 25.424999999999997 23.025000000000002 29.2 5 22.775000000000002 31.2 24.325 21.7 6 19.7 34.875 24.175 21.25 7 15.525 25.624999999999996 41.199999999999996 17.65 8 18.099999999999998 25.575 32.125 24.2 9 16.775000000000002 22.95 36.8 23.474999999999998 10-14 19.314999999999998 29.49 28.105000000000004 23.09 15-19 19.645000000000003 28.725 27.42 24.21 20-24 19.759999999999998 29.025000000000002 27.810000000000002 23.405 25-29 19.37 28.615000000000002 27.965 24.05 30-34 19.225 29.385 27.075 24.315 35-39 20.380000000000003 29.15 27.205000000000002 23.265 40-44 19.915 28.555000000000003 27.755000000000003 23.775 45-49 20.150000000000002 28.615000000000002 27.255000000000003 23.98 50-54 19.655 27.99 28.425 23.93 55-59 19.939999999999998 28.055000000000003 27.944999999999997 24.060000000000002 60-64 20.415 28.310000000000002 27.55 23.724999999999998 65-69 20.349999999999998 28.79 27.534999999999997 23.325000000000003 70-74 20.21 29.4 27.139999999999997 23.25 75-79 20.294999999999998 28.52 27.689999999999998 23.494999999999997 80-84 20.735 28.415000000000003 28.055000000000003 22.795 85-89 20.46 28.03 27.810000000000002 23.7 90-94 20.5 28.525 27.48 23.494999999999997 95-99 20.595 28.215 27.975 23.215 100-104 20.635 28.07 28.525 22.770000000000003 105-109 20.52 28.475 27.615000000000002 23.39 110-114 20.979999999999997 28.744999999999997 27.395000000000003 22.88 115-119 20.200000000000003 28.435 27.634999999999998 23.73 120-124 20.465 28.82 27.115000000000002 23.599999999999998 125-129 20.24 27.950000000000003 28.044999999999998 23.765 130-134 20.79 28.49 27.74 22.98 135-139 20.055 28.389999999999997 27.650000000000002 23.905 140-144 20.495 28.975 27.295 23.235 145-149 20.62 27.785 27.860000000000003 23.735 150-151 19.9875 28.1875 27.525 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 3.0 23 4.5 24 5.0 25 4.5 26 3.5 27 8.5 28 15.0 29 18.5 30 22.0 31 27.0 32 37.0 33 43.0 34 50.0 35 67.0 36 83.5 37 106.5 38 123.5 39 149.0 40 190.0 41 211.5 42 220.5 43 242.0 44 254.0 45 269.0 46 268.0 47 238.0 48 220.5 49 221.0 50 207.5 51 162.5 52 120.0 53 96.0 54 84.5 55 68.0 56 47.5 57 31.0 58 20.5 59 16.0 60 14.0 61 9.5 62 4.0 63 0.5 64 2.5 65 2.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.575 #Duplication Level Percentage of deduplicated Percentage of total 1 95.5270729793356 91.3 2 4.3159822129217895 8.25 3 0.15694480774261052 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7749999999999999 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.6125 0.0 0.0 0.0 0.0 132-133 1.7375 0.0 0.0 0.0 0.0 134-135 1.9375 0.0 0.0 0.0 0.0 136-137 2.175 0.0 0.0 0.0 0.0 138-139 2.4000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161419 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161419_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2565 37.0 37.0 37.0 37.0 37.0 2 36.0235 37.0 37.0 37.0 37.0 37.0 3 36.1505 37.0 37.0 37.0 37.0 37.0 4 36.1805 37.0 37.0 37.0 37.0 37.0 5 36.3165 37.0 37.0 37.0 37.0 37.0 6 36.1205 37.0 37.0 37.0 37.0 37.0 7 36.2365 37.0 37.0 37.0 37.0 37.0 8 36.2615 37.0 37.0 37.0 37.0 37.0 9 36.2095 37.0 37.0 37.0 37.0 37.0 10-14 36.205 37.0 37.0 37.0 37.0 37.0 15-19 36.2679 37.0 37.0 37.0 37.0 37.0 20-24 36.201 37.0 37.0 37.0 37.0 37.0 25-29 36.1897 37.0 37.0 37.0 37.0 37.0 30-34 36.125099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.108999999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.125800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.075399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.064 37.0 37.0 37.0 37.0 37.0 55-59 36.0302 37.0 37.0 37.0 37.0 37.0 60-64 36.03680000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.989 37.0 37.0 37.0 37.0 37.0 70-74 35.9134 37.0 37.0 37.0 37.0 37.0 75-79 35.928599999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.92100000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8745 37.0 37.0 37.0 37.0 37.0 90-94 35.803200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.838100000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8509 37.0 37.0 37.0 37.0 37.0 105-109 35.853699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.751200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7701 37.0 37.0 37.0 37.0 37.0 120-124 35.732699999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.5996 37.0 37.0 37.0 37.0 37.0 130-134 35.5581 37.0 37.0 37.0 37.0 37.0 135-139 35.6509 37.0 37.0 37.0 37.0 37.0 140-144 35.5523 37.0 37.0 37.0 37.0 37.0 145-149 35.6069 37.0 37.0 37.0 37.0 37.0 150-151 34.948499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 2.0 20 3.0 21 1.0 22 4.0 23 5.0 24 8.0 25 8.0 26 11.0 27 9.0 28 20.0 29 15.0 30 36.0 31 37.0 32 72.0 33 95.0 34 182.0 35 536.0 36 2658.0 37 296.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.425000000000004 22.575 11.475 29.525000000000002 2 24.975 27.250000000000004 31.95 15.825 3 20.625 26.200000000000003 32.9 20.275000000000002 4 23.0 34.300000000000004 22.8 19.900000000000002 5 23.95 37.25 22.7 16.1 6 19.85 38.975 22.45 18.725 7 20.375 21.475 38.75 19.400000000000002 8 20.875 26.125 28.4 24.6 9 20.025000000000002 25.900000000000002 31.45 22.625 10-14 22.695 29.715000000000003 26.419999999999998 21.17 15-19 22.595000000000002 28.52 27.810000000000002 21.075 20-24 22.63 28.575 27.834999999999997 20.96 25-29 22.82 28.715000000000003 27.515 20.95 30-34 22.43 28.15 28.125 21.295 35-39 22.400000000000002 29.025000000000002 27.51 21.065 40-44 22.585 27.67 28.360000000000003 21.385 45-49 22.935 28.199999999999996 28.335 20.53 50-54 22.795 27.88 28.485 20.84 55-59 22.155 28.439999999999998 27.79 21.615000000000002 60-64 22.884999999999998 27.605 28.249999999999996 21.26 65-69 22.41 27.785 28.38 21.425 70-74 22.66 28.060000000000002 27.97 21.310000000000002 75-79 23.075000000000003 27.665 28.194999999999997 21.065 80-84 23.02 27.55 27.97 21.46 85-89 23.165 27.675 27.77 21.39 90-94 23.46 28.01 27.439999999999998 21.09 95-99 22.655 27.62 28.09 21.634999999999998 100-104 23.425 27.955000000000002 27.474999999999998 21.145 105-109 23.1 28.095 28.16 20.645 110-114 23.14 27.495000000000005 27.800000000000004 21.565 115-119 23.54 27.894999999999996 27.41 21.154999999999998 120-124 23.799999999999997 27.950000000000003 27.71 20.54 125-129 23.56 28.34 27.045 21.055 130-134 23.75 27.625 28.055000000000003 20.57 135-139 23.02 27.715 28.27 20.995 140-144 23.635 27.955000000000002 27.98 20.43 145-149 23.705000000000002 27.685 28.175 20.435 150-151 24.375 27.787499999999998 27.3 20.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 2.5 22 2.0 23 1.5 24 3.5 25 6.5 26 9.0 27 13.5 28 12.0 29 9.5 30 18.5 31 25.0 32 34.5 33 44.5 34 55.0 35 68.5 36 88.0 37 119.0 38 144.0 39 179.5 40 203.0 41 213.5 42 226.0 43 252.0 44 272.5 45 272.0 46 247.5 47 224.5 48 215.5 49 188.0 50 166.0 51 147.5 52 119.0 53 94.0 54 83.5 55 64.0 56 49.0 57 42.0 58 27.0 59 14.5 60 10.0 61 8.5 62 6.5 63 4.0 64 1.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.04741833508957 90.2 2 4.610115911485774 8.75 3 0.26343519494204426 0.75 4 0.07903055848261328 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7749999999999999 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.6125 0.0 0.0 0.0 0.0 132-133 1.7375 0.0 0.0 0.0 0.0 134-135 1.9375 0.0 0.0 0.0 0.0 136-137 2.175 0.0 0.0 0.0 0.0 138-139 2.4000000000000004 0.0 0.0125 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACATT 10 0.006830828 145.0 2 >>END_MODULE Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824635 spots for SRR12161419.sra Written 824635 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra Read 824633 spots for SRR12161419.sra Written 824633 spots for SRR12161419.sra SRR ids: ['SRR12161419.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7gisej6s SRR12161419.sra spots: 16492662 blocks: [[1, 824633], [824634, 1649266], [1649267, 2473899], [2473900, 3298532], [3298533, 4123165], [4123166, 4947798], [4947799, 5772431], [5772432, 6597064], [6597065, 7421697], [7421698, 8246330], [8246331, 9070963], [9070964, 9895596], [9895597, 10720229], [10720230, 11544862], [11544863, 12369495], [12369496, 13194128], [13194129, 14018761], [14018762, 14843394], [14843395, 15668027], [15668028, 16492662]] SRR12161419 file size 5583227 SRR12161419 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161419 SRR12161419_1.fastq SRR12161419_2.fastq Input file: SRR12161419_1.fastq Paired file: SRR12161419_2.fastq trimmed: SRR12161419-trimmed-pair1.fastq, SRR12161419-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:22:09 2025 >> started Thu Feb 13 22:22:27 2025 >> done (17.465s) 16492662 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 571 ( 0.00%) empty read pairs filtered out after trimming by size control 16492080 (100.00%) read pairs available; of these: 698517 ( 4.24%) trimmed read pairs available after processing 15793563 (95.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 5 0.00% 28 8 0.00% 29 3 0.00% 30 12 0.00% 31 9 0.00% 32 6 0.00% 33 8 0.00% 34 5 0.00% 35 11 0.00% 36 2 0.00% 37 13 0.00% 38 10 0.00% 39 11 0.00% 40 15 0.00% 41 11 0.00% 42 13 0.00% 43 14 0.00% 44 10 0.00% 45 6 0.00% 46 15 0.00% 47 16 0.00% 48 16 0.00% 49 22 0.00% 50 9 0.00% 51 25 0.00% 52 20 0.00% 53 29 0.00% 54 31 0.00% 55 19 0.00% 56 18 0.00% 57 31 0.00% 58 40 0.00% 59 37 0.00% 60 47 0.00% 61 63 0.00% 62 46 0.00% 63 64 0.00% 64 60 0.00% 65 70 0.00% 66 75 0.00% 67 96 0.00% 68 99 0.00% 69 109 0.00% 70 138 0.00% 71 184 0.00% 72 166 0.00% 73 217 0.00% 74 219 0.00% 75 258 0.00% 76 277 0.00% 77 305 0.00% 78 362 0.00% 79 375 0.00% 80 453 0.00% 81 539 0.00% 82 534 0.00% 83 664 0.00% 84 737 0.00% 85 778 0.00% 86 917 0.01% 87 962 0.01% 88 1014 0.01% 89 1199 0.01% 90 1288 0.01% 91 1393 0.01% 92 1583 0.01% 93 1730 0.01% 94 1942 0.01% 95 2194 0.01% 96 2262 0.01% 97 2476 0.02% 98 2674 0.02% 99 2935 0.02% 100 3062 0.02% 101 3415 0.02% 102 3675 0.02% 103 3948 0.02% 104 4272 0.03% 105 4442 0.03% 106 4715 0.03% 107 5099 0.03% 108 5444 0.03% 109 5598 0.03% 110 5996 0.04% 111 6290 0.04% 112 6708 0.04% 113 6851 0.04% 114 7410 0.04% 115 7794 0.05% 116 7926 0.05% 117 8560 0.05% 118 8994 0.05% 119 9276 0.06% 120 9765 0.06% 121 10157 0.06% 122 10699 0.06% 123 11149 0.07% 124 11537 0.07% 125 11942 0.07% 126 12769 0.08% 127 13199 0.08% 128 13849 0.08% 129 14079 0.09% 130 14804 0.09% 131 15139 0.09% 132 15556 0.09% 133 16221 0.10% 134 16596 0.10% 135 17240 0.10% 136 17602 0.11% 137 18533 0.11% 138 18961 0.11% 139 19739 0.12% 140 20123 0.12% 141 20712 0.13% 142 21880 0.13% 143 21962 0.13% 144 22830 0.14% 145 23415 0.14% 146 23872 0.14% 147 24474 0.15% 148 25512 0.15% 149 25724 0.16% 150 26987 0.16% 151 15793563 95.76% 16492080 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=11.43 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.8 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=4.60 fanout-score-rank=14 prefix-density=0.85 prefix-fanout=2.1 sequence=ATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.16 sequence-density-rank=23 fanout-score=26.63 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=5.7 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12161419 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:23:08 Started mapping on | Feb 13 22:23:08 Finished on | Feb 13 22:24:53 Mapping speed, Million of reads per hour | 565.44 Number of input reads | 16492080 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 15765751 Uniquely mapped reads % | 95.60% Average mapped length | 299.04 Number of splices: Total | 16225450 Number of splices: Annotated (sjdb) | 15830520 Number of splices: GT/AG | 15891913 Number of splices: GC/AG | 267135 Number of splices: AT/AC | 13264 Number of splices: Non-canonical | 53138 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352674 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 39399 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.96% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 373655 373655 373655 N_multimapping 352674 352674 352674 N_noFeature 630317 15574991 689035 N_ambiguous 241350 908 108827 UnstrandedReadsAssigned:14894084 PositiveStrandReadsAssigned:189852 NegativeStrandReadsAssigned:14967889 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161419 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161419-trimmed-pair1.fastq SRR12161419-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,492,080 reads, 14,875,005 reads pseudoaligned [quant] estimated average fragment length: 295.408 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR12161419.ke.tsv 34699 SRR12161419.se.tsv 87100 total ==> SRR12161419.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.59 488 16.8995 Potri.005G024800.1.v4.1 1035 740.592 342 27.5636 Potri.004G059700.1.v4.1 961 666.837 34 3.04332 Potri.007G009000.2.v4.1 1416 1121.59 0 0 Potri.003G141000.2.v4.1 2943 2648.59 909 20.4851 Potri.016G087400.1.v4.1 270 69.0854 711 614.288 Potri.015G069301.1.v4.1 564 290.205 0 0 Potri.010G195200.1.v4.1 1773 1478.59 13 0.524788 Potri.012G127500.1.v4.1 977 682.705 289 25.267 ==> SRR12161419.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 104 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 8 SRR12161419 completed mapping pipeline successfully