Starting /dee2/code/volunteer_pipeline.sh SRR12161420 current disk space = 3088359575552 free memory = 1447939088 SRR12161420 SRAfilesize b189294ddbd83cf820d9b325d2fe2ddf SRR12161420.sra SRR12161420.sra file validated SRR12161420 is paired end SRR12161420 is conventional basespace SRR12161420 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161420_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5495 37.0 37.0 37.0 37.0 37.0 2 36.48 37.0 37.0 37.0 37.0 37.0 3 36.5735 37.0 37.0 37.0 37.0 37.0 4 36.5955 37.0 37.0 37.0 37.0 37.0 5 36.5435 37.0 37.0 37.0 37.0 37.0 6 36.6295 37.0 37.0 37.0 37.0 37.0 7 36.5595 37.0 37.0 37.0 37.0 37.0 8 36.582 37.0 37.0 37.0 37.0 37.0 9 36.516 37.0 37.0 37.0 37.0 37.0 10-14 36.5666 37.0 37.0 37.0 37.0 37.0 15-19 36.5624 37.0 37.0 37.0 37.0 37.0 20-24 36.5105 37.0 37.0 37.0 37.0 37.0 25-29 36.47500000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.4575 37.0 37.0 37.0 37.0 37.0 35-39 36.4469 37.0 37.0 37.0 37.0 37.0 40-44 36.370599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.367799999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.388799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3772 37.0 37.0 37.0 37.0 37.0 60-64 36.337900000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.295 37.0 37.0 37.0 37.0 37.0 70-74 36.271300000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2932 37.0 37.0 37.0 37.0 37.0 80-84 36.3138 37.0 37.0 37.0 37.0 37.0 85-89 36.26369999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2209 37.0 37.0 37.0 37.0 37.0 95-99 36.2423 37.0 37.0 37.0 37.0 37.0 100-104 36.2181 37.0 37.0 37.0 37.0 37.0 105-109 36.088499999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.106 37.0 37.0 37.0 37.0 37.0 115-119 36.1245 37.0 37.0 37.0 37.0 37.0 120-124 36.102700000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.0514 37.0 37.0 37.0 37.0 37.0 130-134 36.0467 37.0 37.0 37.0 37.0 37.0 135-139 35.96849999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.898700000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.9174 37.0 37.0 37.0 37.0 37.0 150-151 35.74575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 3.0 27 7.0 28 10.0 29 15.0 30 28.0 31 42.0 32 58.0 33 74.0 34 118.0 35 294.0 36 2952.0 37 395.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.05 11.675 6.35 37.925 2 19.25 11.35 36.85 32.550000000000004 3 17.325 15.65 29.25 37.775 4 21.85 24.7 23.375 30.075000000000003 5 22.425 29.2 24.55 23.825 6 21.349999999999998 33.825 22.625 22.2 7 15.875 25.674999999999997 40.65 17.8 8 17.8 26.75 31.5 23.95 9 16.675 24.224999999999998 35.25 23.849999999999998 10-14 19.515 29.7 27.825 22.96 15-19 19.93 28.395 27.485 24.19 20-24 20.044999999999998 27.915 28.360000000000003 23.68 25-29 20.135 28.075 28.185 23.605 30-34 19.715 28.325 27.875 24.085 35-39 20.26 28.599999999999998 26.97 24.169999999999998 40-44 19.794999999999998 28.88 27.189999999999998 24.135 45-49 20.255000000000003 27.925 27.395000000000003 24.425 50-54 19.49 28.299999999999997 27.6 24.610000000000003 55-59 20.445 28.565 27.13 23.86 60-64 20.064999999999998 28.27 27.93 23.735 65-69 20.25 27.55 28.139999999999997 24.060000000000002 70-74 20.560000000000002 28.144999999999996 27.245 24.05 75-79 20.24 27.71 27.925 24.125 80-84 20.51 27.805000000000003 27.925 23.76 85-89 20.41 28.425 27.455000000000002 23.71 90-94 20.965 28.23 26.83 23.974999999999998 95-99 20.5 27.744999999999997 27.98 23.775 100-104 20.705000000000002 28.244999999999997 27.37 23.68 105-109 20.385 27.944999999999997 27.735 23.935000000000002 110-114 20.635 27.839999999999996 27.529999999999998 23.995 115-119 21.025 27.47 28.005000000000003 23.5 120-124 21.245 27.900000000000002 26.985 23.87 125-129 20.544999999999998 28.4 27.57 23.485 130-134 21.52 27.634999999999998 27.24 23.605 135-139 21.17 28.185 27.08 23.565 140-144 20.89 27.665 27.589999999999996 23.855 145-149 21.545 28.02 26.805 23.630000000000003 150-151 20.9125 27.875 26.487500000000004 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.0 20 1.0 21 1.0 22 1.5 23 3.0 24 3.5 25 2.5 26 3.5 27 8.5 28 12.5 29 11.5 30 19.0 31 20.5 32 19.5 33 35.0 34 52.5 35 64.0 36 81.5 37 95.5 38 108.5 39 130.5 40 167.0 41 207.0 42 231.5 43 252.0 44 262.5 45 263.5 46 264.5 47 258.5 48 244.0 49 225.0 50 190.0 51 160.5 52 136.5 53 115.0 54 94.0 55 71.0 56 54.5 57 41.0 58 26.0 59 14.5 60 13.5 61 8.5 62 4.5 63 3.5 64 2.5 65 1.0 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 1.0 73 2.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.24250464314142 88.8 2 5.412576280180419 10.2 3 0.3183868400106129 0.8999999999999999 4 0.02653223666755107 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.5 0.0 0.0 0.0 0.0 136-137 3.85 0.0 0.0 0.0 0.0 138-139 4.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTGCA 10 0.006830828 145.0 145 >>END_MODULE SRR12161420 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161420_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2975 37.0 37.0 37.0 37.0 37.0 2 36.0675 37.0 37.0 37.0 37.0 37.0 3 36.0935 37.0 37.0 37.0 37.0 37.0 4 36.199 37.0 37.0 37.0 37.0 37.0 5 36.17 37.0 37.0 37.0 37.0 37.0 6 36.2065 37.0 37.0 37.0 37.0 37.0 7 36.2075 37.0 37.0 37.0 37.0 37.0 8 36.269 37.0 37.0 37.0 37.0 37.0 9 36.355 37.0 37.0 37.0 37.0 37.0 10-14 36.313700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2391 37.0 37.0 37.0 37.0 37.0 20-24 36.2225 37.0 37.0 37.0 37.0 37.0 25-29 36.1528 37.0 37.0 37.0 37.0 37.0 30-34 36.1332 37.0 37.0 37.0 37.0 37.0 35-39 36.112700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1219 37.0 37.0 37.0 37.0 37.0 45-49 36.061099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.0529 37.0 37.0 37.0 37.0 37.0 55-59 35.9651 37.0 37.0 37.0 37.0 37.0 60-64 35.9803 37.0 37.0 37.0 37.0 37.0 65-69 35.980900000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.827600000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8596 37.0 37.0 37.0 37.0 37.0 80-84 35.9336 37.0 37.0 37.0 37.0 37.0 85-89 35.8388 37.0 37.0 37.0 37.0 37.0 90-94 35.846500000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.861200000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8069 37.0 37.0 37.0 37.0 37.0 105-109 35.8629 37.0 37.0 37.0 37.0 37.0 110-114 35.744299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.7685 37.0 37.0 37.0 37.0 37.0 120-124 35.726 37.0 37.0 37.0 37.0 37.0 125-129 35.5557 37.0 37.0 37.0 37.0 37.0 130-134 35.5475 37.0 37.0 37.0 37.0 37.0 135-139 35.562400000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.471199999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.523500000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.04675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 2.0 15 2.0 16 4.0 17 0.0 18 0.0 19 2.0 20 0.0 21 2.0 22 2.0 23 4.0 24 11.0 25 7.0 26 9.0 27 13.0 28 16.0 29 21.0 30 21.0 31 35.0 32 60.0 33 95.0 34 177.0 35 543.0 36 2689.0 37 279.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 26.275 9.049999999999999 24.9 2 27.800000000000004 26.575 29.875 15.75 3 20.9 28.349999999999998 31.075000000000003 19.675 4 24.0 35.075 23.075000000000003 17.849999999999998 5 23.525 38.65 20.75 17.075000000000003 6 20.974999999999998 40.325 21.3 17.4 7 21.0 23.25 36.475 19.275000000000002 8 20.599999999999998 26.55 27.275 25.575 9 23.275000000000002 24.625 29.9 22.2 10-14 23.315 29.580000000000002 26.224999999999998 20.880000000000003 15-19 22.965 27.705000000000002 27.79 21.54 20-24 23.21 27.805000000000003 27.46 21.525 25-29 22.79 27.944999999999997 27.860000000000003 21.404999999999998 30-34 22.645 27.875 27.625 21.855 35-39 22.43 28.749999999999996 27.029999999999998 21.790000000000003 40-44 23.03 28.244999999999997 27.765 20.96 45-49 22.25 28.12 27.555000000000003 22.075 50-54 22.82 27.215 28.349999999999998 21.615000000000002 55-59 23.115 27.815 27.715 21.355 60-64 23.09 28.189999999999998 27.384999999999998 21.335 65-69 23.474999999999998 27.565 27.855 21.105 70-74 23.205000000000002 27.83 26.995 21.97 75-79 23.555 28.34 27.215 20.89 80-84 23.455000000000002 27.915 27.35 21.279999999999998 85-89 23.325000000000003 27.99 26.88 21.805 90-94 23.03 28.215 27.334999999999997 21.42 95-99 23.535 28.1 27.605 20.76 100-104 23.305 28.07 27.76 20.865000000000002 105-109 23.96 27.32 27.615000000000002 21.105 110-114 23.335 27.85 27.85 20.965 115-119 23.61 28.42 27.325 20.645 120-124 23.72 27.915 27.51 20.855 125-129 24.065 28.27 26.674999999999997 20.990000000000002 130-134 24.345 27.224999999999998 27.900000000000002 20.53 135-139 23.91 27.939999999999998 27.224999999999998 20.925 140-144 24.415 28.235 26.810000000000002 20.54 145-149 25.424999999999997 27.465 27.16 19.950000000000003 150-151 24.675 29.075 26.55 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 2.0 23 1.5 24 1.0 25 2.5 26 4.0 27 6.0 28 5.0 29 8.5 30 15.0 31 17.0 32 25.5 33 36.5 34 44.0 35 54.5 36 66.5 37 95.5 38 131.0 39 160.0 40 196.0 41 221.5 42 249.0 43 261.5 44 259.5 45 259.0 46 280.0 47 283.0 48 248.5 49 212.5 50 178.0 51 153.0 52 118.5 53 88.5 54 71.5 55 55.0 56 41.0 57 39.0 58 28.5 59 15.0 60 12.5 61 11.5 62 7.0 63 3.5 64 5.0 65 3.5 66 0.0 67 0.5 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.88681260010678 87.925 2 5.552589428723972 10.4 3 0.4805125467164976 1.35 4 0.05339028296849973 0.2 5 0.026695141484249865 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0125 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.037500000000000006 0.0 0.0 0.025 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.075 0.0 0.0 0.025 0.0 70-71 0.075 0.0 0.0 0.025 0.0 72-73 0.0875 0.0 0.0 0.025 0.0 74-75 0.1 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.1 0.0 0.0 0.025 0.0 80-81 0.1 0.0 0.0 0.025 0.0 82-83 0.1 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.1125 0.0 0.0 0.025 0.0 88-89 0.1375 0.0 0.0 0.025 0.0 90-91 0.15 0.0 0.0 0.025 0.0 92-93 0.16249999999999998 0.0 0.0 0.025 0.0 94-95 0.2 0.0 0.0 0.025 0.0 96-97 0.21250000000000002 0.0 0.0 0.025 0.0 98-99 0.3125 0.0 0.0 0.025 0.0 100-101 0.3625 0.0 0.0 0.025 0.0 102-103 0.4125 0.0 0.0 0.025 0.0 104-105 0.45 0.0 0.0 0.025 0.0 106-107 0.525 0.0 0.0 0.025 0.0 108-109 0.6125 0.0 0.0 0.025 0.0 110-111 0.675 0.0 0.0 0.025 0.0 112-113 0.8125 0.0 0.0 0.025 0.0 114-115 1.0 0.0 0.0 0.025 0.0 116-117 1.1875 0.0 0.0 0.025 0.0 118-119 1.275 0.0 0.0 0.025 0.0 120-121 1.5625 0.0 0.0 0.025 0.0 122-123 1.8 0.0 0.0 0.025 0.0 124-125 2.0375 0.0 0.0 0.025 0.0 126-127 2.2875 0.0 0.0 0.025 0.0 128-129 2.5125 0.0 0.0 0.025 0.0 130-131 3.0250000000000004 0.0 0.0 0.025 0.0 132-133 3.25 0.0 0.0 0.025 0.0 134-135 3.5 0.0 0.0 0.025 0.0 136-137 3.85 0.0 0.0 0.025 0.0 138-139 4.35 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGA 10 0.006830828 145.0 9 GGCCCAG 10 0.006830828 145.0 1 TTCAGTT 10 0.006830828 145.0 7 ATTCAGT 10 0.006830828 145.0 6 >>END_MODULE Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184257 spots for SRR12161420.sra Written 1184257 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra Read 1184256 spots for SRR12161420.sra Written 1184256 spots for SRR12161420.sra SRR ids: ['SRR12161420.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2qztahvu SRR12161420.sra spots: 23685121 blocks: [[1, 1184256], [1184257, 2368512], [2368513, 3552768], [3552769, 4737024], [4737025, 5921280], [5921281, 7105536], [7105537, 8289792], [8289793, 9474048], [9474049, 10658304], [10658305, 11842560], [11842561, 13026816], [13026817, 14211072], [14211073, 15395328], [15395329, 16579584], [16579585, 17763840], [17763841, 18948096], [18948097, 20132352], [20132353, 21316608], [21316609, 22500864], [22500865, 23685121]] SRR12161420 file size 8027539 SRR12161420 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161420 SRR12161420_1.fastq SRR12161420_2.fastq Input file: SRR12161420_1.fastq Paired file: SRR12161420_2.fastq trimmed: SRR12161420-trimmed-pair1.fastq, SRR12161420-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:37:45 2025 >> started Thu Feb 13 21:38:12 2025 >> done (26.818s) 23685121 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 2896 ( 0.01%) empty read pairs filtered out after trimming by size control 23682193 (99.99%) read pairs available; of these: 1682554 ( 7.10%) trimmed read pairs available after processing 21999639 (92.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 8 0.00% 22 9 0.00% 23 12 0.00% 24 5 0.00% 25 8 0.00% 26 12 0.00% 27 10 0.00% 28 13 0.00% 29 12 0.00% 30 9 0.00% 31 8 0.00% 32 10 0.00% 33 13 0.00% 34 15 0.00% 35 12 0.00% 36 12 0.00% 37 19 0.00% 38 17 0.00% 39 19 0.00% 40 25 0.00% 41 26 0.00% 42 21 0.00% 43 26 0.00% 44 19 0.00% 45 11 0.00% 46 22 0.00% 47 34 0.00% 48 43 0.00% 49 37 0.00% 50 43 0.00% 51 30 0.00% 52 33 0.00% 53 30 0.00% 54 46 0.00% 55 57 0.00% 56 41 0.00% 57 54 0.00% 58 46 0.00% 59 86 0.00% 60 92 0.00% 61 102 0.00% 62 129 0.00% 63 143 0.00% 64 135 0.00% 65 153 0.00% 66 179 0.00% 67 196 0.00% 68 206 0.00% 69 255 0.00% 70 270 0.00% 71 357 0.00% 72 394 0.00% 73 412 0.00% 74 474 0.00% 75 571 0.00% 76 620 0.00% 77 672 0.00% 78 766 0.00% 79 868 0.00% 80 918 0.00% 81 1137 0.00% 82 1291 0.01% 83 1391 0.01% 84 1636 0.01% 85 1872 0.01% 86 2119 0.01% 87 2212 0.01% 88 2463 0.01% 89 2625 0.01% 90 3127 0.01% 91 3433 0.01% 92 3737 0.02% 93 4171 0.02% 94 4855 0.02% 95 5192 0.02% 96 5512 0.02% 97 6123 0.03% 98 6605 0.03% 99 7236 0.03% 100 7842 0.03% 101 8241 0.03% 102 9044 0.04% 103 9749 0.04% 104 10561 0.04% 105 11218 0.05% 106 12035 0.05% 107 12769 0.05% 108 13647 0.06% 109 14521 0.06% 110 14850 0.06% 111 15994 0.07% 112 16830 0.07% 113 17630 0.07% 114 18806 0.08% 115 19691 0.08% 116 20848 0.09% 117 22046 0.09% 118 22607 0.10% 119 23780 0.10% 120 24710 0.10% 121 26003 0.11% 122 26768 0.11% 123 27984 0.12% 124 29184 0.12% 125 30239 0.13% 126 32095 0.14% 127 32400 0.14% 128 33703 0.14% 129 35051 0.15% 130 35841 0.15% 131 36921 0.16% 132 38042 0.16% 133 39202 0.17% 134 40594 0.17% 135 41991 0.18% 136 43534 0.18% 137 43799 0.18% 138 44936 0.19% 139 46602 0.20% 140 47559 0.20% 141 48910 0.21% 142 49903 0.21% 143 51272 0.22% 144 54093 0.23% 145 54392 0.23% 146 55624 0.23% 147 56417 0.24% 148 58116 0.25% 149 58089 0.25% 150 60263 0.25% 151 21999639 92.90% 23682193 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.77 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=15.46 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.7 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGAT criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=22 prefix-density=1.03 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=63.97 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.7 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAG SRR12161420 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:38:55 Started mapping on | Feb 13 21:38:55 Finished on | Feb 13 21:41:42 Mapping speed, Million of reads per hour | 510.51 Number of input reads | 23682193 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22248563 Uniquely mapped reads % | 93.95% Average mapped length | 297.95 Number of splices: Total | 23058577 Number of splices: Annotated (sjdb) | 22615322 Number of splices: GT/AG | 22584834 Number of splices: GC/AG | 400762 Number of splices: AT/AC | 15140 Number of splices: Non-canonical | 57841 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 569993 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 158107 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 863637 863637 863637 N_multimapping 569993 569993 569993 N_noFeature 731378 21986456 811297 N_ambiguous 326086 1270 143125 UnstrandedReadsAssigned:21191099 PositiveStrandReadsAssigned:260837 NegativeStrandReadsAssigned:21294141 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161420 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161420-trimmed-pair1.fastq SRR12161420-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,682,193 reads, 21,464,656 reads pseudoaligned [quant] estimated average fragment length: 267.254 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52401 SRR12161420.ke.tsv 34699 SRR12161420.se.tsv 87100 total ==> SRR12161420.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.75 591 14.2976 Potri.005G024800.1.v4.1 1035 768.746 601 33.1314 Potri.004G059700.1.v4.1 961 694.853 45 2.74453 Potri.007G009000.2.v4.1 1416 1149.75 0 0 Potri.003G141000.2.v4.1 2943 2676.75 820 12.9824 Potri.016G087400.1.v4.1 270 76.3696 1372 761.345 Potri.015G069301.1.v4.1 564 311.443 0 0 Potri.010G195200.1.v4.1 1773 1506.75 14 0.393764 Potri.012G127500.1.v4.1 977 710.813 530 31.5986 ==> SRR12161420.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 658 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12161420 completed mapping pipeline successfully