Starting /dee2/code/volunteer_pipeline.sh SRR12161421 current disk space = 3088714772480 free memory = 1567005592 SRR12161421 SRAfilesize e1fa9a267473d322224f6f645052c1c0 SRR12161421.sra SRR12161421.sra file validated SRR12161421 is paired end SRR12161421 is conventional basespace SRR12161421 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161421_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.591 37.0 37.0 37.0 37.0 37.0 2 36.321 37.0 37.0 37.0 37.0 37.0 3 36.5745 37.0 37.0 37.0 37.0 37.0 4 36.5955 37.0 37.0 37.0 37.0 37.0 5 36.6235 37.0 37.0 37.0 37.0 37.0 6 36.538 37.0 37.0 37.0 37.0 37.0 7 36.5315 37.0 37.0 37.0 37.0 37.0 8 36.572 37.0 37.0 37.0 37.0 37.0 9 36.577 37.0 37.0 37.0 37.0 37.0 10-14 36.586 37.0 37.0 37.0 37.0 37.0 15-19 36.5443 37.0 37.0 37.0 37.0 37.0 20-24 36.5135 37.0 37.0 37.0 37.0 37.0 25-29 36.503499999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.487199999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.443 37.0 37.0 37.0 37.0 37.0 40-44 36.422399999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.426 37.0 37.0 37.0 37.0 37.0 50-54 36.353 37.0 37.0 37.0 37.0 37.0 55-59 36.3452 37.0 37.0 37.0 37.0 37.0 60-64 36.339800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.332 37.0 37.0 37.0 37.0 37.0 70-74 36.322500000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.33489999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.276300000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3086 37.0 37.0 37.0 37.0 37.0 90-94 36.2857 37.0 37.0 37.0 37.0 37.0 95-99 36.2204 37.0 37.0 37.0 37.0 37.0 100-104 36.2598 37.0 37.0 37.0 37.0 37.0 105-109 36.1619 37.0 37.0 37.0 37.0 37.0 110-114 36.195100000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1049 37.0 37.0 37.0 37.0 37.0 120-124 36.086499999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.069900000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0771 37.0 37.0 37.0 37.0 37.0 135-139 36.0043 37.0 37.0 37.0 37.0 37.0 140-144 35.9407 37.0 37.0 37.0 37.0 37.0 145-149 35.8626 37.0 37.0 37.0 37.0 37.0 150-151 35.809 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 1.0 26 5.0 27 7.0 28 9.0 29 15.0 30 22.0 31 38.0 32 62.0 33 76.0 34 98.0 35 292.0 36 2915.0 37 457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.37068534267134 11.205602801400701 6.003001500750376 41.42071035517759 2 18.675 13.525 36.35 31.45 3 17.175 16.45 27.325 39.050000000000004 4 21.099999999999998 25.174999999999997 23.75 29.975 5 23.1 31.75 23.525 21.625 6 20.025000000000002 34.625 25.324999999999996 20.025000000000002 7 14.725 25.525 42.25 17.5 8 17.875 25.8 31.125000000000004 25.2 9 15.675 23.674999999999997 36.025 24.625 10-14 19.89 29.049999999999997 27.185 23.875 15-19 19.495 27.689999999999998 28.110000000000003 24.705 20-24 19.744999999999997 27.79 28.285 24.18 25-29 19.73 28.15 27.584999999999997 24.535 30-34 19.585 28.060000000000002 28.01 24.345 35-39 19.575 28.134999999999998 28.33 23.96 40-44 19.74 28.29 27.955000000000002 24.015 45-49 20.31 28.34 27.615000000000002 23.735 50-54 20.225 27.71 27.735 24.33 55-59 20.04 28.645 28.18 23.135 60-64 20.325 27.905 27.284999999999997 24.485 65-69 20.57 27.685 27.29 24.455 70-74 20.165 28.07 27.27 24.495 75-79 19.575 27.675 27.935 24.815 80-84 20.080000000000002 28.225 26.845000000000002 24.85 85-89 20.775 28.775000000000002 27.155 23.294999999999998 90-94 20.169999999999998 28.13 27.589999999999996 24.11 95-99 20.585 27.939999999999998 27.32 24.154999999999998 100-104 20.52 28.499999999999996 26.810000000000002 24.169999999999998 105-109 20.4 27.925 28.055000000000003 23.62 110-114 21.01 28.275 26.945000000000004 23.77 115-119 20.74 28.225 27.685 23.35 120-124 20.560000000000002 28.349999999999998 27.21 23.880000000000003 125-129 20.745 28.225 27.48 23.549999999999997 130-134 21.0 28.044999999999998 27.694999999999997 23.26 135-139 21.205 27.639999999999997 27.24 23.915 140-144 20.815 27.92 27.18 24.085 145-149 21.52 28.1 26.97 23.41 150-151 20.962500000000002 27.9375 27.1375 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 2.0 23 1.5 24 1.0 25 0.0 26 2.5 27 8.0 28 14.5 29 11.0 30 9.0 31 19.5 32 29.5 33 47.5 34 56.0 35 65.0 36 76.0 37 97.0 38 132.5 39 141.5 40 163.0 41 199.5 42 220.5 43 223.5 44 234.0 45 268.5 46 291.5 47 269.0 48 239.0 49 220.5 50 188.5 51 173.0 52 143.5 53 97.5 54 79.5 55 69.0 56 49.5 57 38.0 58 32.0 59 25.0 60 19.0 61 12.5 62 7.0 63 5.0 64 5.0 65 2.5 66 1.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.8949613436417 88.05 2 5.6518261796854175 10.6 3 0.39989336177019463 1.125 4 0.026659557451346308 0.1 5 0.026659557451346308 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAGGTACTTGTCAGCCAATTGGACTCTCTTCACATTCTCTTGCTCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7875 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.4500000000000002 0.0 0.0 0.0 0.0 132-133 1.575 0.0 0.0 0.0 0.0 134-135 1.675 0.0 0.0 0.0 0.0 136-137 1.8250000000000002 0.0 0.0 0.0 0.0 138-139 2.0374999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGAC 10 0.006830828 145.0 1 ATGCACC 10 0.006830828 145.0 6 CATGCAC 10 0.006830828 145.0 5 >>END_MODULE SRR12161421 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161421_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.376 37.0 37.0 37.0 37.0 37.0 2 36.114 37.0 37.0 37.0 37.0 37.0 3 36.163 37.0 37.0 37.0 37.0 37.0 4 36.2385 37.0 37.0 37.0 37.0 37.0 5 36.3185 37.0 37.0 37.0 37.0 37.0 6 36.2535 37.0 37.0 37.0 37.0 37.0 7 36.2545 37.0 37.0 37.0 37.0 37.0 8 36.2065 37.0 37.0 37.0 37.0 37.0 9 36.3125 37.0 37.0 37.0 37.0 37.0 10-14 36.2942 37.0 37.0 37.0 37.0 37.0 15-19 36.3052 37.0 37.0 37.0 37.0 37.0 20-24 36.251799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.193799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.1858 37.0 37.0 37.0 37.0 37.0 35-39 36.1254 37.0 37.0 37.0 37.0 37.0 40-44 36.1524 37.0 37.0 37.0 37.0 37.0 45-49 36.109 37.0 37.0 37.0 37.0 37.0 50-54 36.1428 37.0 37.0 37.0 37.0 37.0 55-59 36.042899999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.101299999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.043800000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9747 37.0 37.0 37.0 37.0 37.0 75-79 35.9833 37.0 37.0 37.0 37.0 37.0 80-84 35.97449999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.9134 37.0 37.0 37.0 37.0 37.0 90-94 35.935199999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9157 37.0 37.0 37.0 37.0 37.0 100-104 35.922399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.91680000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.823 37.0 37.0 37.0 37.0 37.0 115-119 35.859899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.8291 37.0 37.0 37.0 37.0 37.0 125-129 35.7159 37.0 37.0 37.0 37.0 37.0 130-134 35.7068 37.0 37.0 37.0 37.0 37.0 135-139 35.71509999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.6549 37.0 37.0 37.0 37.0 37.0 145-149 35.655899999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.123000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 4.0 20 2.0 21 0.0 22 3.0 23 6.0 24 5.0 25 11.0 26 5.0 27 6.0 28 15.0 29 21.0 30 24.0 31 33.0 32 56.0 33 86.0 34 160.0 35 500.0 36 2779.0 37 276.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.225 24.075 8.85 26.85 2 27.35 27.400000000000002 29.599999999999998 15.65 3 19.775000000000002 28.4 31.025000000000002 20.8 4 22.55 35.575 23.375 18.5 5 24.375 36.8 21.875 16.950000000000003 6 20.775 38.925 22.3 18.0 7 21.5 22.45 36.7 19.35 8 21.4 26.825 28.249999999999996 23.525 9 21.349999999999998 24.025 30.225 24.4 10-14 23.115 29.294999999999998 26.179999999999996 21.41 15-19 23.025000000000002 27.939999999999998 27.705000000000002 21.33 20-24 22.54 29.060000000000002 27.43 20.97 25-29 23.22 28.505000000000003 27.155 21.12 30-34 22.375 28.32 28.299999999999997 21.005 35-39 22.645 28.03 28.18 21.145 40-44 22.040000000000003 28.165000000000003 28.044999999999998 21.75 45-49 22.965 27.875 27.985 21.175 50-54 22.42 28.895 27.04 21.645 55-59 22.625 27.785 27.83 21.759999999999998 60-64 22.935 28.185 27.565 21.315 65-69 22.725 27.54 27.915 21.82 70-74 23.055 27.905 27.445000000000004 21.595 75-79 22.23 28.444999999999997 27.589999999999996 21.735 80-84 23.18 27.77 27.775 21.275 85-89 23.189999999999998 28.105000000000004 27.445000000000004 21.26 90-94 23.095 27.634999999999998 27.405 21.865000000000002 95-99 22.89 28.035 27.395000000000003 21.68 100-104 23.445 27.384999999999998 27.55 21.62 105-109 22.585 27.955000000000002 28.26 21.2 110-114 23.25 28.015 27.73 21.005 115-119 23.5 27.655 27.575 21.27 120-124 24.04 28.435 26.97 20.555 125-129 24.14 27.195000000000004 27.439999999999998 21.224999999999998 130-134 24.310000000000002 27.384999999999998 27.61 20.695 135-139 23.69 27.975 27.235 21.099999999999998 140-144 23.98 27.529999999999998 27.325 21.165 145-149 24.915000000000003 27.384999999999998 27.450000000000003 20.25 150-151 23.962500000000002 28.199999999999996 26.8125 21.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 1.5 8 1.5 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.5 23 3.5 24 4.0 25 2.0 26 2.5 27 4.5 28 6.5 29 9.5 30 15.5 31 23.5 32 28.0 33 38.0 34 49.5 35 68.5 36 83.5 37 100.0 38 133.0 39 164.0 40 202.0 41 228.5 42 238.5 43 251.5 44 245.5 45 257.0 46 283.5 47 277.0 48 234.0 49 186.5 50 166.0 51 132.0 52 108.0 53 98.5 54 77.5 55 60.0 56 47.0 57 36.5 58 27.5 59 22.5 60 18.0 61 14.0 62 12.5 63 9.0 64 4.0 65 2.0 66 1.0 67 2.0 68 1.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 93.82847982901416 87.8 2 5.583756345177665 10.45 3 0.5076142131979695 1.425 4 0.05343307507347048 0.2 5 0.02671653753673524 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7875 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.2000000000000002 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.7 0.0 0.0 0.0 0.0 136-137 1.85 0.0 0.0 0.0 0.0 138-139 2.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747706 spots for SRR12161421.sra Written 747706 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra Read 747691 spots for SRR12161421.sra Written 747691 spots for SRR12161421.sra SRR ids: ['SRR12161421.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zilkv0bo SRR12161421.sra spots: 14953835 blocks: [[1, 747691], [747692, 1495382], [1495383, 2243073], [2243074, 2990764], [2990765, 3738455], [3738456, 4486146], [4486147, 5233837], [5233838, 5981528], [5981529, 6729219], [6729220, 7476910], [7476911, 8224601], [8224602, 8972292], [8972293, 9719983], [9719984, 10467674], [10467675, 11215365], [11215366, 11963056], [11963057, 12710747], [12710748, 13458438], [13458439, 14206129], [14206130, 14953835]] SRR12161421 file size 5060266 SRR12161421 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161421 SRR12161421_1.fastq SRR12161421_2.fastq Input file: SRR12161421_1.fastq Paired file: SRR12161421_2.fastq trimmed: SRR12161421-trimmed-pair1.fastq, SRR12161421-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:26:25 2025 >> started Thu Feb 13 22:26:41 2025 >> done (16.572s) 14953835 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 1071 ( 0.01%) empty read pairs filtered out after trimming by size control 14952741 (99.99%) read pairs available; of these: 507299 ( 3.39%) trimmed read pairs available after processing 14445442 (96.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 5 0.00% 21 1 0.00% 22 2 0.00% 23 6 0.00% 24 6 0.00% 25 13 0.00% 26 4 0.00% 27 5 0.00% 28 11 0.00% 29 3 0.00% 30 4 0.00% 31 13 0.00% 32 9 0.00% 33 3 0.00% 34 7 0.00% 35 12 0.00% 36 5 0.00% 37 9 0.00% 38 6 0.00% 39 15 0.00% 40 6 0.00% 41 10 0.00% 42 6 0.00% 43 10 0.00% 44 14 0.00% 45 10 0.00% 46 11 0.00% 47 16 0.00% 48 19 0.00% 49 19 0.00% 50 19 0.00% 51 27 0.00% 52 24 0.00% 53 28 0.00% 54 20 0.00% 55 33 0.00% 56 22 0.00% 57 31 0.00% 58 28 0.00% 59 31 0.00% 60 54 0.00% 61 44 0.00% 62 54 0.00% 63 48 0.00% 64 75 0.00% 65 81 0.00% 66 72 0.00% 67 80 0.00% 68 83 0.00% 69 93 0.00% 70 121 0.00% 71 132 0.00% 72 145 0.00% 73 161 0.00% 74 164 0.00% 75 209 0.00% 76 235 0.00% 77 228 0.00% 78 255 0.00% 79 322 0.00% 80 352 0.00% 81 371 0.00% 82 454 0.00% 83 478 0.00% 84 540 0.00% 85 603 0.00% 86 658 0.00% 87 719 0.00% 88 751 0.01% 89 799 0.01% 90 923 0.01% 91 1046 0.01% 92 1189 0.01% 93 1253 0.01% 94 1332 0.01% 95 1630 0.01% 96 1690 0.01% 97 1839 0.01% 98 1898 0.01% 99 2041 0.01% 100 2272 0.02% 101 2387 0.02% 102 2571 0.02% 103 2696 0.02% 104 3029 0.02% 105 3168 0.02% 106 3398 0.02% 107 3615 0.02% 108 3680 0.02% 109 3922 0.03% 110 4192 0.03% 111 4559 0.03% 112 4697 0.03% 113 4900 0.03% 114 5159 0.03% 115 5517 0.04% 116 5783 0.04% 117 6083 0.04% 118 6351 0.04% 119 6765 0.05% 120 7019 0.05% 121 7265 0.05% 122 7531 0.05% 123 7921 0.05% 124 8263 0.06% 125 8499 0.06% 126 9044 0.06% 127 9283 0.06% 128 9830 0.07% 129 9934 0.07% 130 10314 0.07% 131 10555 0.07% 132 10995 0.07% 133 11557 0.08% 134 11869 0.08% 135 12614 0.08% 136 12948 0.09% 137 13165 0.09% 138 13643 0.09% 139 14575 0.10% 140 14778 0.10% 141 15046 0.10% 142 15881 0.11% 143 16331 0.11% 144 17032 0.11% 145 17521 0.12% 146 17927 0.12% 147 18332 0.12% 148 18966 0.13% 149 19557 0.13% 150 20613 0.14% 151 14445442 96.61% 14952741 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.50 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=18 fanout-score=8.91 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=4.8 sequence=GCTCCAAGCATGGCCCACCTGGAATGGATGACTTCAAGCTCACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=26 prefix-density=0.65 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=57.24 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12161421 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:27:25 Started mapping on | Feb 13 22:27:25 Finished on | Feb 13 22:28:52 Mapping speed, Million of reads per hour | 618.73 Number of input reads | 14952741 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14127235 Uniquely mapped reads % | 94.48% Average mapped length | 299.52 Number of splices: Total | 14511666 Number of splices: Annotated (sjdb) | 14180927 Number of splices: GT/AG | 14207796 Number of splices: GC/AG | 249483 Number of splices: AT/AC | 12070 Number of splices: Non-canonical | 42317 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341674 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 106814 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 483832 483832 483832 N_multimapping 341674 341674 341674 N_noFeature 515784 13940903 571920 N_ambiguous 218038 1148 87114 UnstrandedReadsAssigned:13393413 PositiveStrandReadsAssigned:185184 NegativeStrandReadsAssigned:13468201 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161421 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161421-trimmed-pair1.fastq SRR12161421-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,952,741 reads, 13,508,451 reads pseudoaligned [quant] estimated average fragment length: 281.445 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR12161421.ke.tsv 34699 SRR12161421.se.tsv 87100 total ==> SRR12161421.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.55 435 15.5146 Potri.005G024800.1.v4.1 1035 754.555 232 19.054 Potri.004G059700.1.v4.1 961 680.723 65 5.91743 Potri.007G009000.2.v4.1 1416 1135.55 0 0 Potri.003G141000.2.v4.1 2943 2662.55 569.417 13.2532 Potri.016G087400.1.v4.1 270 63.2143 777 761.72 Potri.015G069301.1.v4.1 564 295.618 0 0 Potri.010G195200.1.v4.1 1773 1492.55 18 0.747364 Potri.012G127500.1.v4.1 977 696.67 83 7.38314 ==> SRR12161421.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 226 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 200 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR12161421 completed mapping pipeline successfully