Starting /dee2/code/volunteer_pipeline.sh SRR12161422 current disk space = 3088531271680 free memory = 1499187688 SRR12161422 SRAfilesize b7b18240203abf672e92d496e8ced4be SRR12161422.sra SRR12161422.sra file validated SRR12161422 is paired end SRR12161422 is conventional basespace SRR12161422 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161422_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.64175 37.0 37.0 37.0 37.0 37.0 2 36.483 37.0 37.0 37.0 37.0 37.0 3 36.619 37.0 37.0 37.0 37.0 37.0 4 36.6515 37.0 37.0 37.0 37.0 37.0 5 36.6215 37.0 37.0 37.0 37.0 37.0 6 36.589 37.0 37.0 37.0 37.0 37.0 7 36.5595 37.0 37.0 37.0 37.0 37.0 8 36.543 37.0 37.0 37.0 37.0 37.0 9 36.5225 37.0 37.0 37.0 37.0 37.0 10-14 36.5903 37.0 37.0 37.0 37.0 37.0 15-19 36.5678 37.0 37.0 37.0 37.0 37.0 20-24 36.539300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.483399999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4633 37.0 37.0 37.0 37.0 37.0 35-39 36.491 37.0 37.0 37.0 37.0 37.0 40-44 36.415099999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4917 37.0 37.0 37.0 37.0 37.0 50-54 36.3701 37.0 37.0 37.0 37.0 37.0 55-59 36.401799999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.351099999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.367399999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.336 37.0 37.0 37.0 37.0 37.0 75-79 36.3164 37.0 37.0 37.0 37.0 37.0 80-84 36.324200000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.301300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.3 37.0 37.0 37.0 37.0 37.0 95-99 36.282399999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2999 37.0 37.0 37.0 37.0 37.0 105-109 36.223 37.0 37.0 37.0 37.0 37.0 110-114 36.230000000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.2079 37.0 37.0 37.0 37.0 37.0 120-124 36.158699999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.105900000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.0655 37.0 37.0 37.0 37.0 37.0 135-139 36.0023 37.0 37.0 37.0 37.0 37.0 140-144 36.037099999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.9834 37.0 37.0 37.0 37.0 37.0 150-151 35.775999999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 0.0 25 1.0 26 4.0 27 6.0 28 11.0 29 17.0 30 22.0 31 34.0 32 45.0 33 64.0 34 97.0 35 289.0 36 2992.0 37 416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.536134033508375 12.07801950487622 6.57664416104026 36.809202300575144 2 19.650000000000002 14.274999999999999 35.425000000000004 30.65 3 17.625 17.349999999999998 28.549999999999997 36.475 4 21.55 26.1 25.074999999999996 27.275 5 22.325 31.4 23.075000000000003 23.200000000000003 6 21.275 33.85 24.75 20.125 7 15.375 27.775 40.225 16.625 8 17.575 28.349999999999998 29.425 24.65 9 17.549999999999997 24.85 35.25 22.35 10-14 19.52 30.075000000000003 26.625 23.78 15-19 20.07 28.675 27.67 23.585 20-24 19.825 28.804999999999996 27.67 23.7 25-29 20.380000000000003 28.26 27.83 23.53 30-34 20.455000000000002 28.860000000000003 27.084999999999997 23.599999999999998 35-39 20.13 28.505000000000003 27.305 24.060000000000002 40-44 20.015 29.34 27.405 23.24 45-49 20.36 28.89 27.115000000000002 23.635 50-54 20.355 28.89 27.24 23.515 55-59 19.555 29.005 27.310000000000002 24.13 60-64 20.505000000000003 28.249999999999996 27.465 23.78 65-69 20.765 28.244999999999997 27.115000000000002 23.875 70-74 20.61 27.765 27.805000000000003 23.82 75-79 20.125 27.85 27.744999999999997 24.279999999999998 80-84 19.715 28.549999999999997 28.115000000000002 23.62 85-89 20.75 27.37 27.900000000000002 23.98 90-94 20.25 28.544999999999998 27.16 24.044999999999998 95-99 20.515 27.834999999999997 27.584999999999997 24.065 100-104 20.52 28.68 26.685 24.115000000000002 105-109 21.08 28.15 26.634999999999998 24.135 110-114 20.64 27.845 27.884999999999998 23.630000000000003 115-119 21.005 28.54 26.265 24.19 120-124 20.955 27.810000000000002 27.165 24.07 125-129 21.0 28.134999999999998 27.025 23.84 130-134 20.45 28.375 27.224999999999998 23.95 135-139 21.57 28.095 26.8 23.535 140-144 21.255 27.405 27.169999999999998 24.169999999999998 145-149 21.3 28.415000000000003 26.490000000000002 23.794999999999998 150-151 21.5375 26.724999999999998 26.85 24.887500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 2.0 24 3.5 25 2.0 26 2.5 27 5.5 28 11.0 29 19.5 30 27.0 31 24.5 32 28.5 33 42.5 34 57.0 35 74.5 36 97.5 37 116.0 38 143.5 39 164.0 40 156.0 41 172.5 42 221.5 43 262.5 44 258.5 45 247.0 46 246.0 47 231.0 48 228.5 49 218.5 50 183.5 51 149.0 52 119.5 53 100.5 54 84.0 55 82.5 56 69.5 57 44.5 58 27.5 59 19.0 60 18.5 61 10.5 62 6.5 63 4.0 64 2.0 65 1.5 66 2.5 67 3.0 68 2.0 69 0.5 70 0.5 71 1.0 72 1.0 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.80672717565403 87.85 2 5.6860651361452215 10.65 3 0.42712226374799783 1.2 4 0.08008542445274959 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.6749999999999998 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 2.9375 0.0 0.0 0.0 0.0 130-131 3.225 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.975 0.0 0.0 0.0 0.0 136-137 4.525 0.0 0.0 0.0 0.0 138-139 5.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGTG 10 0.006830828 145.0 7 CACACCT 10 0.006830828 145.0 6 ACACCTG 10 0.006830828 145.0 7 >>END_MODULE SRR12161422 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161422_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.398 37.0 37.0 37.0 37.0 37.0 2 36.1525 37.0 37.0 37.0 37.0 37.0 3 36.183 37.0 37.0 37.0 37.0 37.0 4 36.2525 37.0 37.0 37.0 37.0 37.0 5 36.3545 37.0 37.0 37.0 37.0 37.0 6 36.3455 37.0 37.0 37.0 37.0 37.0 7 36.27 37.0 37.0 37.0 37.0 37.0 8 36.3255 37.0 37.0 37.0 37.0 37.0 9 36.242 37.0 37.0 37.0 37.0 37.0 10-14 36.353 37.0 37.0 37.0 37.0 37.0 15-19 36.343399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3141 37.0 37.0 37.0 37.0 37.0 25-29 36.27040000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.265100000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2531 37.0 37.0 37.0 37.0 37.0 40-44 36.244299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.1626 37.0 37.0 37.0 37.0 37.0 50-54 36.201499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.118900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1353 37.0 37.0 37.0 37.0 37.0 65-69 36.1221 37.0 37.0 37.0 37.0 37.0 70-74 36.015 37.0 37.0 37.0 37.0 37.0 75-79 36.0293 37.0 37.0 37.0 37.0 37.0 80-84 36.0501 37.0 37.0 37.0 37.0 37.0 85-89 36.0327 37.0 37.0 37.0 37.0 37.0 90-94 35.9296 37.0 37.0 37.0 37.0 37.0 95-99 35.9617 37.0 37.0 37.0 37.0 37.0 100-104 35.9485 37.0 37.0 37.0 37.0 37.0 105-109 35.971199999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.8811 37.0 37.0 37.0 37.0 37.0 115-119 35.8986 37.0 37.0 37.0 37.0 37.0 120-124 35.9202 37.0 37.0 37.0 37.0 37.0 125-129 35.8186 37.0 37.0 37.0 37.0 37.0 130-134 35.6983 37.0 37.0 37.0 37.0 37.0 135-139 35.7608 37.0 37.0 37.0 37.0 37.0 140-144 35.712900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.745599999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.09225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 7.0 15 0.0 16 0.0 17 2.0 18 2.0 19 1.0 20 0.0 21 5.0 22 1.0 23 5.0 24 2.0 25 6.0 26 6.0 27 11.0 28 7.0 29 8.0 30 30.0 31 42.0 32 44.0 33 80.0 34 153.0 35 440.0 36 2833.0 37 313.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.175 26.174999999999997 9.825000000000001 22.825 2 29.099999999999998 26.724999999999998 27.3 16.875 3 21.099999999999998 27.150000000000002 32.175 19.575 4 23.25 35.05 22.6 19.1 5 25.025 36.775000000000006 20.95 17.25 6 22.400000000000002 40.225 20.175 17.2 7 20.775 23.1 37.824999999999996 18.3 8 22.2 25.45 27.900000000000002 24.45 9 21.625 24.6 29.9 23.875 10-14 23.685000000000002 29.299999999999997 25.319999999999997 21.695 15-19 23.405 28.275 26.810000000000002 21.51 20-24 23.09 27.889999999999997 27.91 21.11 25-29 23.544999999999998 28.58 26.83 21.044999999999998 30-34 23.34 27.944999999999997 27.529999999999998 21.185000000000002 35-39 23.085 27.88 27.465 21.57 40-44 23.205000000000002 28.785 26.88 21.13 45-49 23.095 27.915 27.439999999999998 21.55 50-54 23.305 27.815 27.544999999999998 21.335 55-59 24.005000000000003 27.165 27.77 21.060000000000002 60-64 23.16 27.765 27.615000000000002 21.46 65-69 23.71 27.224999999999998 27.72 21.345 70-74 23.44 27.639999999999997 27.439999999999998 21.48 75-79 23.330000000000002 27.58 27.555000000000003 21.535 80-84 23.78 28.355000000000004 26.490000000000002 21.375 85-89 24.385 27.63 26.86 21.125 90-94 23.369999999999997 28.165000000000003 26.735 21.73 95-99 24.32 27.694999999999997 27.455000000000002 20.53 100-104 24.25 26.884999999999998 27.279999999999998 21.584999999999997 105-109 24.265 27.515 26.905 21.315 110-114 24.425 27.810000000000002 27.24 20.525 115-119 24.05 27.529999999999998 27.685 20.735 120-124 24.375 27.485 27.095000000000002 21.044999999999998 125-129 24.92 27.425 27.189999999999998 20.465 130-134 24.54 27.785 27.465 20.21 135-139 23.494999999999997 27.650000000000002 27.689999999999998 21.165 140-144 25.09 27.705000000000002 26.974999999999998 20.23 145-149 25.285000000000004 27.525 26.66 20.53 150-151 24.825 27.800000000000004 27.425 19.950000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 1.5 15 1.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 3.0 25 2.5 26 1.5 27 3.5 28 4.0 29 3.0 30 6.5 31 10.0 32 17.5 33 31.0 34 47.0 35 56.0 36 75.5 37 127.0 38 151.5 39 167.0 40 185.5 41 196.5 42 233.5 43 262.0 44 271.0 45 261.0 46 241.0 47 227.0 48 219.0 49 205.5 50 179.0 51 150.0 52 122.5 53 98.5 54 97.0 55 89.0 56 65.0 57 44.5 58 28.0 59 26.0 60 23.5 61 15.0 62 10.5 63 10.0 64 6.5 65 2.0 66 0.0 67 0.0 68 0.5 69 2.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.60902255639097 87.15 2 5.692803437164339 10.6 3 0.5370569280343717 1.5 4 0.05370569280343716 0.2 5 0.05370569280343716 0.25 6 0.05370569280343716 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.5125000000000002 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 1.925 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.475 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.275 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 4.0375 0.0 0.0 0.0 0.0 136-137 4.625 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATTTG 10 0.006830828 145.0 3 >>END_MODULE Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137419 spots for SRR12161422.sra Written 1137419 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra Read 1137412 spots for SRR12161422.sra Written 1137412 spots for SRR12161422.sra SRR ids: ['SRR12161422.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6s8v3uug SRR12161422.sra spots: 22748247 blocks: [[1, 1137412], [1137413, 2274824], [2274825, 3412236], [3412237, 4549648], [4549649, 5687060], [5687061, 6824472], [6824473, 7961884], [7961885, 9099296], [9099297, 10236708], [10236709, 11374120], [11374121, 12511532], [12511533, 13648944], [13648945, 14786356], [14786357, 15923768], [15923769, 17061180], [17061181, 18198592], [18198593, 19336004], [19336005, 20473416], [20473417, 21610828], [21610829, 22748247]] SRR12161422 file size 7709149 SRR12161422 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161422 SRR12161422_1.fastq SRR12161422_2.fastq Input file: SRR12161422_1.fastq Paired file: SRR12161422_2.fastq trimmed: SRR12161422-trimmed-pair1.fastq, SRR12161422-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:02:50 2025 >> started Thu Feb 13 22:03:14 2025 >> done (24.262s) 22748247 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 8312 ( 0.04%) empty read pairs filtered out after trimming by size control 22739902 (99.96%) read pairs available; of these: 1721695 ( 7.57%) trimmed read pairs available after processing 21018207 (92.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 4 0.00% 21 6 0.00% 22 4 0.00% 23 9 0.00% 24 15 0.00% 25 7 0.00% 26 10 0.00% 27 6 0.00% 28 10 0.00% 29 13 0.00% 30 15 0.00% 31 10 0.00% 32 12 0.00% 33 13 0.00% 34 14 0.00% 35 19 0.00% 36 13 0.00% 37 17 0.00% 38 3 0.00% 39 10 0.00% 40 20 0.00% 41 23 0.00% 42 21 0.00% 43 30 0.00% 44 22 0.00% 45 30 0.00% 46 25 0.00% 47 20 0.00% 48 29 0.00% 49 36 0.00% 50 43 0.00% 51 53 0.00% 52 40 0.00% 53 49 0.00% 54 61 0.00% 55 50 0.00% 56 84 0.00% 57 73 0.00% 58 67 0.00% 59 116 0.00% 60 139 0.00% 61 129 0.00% 62 147 0.00% 63 144 0.00% 64 174 0.00% 65 190 0.00% 66 207 0.00% 67 235 0.00% 68 282 0.00% 69 304 0.00% 70 386 0.00% 71 407 0.00% 72 466 0.00% 73 556 0.00% 74 606 0.00% 75 680 0.00% 76 670 0.00% 77 870 0.00% 78 870 0.00% 79 1027 0.00% 80 1180 0.01% 81 1315 0.01% 82 1509 0.01% 83 1663 0.01% 84 1949 0.01% 85 2178 0.01% 86 2284 0.01% 87 2564 0.01% 88 2721 0.01% 89 3203 0.01% 90 3510 0.02% 91 3913 0.02% 92 4303 0.02% 93 4843 0.02% 94 5291 0.02% 95 5875 0.03% 96 6322 0.03% 97 6670 0.03% 98 7043 0.03% 99 7627 0.03% 100 8277 0.04% 101 8803 0.04% 102 9481 0.04% 103 10246 0.05% 104 11187 0.05% 105 12137 0.05% 106 12560 0.06% 107 13209 0.06% 108 13751 0.06% 109 14725 0.06% 110 15275 0.07% 111 16240 0.07% 112 17182 0.08% 113 17924 0.08% 114 19364 0.09% 115 20434 0.09% 116 21395 0.09% 117 22322 0.10% 118 22898 0.10% 119 23659 0.10% 120 25101 0.11% 121 25822 0.11% 122 26960 0.12% 123 28290 0.12% 124 29417 0.13% 125 30749 0.14% 126 32565 0.14% 127 32947 0.14% 128 33714 0.15% 129 34801 0.15% 130 35715 0.16% 131 36605 0.16% 132 37897 0.17% 133 39883 0.18% 134 40796 0.18% 135 42500 0.19% 136 43334 0.19% 137 45039 0.20% 138 45719 0.20% 139 47625 0.21% 140 48087 0.21% 141 49514 0.22% 142 51185 0.23% 143 52891 0.23% 144 54578 0.24% 145 55795 0.25% 146 57049 0.25% 147 58081 0.26% 148 59394 0.26% 149 60681 0.27% 150 62330 0.27% 151 21018207 92.43% 22739902 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=35 prefix-density=0.52 prefix-fanout=1.9 sequence=GTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=132.95 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.3 sequence=TTGTCTTGAGATTTTCGCAGTGTCCAACATAAGCATTCGATACATACAAGTAAATGTTCAGAAATAAAACACAAGAAACCTCCCCATCCTCGTCAACACACGATCCCAAGCAATGCACCACTCCTGCACTCCTTTCCTTAGCCAGACCCTCAAATATATCTGGGCGGTGATCTAAACATCCTTGACAACAAGATCACCGTTGACAAACTCTCTGTAGGCAGCAACAGGCCAAGAAAAACCTCTAAAGATCAAACCAGTAGCCAAAGGCACGTCAATAATGATCTCCTTCATTGCTGGCTTCTTCTCGTCACTTATAGCAATCAAGTAACTCCTACCAACCCATCCAATCCATCCAGCAATGTACAAGAACAAAATCCCTGGTGTGATAAACTCACCCCAGTGCCTTTGGTCACCACTCACAATCAAGTGAGGTAGCCCATCTGAGCCACATAGCAACCCTTGCTTCCCATAGTTGTCAAACCTTCTTTTTGTCTTCTCGACAGTAGCTTTG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=28 prefix-density=1.10 prefix-fanout=1.0 sequence=ACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=51.67 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.1 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12161422 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:03:58 Started mapping on | Feb 13 22:03:58 Finished on | Feb 13 22:06:54 Mapping speed, Million of reads per hour | 465.13 Number of input reads | 22739902 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20911464 Uniquely mapped reads % | 91.96% Average mapped length | 297.74 Number of splices: Total | 20873810 Number of splices: Annotated (sjdb) | 20458043 Number of splices: GT/AG | 20465540 Number of splices: GC/AG | 333241 Number of splices: AT/AC | 16627 Number of splices: Non-canonical | 58402 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 559111 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 285740 % of reads mapped to too many loci | 1.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1269327 1269327 1269327 N_multimapping 559111 559111 559111 N_noFeature 656133 20553112 734732 N_ambiguous 434911 1193 154567 UnstrandedReadsAssigned:19820420 PositiveStrandReadsAssigned:357159 NegativeStrandReadsAssigned:20022165 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161422 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161422-trimmed-pair1.fastq SRR12161422-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,739,902 reads, 20,289,666 reads pseudoaligned [quant] estimated average fragment length: 255.132 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR12161422.ke.tsv 34699 SRR12161422.se.tsv 87100 total ==> SRR12161422.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.87 412 7.68875 Potri.005G024800.1.v4.1 1035 780.868 547 23.0587 Potri.004G059700.1.v4.1 961 706.95 147 6.84467 Potri.007G009000.2.v4.1 1416 1161.87 0 0 Potri.003G141000.2.v4.1 2943 2688.87 513 6.28018 Potri.016G087400.1.v4.1 270 76.8823 1131 484.24 Potri.015G069301.1.v4.1 564 319.159 0 0 Potri.010G195200.1.v4.1 1773 1518.87 43 0.931908 Potri.012G127500.1.v4.1 977 722.922 1412 64.2936 ==> SRR12161422.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 257 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 485 Potri.001G212900.v4.1 44 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 27 SRR12161422 completed mapping pipeline successfully