Starting /dee2/code/volunteer_pipeline.sh SRR12161423 current disk space = 3088588759040 free memory = 1432409400 SRR12161423 SRAfilesize 496eede3e1c7bfeb2aaf0d4d33305b9d SRR12161423.sra SRR12161423.sra file validated SRR12161423 is paired end SRR12161423 is conventional basespace SRR12161423 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161423_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.574 37.0 37.0 37.0 37.0 37.0 2 36.311 37.0 37.0 37.0 37.0 37.0 3 36.4335 37.0 37.0 37.0 37.0 37.0 4 36.5185 37.0 37.0 37.0 37.0 37.0 5 36.579 37.0 37.0 37.0 37.0 37.0 6 36.6205 37.0 37.0 37.0 37.0 37.0 7 36.464 37.0 37.0 37.0 37.0 37.0 8 36.406 37.0 37.0 37.0 37.0 37.0 9 36.538 37.0 37.0 37.0 37.0 37.0 10-14 36.5225 37.0 37.0 37.0 37.0 37.0 15-19 36.5186 37.0 37.0 37.0 37.0 37.0 20-24 36.5061 37.0 37.0 37.0 37.0 37.0 25-29 36.4262 37.0 37.0 37.0 37.0 37.0 30-34 36.3978 37.0 37.0 37.0 37.0 37.0 35-39 36.4228 37.0 37.0 37.0 37.0 37.0 40-44 36.390499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.340799999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.328500000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3789 37.0 37.0 37.0 37.0 37.0 60-64 36.2917 37.0 37.0 37.0 37.0 37.0 65-69 36.268 37.0 37.0 37.0 37.0 37.0 70-74 36.292899999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.312200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.282900000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.23779999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2116 37.0 37.0 37.0 37.0 37.0 95-99 36.2042 37.0 37.0 37.0 37.0 37.0 100-104 36.1793 37.0 37.0 37.0 37.0 37.0 105-109 36.1232 37.0 37.0 37.0 37.0 37.0 110-114 36.1196 37.0 37.0 37.0 37.0 37.0 115-119 36.1198 37.0 37.0 37.0 37.0 37.0 120-124 36.0739 37.0 37.0 37.0 37.0 37.0 125-129 36.010000000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.094899999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9382 37.0 37.0 37.0 37.0 37.0 140-144 35.8894 37.0 37.0 37.0 37.0 37.0 145-149 35.87480000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.721000000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 2.0 24 1.0 25 4.0 26 2.0 27 3.0 28 9.0 29 16.0 30 37.0 31 36.0 32 48.0 33 72.0 34 136.0 35 315.0 36 2906.0 37 411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.425 12.125 5.075 32.375 2 20.775 12.174999999999999 33.825 33.225 3 17.4 17.8 29.975 34.825 4 21.725 26.05 24.025 28.199999999999996 5 22.8 32.4 24.4 20.4 6 20.275000000000002 36.3 22.925 20.5 7 15.375 27.3 41.449999999999996 15.875 8 16.85 26.125 31.0 26.025 9 16.3 25.275 34.575 23.849999999999998 10-14 19.105 29.57 27.865000000000002 23.46 15-19 19.67 27.965 27.884999999999998 24.48 20-24 19.509999999999998 28.895 27.775 23.82 25-29 19.509999999999998 28.665000000000003 27.694999999999997 24.13 30-34 20.085 28.494999999999997 27.779999999999998 23.64 35-39 20.365 28.37 27.145000000000003 24.12 40-44 19.5 29.415000000000003 27.165 23.919999999999998 45-49 20.02 28.52 27.155 24.305 50-54 20.305 28.549999999999997 27.834999999999997 23.31 55-59 19.900000000000002 28.585 27.450000000000003 24.065 60-64 19.575 29.03 26.82 24.575 65-69 20.330000000000002 28.735 26.97 23.965 70-74 20.515 28.720000000000002 27.305 23.46 75-79 19.665 28.935 27.775 23.625 80-84 20.16 28.485 27.389999999999997 23.965 85-89 20.355 28.694999999999997 26.83 24.12 90-94 20.48 28.415000000000003 27.32 23.785 95-99 20.015 27.73 28.095 24.16 100-104 20.505000000000003 28.125 27.61 23.76 105-109 20.86 27.67 27.36 24.11 110-114 20.955 27.87 27.525 23.65 115-119 20.53 28.42 27.55 23.5 120-124 20.630000000000003 28.194999999999997 27.694999999999997 23.48 125-129 21.02 28.115000000000002 26.625 24.240000000000002 130-134 20.155 27.97 27.839999999999996 24.035 135-139 20.78 27.994999999999997 27.41 23.815 140-144 20.915 27.88 27.42 23.785 145-149 20.59 27.88 27.455000000000002 24.075 150-151 20.75 28.237499999999997 27.175 23.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.0 22 2.0 23 3.0 24 3.5 25 7.0 26 8.5 27 8.5 28 14.5 29 16.0 30 16.0 31 29.0 32 35.0 33 39.0 34 48.5 35 61.0 36 72.5 37 90.5 38 124.5 39 157.0 40 178.0 41 193.0 42 214.5 43 248.5 44 276.5 45 267.0 46 255.0 47 254.0 48 241.5 49 230.0 50 190.5 51 168.5 52 141.0 53 96.0 54 75.5 55 59.0 56 54.0 57 36.0 58 22.5 59 16.5 60 13.5 61 11.0 62 5.0 63 3.0 64 2.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.06757116254323 88.4 2 5.613194998669859 10.549999999999999 3 0.23942537909018355 0.675 4 0.053205639797818574 0.2 5 0.0 0.0 6 0.0 0.0 7 0.026602819898909287 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.2374999999999998 0.0 0.0 0.0 0.0 134-135 1.4 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACCAT 10 0.006830828 145.0 7 CCCTTGA 10 0.006830828 145.0 3 TTTTTTT 35 0.0035366106 20.714287 115-119 >>END_MODULE SRR12161423 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161423_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2665 37.0 37.0 37.0 37.0 37.0 2 35.872 37.0 37.0 37.0 37.0 37.0 3 35.981 37.0 37.0 37.0 37.0 37.0 4 36.0305 37.0 37.0 37.0 37.0 37.0 5 36.2005 37.0 37.0 37.0 37.0 37.0 6 36.076 37.0 37.0 37.0 37.0 37.0 7 36.099 37.0 37.0 37.0 37.0 37.0 8 36.123 37.0 37.0 37.0 37.0 37.0 9 36.149 37.0 37.0 37.0 37.0 37.0 10-14 36.1387 37.0 37.0 37.0 37.0 37.0 15-19 36.1175 37.0 37.0 37.0 37.0 37.0 20-24 36.088300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.027100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.02470000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.941700000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.9975 37.0 37.0 37.0 37.0 37.0 45-49 35.9735 37.0 37.0 37.0 37.0 37.0 50-54 35.98290000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.9457 37.0 37.0 37.0 37.0 37.0 60-64 35.940000000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.868399999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.7457 37.0 37.0 37.0 37.0 37.0 75-79 35.747400000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.7648 37.0 37.0 37.0 37.0 37.0 85-89 35.7129 37.0 37.0 37.0 37.0 37.0 90-94 35.650999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7119 37.0 37.0 37.0 37.0 37.0 100-104 35.711200000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.674099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.5812 37.0 37.0 37.0 37.0 37.0 115-119 35.6174 37.0 37.0 37.0 37.0 37.0 120-124 35.572700000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4976 37.0 37.0 37.0 37.0 37.0 130-134 35.435 37.0 37.0 37.0 37.0 37.0 135-139 35.3956 37.0 37.0 37.0 37.0 37.0 140-144 35.3945 37.0 37.0 37.0 37.0 37.0 145-149 35.4875 37.0 37.0 37.0 37.0 37.0 150-151 34.93675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 4.0 15 3.0 16 3.0 17 2.0 18 3.0 19 1.0 20 3.0 21 8.0 22 3.0 23 10.0 24 7.0 25 10.0 26 13.0 27 10.0 28 15.0 29 18.0 30 25.0 31 32.0 32 59.0 33 112.0 34 195.0 35 562.0 36 2672.0 37 224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.55 26.674999999999997 7.025 21.75 2 28.925 27.525 27.425 16.125 3 21.525 29.65 30.375000000000004 18.45 4 22.3 37.05 23.025000000000002 17.625 5 25.85 37.4 20.75 16.0 6 22.1 39.75 20.849999999999998 17.299999999999997 7 19.05 23.474999999999998 37.475 20.0 8 21.224999999999998 25.900000000000002 28.349999999999998 24.525 9 21.15 24.525 29.599999999999998 24.725 10-14 23.200000000000003 29.59 26.295 20.915 15-19 23.105 28.349999999999998 27.38 21.165 20-24 22.605 28.825 27.51 21.060000000000002 25-29 23.095 28.525 27.62 20.76 30-34 22.535 28.560000000000002 27.834999999999997 21.07 35-39 22.805 28.185 27.994999999999997 21.015 40-44 23.01 27.805000000000003 27.58 21.605 45-49 22.71 28.28 27.944999999999997 21.065 50-54 22.89 27.615000000000002 27.855 21.64 55-59 22.675 27.88 27.810000000000002 21.634999999999998 60-64 23.7 27.185 28.084999999999997 21.029999999999998 65-69 23.830000000000002 27.83 27.22 21.12 70-74 23.16 28.515 26.775 21.55 75-79 23.225 28.189999999999998 26.939999999999998 21.645 80-84 23.79 27.565 27.625 21.02 85-89 22.919999999999998 28.299999999999997 27.310000000000002 21.47 90-94 23.9 27.61 27.18 21.310000000000002 95-99 23.674999999999997 27.79 27.355 21.18 100-104 23.549999999999997 28.325 26.935 21.19 105-109 23.75 27.735 27.6 20.915 110-114 23.735 28.194999999999997 27.555000000000003 20.515 115-119 23.93 27.894999999999996 27.500000000000004 20.674999999999997 120-124 24.0 27.615000000000002 27.534999999999997 20.849999999999998 125-129 23.915 28.21 27.145000000000003 20.73 130-134 24.325 27.57 27.345000000000002 20.76 135-139 24.060000000000002 27.515 27.395000000000003 21.029999999999998 140-144 24.275 28.18 27.395000000000003 20.150000000000002 145-149 23.794999999999998 27.485 27.515 21.205 150-151 23.9125 27.462500000000002 28.425 20.200000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 1.5 12 2.0 13 1.5 14 2.0 15 1.5 16 1.0 17 0.5 18 0.0 19 1.0 20 1.5 21 1.5 22 2.5 23 2.5 24 2.5 25 3.0 26 4.5 27 6.5 28 8.0 29 8.5 30 9.5 31 18.5 32 29.0 33 34.0 34 48.5 35 68.0 36 76.5 37 94.0 38 133.0 39 172.5 40 180.5 41 191.0 42 235.5 43 259.0 44 267.5 45 287.5 46 290.0 47 266.5 48 233.0 49 191.5 50 162.5 51 147.5 52 124.5 53 89.5 54 65.0 55 61.0 56 51.5 57 36.5 58 26.5 59 25.5 60 22.0 61 14.0 62 6.5 63 2.5 64 2.0 65 1.5 66 1.0 67 0.5 68 2.0 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.5 82 1.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.28571428571428 88.275 2 5.07343124165554 9.5 3 0.4539385847797063 1.275 4 0.08010680907877168 0.3 5 0.0267022696929239 0.125 6 0.0267022696929239 0.15 7 0.0267022696929239 0.17500000000000002 8 0.0267022696929239 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 7 0.17500000000000002 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.2374999999999998 0.0 0.0 0.0 0.0 134-135 1.4 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATGTG 10 0.006830828 145.0 4 TACACTG 10 0.006830828 145.0 9 >>END_MODULE Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571583 spots for SRR12161423.sra Written 571583 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra Read 571565 spots for SRR12161423.sra Written 571565 spots for SRR12161423.sra SRR ids: ['SRR12161423.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lz3_5fd5 SRR12161423.sra spots: 11431318 blocks: [[1, 571565], [571566, 1143130], [1143131, 1714695], [1714696, 2286260], [2286261, 2857825], [2857826, 3429390], [3429391, 4000955], [4000956, 4572520], [4572521, 5144085], [5144086, 5715650], [5715651, 6287215], [6287216, 6858780], [6858781, 7430345], [7430346, 8001910], [8001911, 8573475], [8573476, 9145040], [9145041, 9716605], [9716606, 10288170], [10288171, 10859735], [10859736, 11431318]] SRR12161423 file size 3863161 SRR12161423 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161423 SRR12161423_1.fastq SRR12161423_2.fastq Input file: SRR12161423_1.fastq Paired file: SRR12161423_2.fastq trimmed: SRR12161423-trimmed-pair1.fastq, SRR12161423-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:05:42 2025 >> started Thu Feb 13 22:05:55 2025 >> done (13.528s) 11431318 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 882 ( 0.01%) empty read pairs filtered out after trimming by size control 11430421 (99.99%) read pairs available; of these: 330976 ( 2.90%) trimmed read pairs available after processing 11099445 (97.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 5 0.00% 24 10 0.00% 25 7 0.00% 26 9 0.00% 27 4 0.00% 28 13 0.00% 29 7 0.00% 30 5 0.00% 31 4 0.00% 32 4 0.00% 33 5 0.00% 34 7 0.00% 35 9 0.00% 36 6 0.00% 37 9 0.00% 38 11 0.00% 39 10 0.00% 40 9 0.00% 41 8 0.00% 42 4 0.00% 43 10 0.00% 44 14 0.00% 45 9 0.00% 46 12 0.00% 47 14 0.00% 48 13 0.00% 49 9 0.00% 50 10 0.00% 51 14 0.00% 52 18 0.00% 53 14 0.00% 54 16 0.00% 55 19 0.00% 56 20 0.00% 57 16 0.00% 58 23 0.00% 59 16 0.00% 60 26 0.00% 61 30 0.00% 62 35 0.00% 63 36 0.00% 64 30 0.00% 65 36 0.00% 66 42 0.00% 67 41 0.00% 68 46 0.00% 69 38 0.00% 70 56 0.00% 71 66 0.00% 72 81 0.00% 73 100 0.00% 74 104 0.00% 75 95 0.00% 76 115 0.00% 77 120 0.00% 78 125 0.00% 79 164 0.00% 80 203 0.00% 81 216 0.00% 82 239 0.00% 83 277 0.00% 84 277 0.00% 85 311 0.00% 86 328 0.00% 87 390 0.00% 88 454 0.00% 89 487 0.00% 90 461 0.00% 91 554 0.00% 92 669 0.01% 93 716 0.01% 94 832 0.01% 95 944 0.01% 96 895 0.01% 97 1027 0.01% 98 1047 0.01% 99 1199 0.01% 100 1321 0.01% 101 1342 0.01% 102 1555 0.01% 103 1574 0.01% 104 1736 0.02% 105 1772 0.02% 106 2033 0.02% 107 2032 0.02% 108 2211 0.02% 109 2416 0.02% 110 2442 0.02% 111 2703 0.02% 112 2983 0.03% 113 3106 0.03% 114 3199 0.03% 115 3370 0.03% 116 3683 0.03% 117 3772 0.03% 118 3838 0.03% 119 4036 0.04% 120 4292 0.04% 121 4523 0.04% 122 4783 0.04% 123 5070 0.04% 124 5509 0.05% 125 5487 0.05% 126 5810 0.05% 127 5972 0.05% 128 6154 0.05% 129 6509 0.06% 130 6637 0.06% 131 6817 0.06% 132 7416 0.06% 133 7638 0.07% 134 7956 0.07% 135 8564 0.07% 136 8769 0.08% 137 8983 0.08% 138 9269 0.08% 139 9430 0.08% 140 9498 0.08% 141 10208 0.09% 142 10783 0.09% 143 10939 0.10% 144 11697 0.10% 145 11933 0.10% 146 12580 0.11% 147 12852 0.11% 148 13309 0.12% 149 13366 0.12% 150 13782 0.12% 151 11099445 97.10% 11430421 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.92 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=13.56 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.6 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.42 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=27 prefix-density=1.42 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.12 sequence-density-rank=27 fanout-score=30.31 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=5.5 sequence=AAAAAAGAAAGGCAGAAGCAAGTTCAGCAATGGCAGC SRR12161423 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:06:36 Started mapping on | Feb 13 22:06:36 Finished on | Feb 13 22:07:49 Mapping speed, Million of reads per hour | 563.69 Number of input reads | 11430421 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 10638332 Uniquely mapped reads % | 93.07% Average mapped length | 299.56 Number of splices: Total | 11148981 Number of splices: Annotated (sjdb) | 10924157 Number of splices: GT/AG | 10926014 Number of splices: GC/AG | 184124 Number of splices: AT/AC | 6954 Number of splices: Non-canonical | 31889 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244456 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 53893 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 547633 547633 547633 N_multimapping 244456 244456 244456 N_noFeature 349533 10495246 385802 N_ambiguous 178198 747 70964 UnstrandedReadsAssigned:10110601 PositiveStrandReadsAssigned:142339 NegativeStrandReadsAssigned:10181566 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161423 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161423-trimmed-pair1.fastq SRR12161423-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,430,421 reads, 10,220,825 reads pseudoaligned [quant] estimated average fragment length: 299.838 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR12161423.ke.tsv 34699 SRR12161423.se.tsv 87100 total ==> SRR12161423.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719.16 438 20.3696 Potri.005G024800.1.v4.1 1035 736.162 212 23.0244 Potri.004G059700.1.v4.1 961 662.432 11 1.32763 Potri.007G009000.2.v4.1 1416 1117.16 0 0 Potri.003G141000.2.v4.1 2943 2644.16 607 18.3538 Potri.016G087400.1.v4.1 270 64.1759 423.338 527.399 Potri.015G069301.1.v4.1 564 286.55 0 0 Potri.010G195200.1.v4.1 1773 1474.16 39 2.11517 Potri.012G127500.1.v4.1 977 678.275 132 15.5594 ==> SRR12161423.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 101 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 113 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR12161423 completed mapping pipeline successfully