Starting /dee2/code/volunteer_pipeline.sh SRR12161424 current disk space = 3088551485440 free memory = 1435180996 SRR12161424 SRAfilesize 69ad585677d9844d925fb0e5b4df32b0 SRR12161424.sra SRR12161424.sra file validated SRR12161424 is paired end SRR12161424 is conventional basespace SRR12161424 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161424_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6065 37.0 37.0 37.0 37.0 37.0 2 36.545 37.0 37.0 37.0 37.0 37.0 3 36.54 37.0 37.0 37.0 37.0 37.0 4 36.6395 37.0 37.0 37.0 37.0 37.0 5 36.6 37.0 37.0 37.0 37.0 37.0 6 36.557 37.0 37.0 37.0 37.0 37.0 7 36.525 37.0 37.0 37.0 37.0 37.0 8 36.5945 37.0 37.0 37.0 37.0 37.0 9 36.6095 37.0 37.0 37.0 37.0 37.0 10-14 36.62330000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5648 37.0 37.0 37.0 37.0 37.0 20-24 36.513799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.53189999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.51969999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4679 37.0 37.0 37.0 37.0 37.0 40-44 36.4718 37.0 37.0 37.0 37.0 37.0 45-49 36.4661 37.0 37.0 37.0 37.0 37.0 50-54 36.411 37.0 37.0 37.0 37.0 37.0 55-59 36.449 37.0 37.0 37.0 37.0 37.0 60-64 36.3917 37.0 37.0 37.0 37.0 37.0 65-69 36.373599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3646 37.0 37.0 37.0 37.0 37.0 75-79 36.362100000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3288 37.0 37.0 37.0 37.0 37.0 85-89 36.3593 37.0 37.0 37.0 37.0 37.0 90-94 36.2712 37.0 37.0 37.0 37.0 37.0 95-99 36.2856 37.0 37.0 37.0 37.0 37.0 100-104 36.2285 37.0 37.0 37.0 37.0 37.0 105-109 36.1815 37.0 37.0 37.0 37.0 37.0 110-114 36.161699999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1999 37.0 37.0 37.0 37.0 37.0 120-124 36.13590000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.0642 37.0 37.0 37.0 37.0 37.0 130-134 36.1149 37.0 37.0 37.0 37.0 37.0 135-139 36.013400000000004 37.0 37.0 37.0 37.0 37.0 140-144 36.0056 37.0 37.0 37.0 37.0 37.0 145-149 35.93579999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.90525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 0.0 25 0.0 26 3.0 27 8.0 28 6.0 29 17.0 30 22.0 31 32.0 32 47.0 33 65.0 34 106.0 35 296.0 36 2981.0 37 415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.1 10.5 5.65 38.75 2 20.0 12.375 36.3 31.324999999999996 3 16.275000000000002 16.900000000000002 28.625 38.2 4 22.6 23.799999999999997 23.75 29.849999999999998 5 23.35 32.25 23.525 20.875 6 21.775 34.125 22.275 21.825 7 16.1 26.724999999999998 39.775 17.4 8 17.65 26.875 30.599999999999998 24.875 9 18.15 24.3 33.85 23.7 10-14 19.53 29.330000000000002 27.915 23.225 15-19 20.369999999999997 27.839999999999996 28.18 23.61 20-24 19.935 28.28 27.965 23.82 25-29 20.1 28.365000000000002 28.005000000000003 23.53 30-34 19.814999999999998 27.944999999999997 28.13 24.11 35-39 20.015 28.925 26.97 24.09 40-44 20.265 28.560000000000002 27.625 23.549999999999997 45-49 20.115 27.800000000000004 27.750000000000004 24.335 50-54 20.085 27.794999999999998 28.08 24.04 55-59 20.115 28.43 27.505000000000003 23.95 60-64 20.225 27.950000000000003 27.575 24.25 65-69 20.21 27.38 27.860000000000003 24.55 70-74 20.09 28.470000000000002 28.075 23.365 75-79 20.244999999999997 28.910000000000004 26.945000000000004 23.9 80-84 20.01 28.415000000000003 27.925 23.65 85-89 20.1 28.23 28.095 23.575 90-94 20.575 28.470000000000002 27.36 23.595 95-99 19.805 28.32 28.01 23.865 100-104 20.14 28.360000000000003 27.665 23.835 105-109 20.794999999999998 28.055000000000003 27.450000000000003 23.7 110-114 20.65 28.005000000000003 27.76 23.585 115-119 20.27 28.194999999999997 27.99 23.544999999999998 120-124 20.78 27.865000000000002 27.450000000000003 23.905 125-129 20.785 27.88 27.465 23.87 130-134 20.669999999999998 28.549999999999997 27.255000000000003 23.525 135-139 20.974999999999998 27.925 27.42 23.68 140-144 20.75 27.900000000000002 27.700000000000003 23.65 145-149 20.985 28.23 27.279999999999998 23.505000000000003 150-151 20.4875 28.9875 26.137500000000003 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 2.0 25 3.5 26 4.5 27 9.0 28 9.0 29 10.5 30 20.0 31 29.0 32 37.5 33 40.5 34 38.0 35 53.5 36 81.0 37 97.0 38 128.0 39 166.0 40 179.5 41 189.0 42 235.0 43 274.0 44 260.5 45 254.0 46 256.0 47 255.0 48 250.5 49 223.0 50 196.5 51 158.5 52 124.0 53 98.5 54 77.0 55 65.0 56 45.0 57 33.5 58 25.0 59 23.0 60 20.0 61 10.5 62 5.5 63 2.5 64 2.0 65 2.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 94.60887949260042 89.5 2 5.07399577167019 9.6 3 0.3171247357293869 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.6000000000000001 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.3 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.9874999999999998 0.0 0.0 0.0 0.0 136-137 2.125 0.0 0.0 0.0 0.0 138-139 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCATA 10 0.006830828 145.0 6 CACAATA 10 0.006830828 145.0 4 CCCATTG 10 0.006830828 145.0 2 CACTTGC 10 0.006830828 145.0 8 ACAATAC 10 0.006830828 145.0 5 >>END_MODULE SRR12161424 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161424_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.445 37.0 37.0 37.0 37.0 37.0 2 36.063 37.0 37.0 37.0 37.0 37.0 3 36.2335 37.0 37.0 37.0 37.0 37.0 4 36.1875 37.0 37.0 37.0 37.0 37.0 5 36.482 37.0 37.0 37.0 37.0 37.0 6 36.2995 37.0 37.0 37.0 37.0 37.0 7 36.3125 37.0 37.0 37.0 37.0 37.0 8 36.338 37.0 37.0 37.0 37.0 37.0 9 36.341 37.0 37.0 37.0 37.0 37.0 10-14 36.3525 37.0 37.0 37.0 37.0 37.0 15-19 36.3683 37.0 37.0 37.0 37.0 37.0 20-24 36.2881 37.0 37.0 37.0 37.0 37.0 25-29 36.2213 37.0 37.0 37.0 37.0 37.0 30-34 36.220800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.221 37.0 37.0 37.0 37.0 37.0 40-44 36.274800000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.1964 37.0 37.0 37.0 37.0 37.0 50-54 36.18470000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.1734 37.0 37.0 37.0 37.0 37.0 60-64 36.1216 37.0 37.0 37.0 37.0 37.0 65-69 36.085899999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.050599999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.004000000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.0925 37.0 37.0 37.0 37.0 37.0 85-89 36.0573 37.0 37.0 37.0 37.0 37.0 90-94 36.047000000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.004000000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.960699999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.9486 37.0 37.0 37.0 37.0 37.0 110-114 35.8986 37.0 37.0 37.0 37.0 37.0 115-119 35.9252 37.0 37.0 37.0 37.0 37.0 120-124 35.8964 37.0 37.0 37.0 37.0 37.0 125-129 35.7571 37.0 37.0 37.0 37.0 37.0 130-134 35.74830000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.839800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7709 37.0 37.0 37.0 37.0 37.0 145-149 35.7685 37.0 37.0 37.0 37.0 37.0 150-151 35.18925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 4.0 15 3.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 2.0 24 3.0 25 2.0 26 8.0 27 6.0 28 12.0 29 15.0 30 17.0 31 35.0 32 52.0 33 83.0 34 164.0 35 481.0 36 2809.0 37 296.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.175 25.224999999999998 8.75 24.85 2 27.55 26.875 29.375 16.2 3 20.549999999999997 27.150000000000002 32.7 19.6 4 22.725 36.225 22.6 18.45 5 25.2 37.325 21.05 16.425 6 19.875 40.075 21.85 18.2 7 21.65 23.1 37.125 18.125 8 20.75 26.950000000000003 27.85 24.45 9 21.825 25.7 28.825 23.65 10-14 23.21 29.07 26.545 21.175 15-19 22.615 28.225 28.055000000000003 21.105 20-24 22.93 28.28 27.715 21.075 25-29 23.43 28.294999999999998 27.46 20.815 30-34 22.759999999999998 28.34 27.644999999999996 21.255 35-39 22.93 27.725 27.779999999999998 21.565 40-44 23.125 27.655 28.465 20.755000000000003 45-49 22.625 27.794999999999998 28.244999999999997 21.335 50-54 23.13 27.994999999999997 28.155 20.72 55-59 23.23 28.155 27.229999999999997 21.385 60-64 23.275000000000002 27.675 27.96 21.09 65-69 23.080000000000002 27.51 28.465 20.945 70-74 23.544999999999998 28.025 27.255000000000003 21.175 75-79 23.605 28.395 27.185 20.815 80-84 23.575 27.88 27.875 20.669999999999998 85-89 23.35 28.18 27.57 20.9 90-94 22.745 28.12 27.575 21.560000000000002 95-99 23.41 28.444999999999997 27.689999999999998 20.455000000000002 100-104 23.405 27.855 27.794999999999998 20.945 105-109 22.805 27.855 28.249999999999996 21.09 110-114 23.189999999999998 28.24 27.905 20.665 115-119 24.03 27.42 27.765 20.785 120-124 23.775 27.105 28.165000000000003 20.955 125-129 23.93 28.505000000000003 27.055 20.51 130-134 23.580000000000002 27.595 27.88 20.945 135-139 24.445 27.015 27.794999999999998 20.745 140-144 23.715 28.044999999999998 27.705000000000002 20.535 145-149 24.075 28.29 27.195000000000004 20.44 150-151 24.3125 28.425 27.1375 20.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 2.5 23 3.0 24 3.0 25 4.0 26 5.0 27 5.5 28 5.0 29 6.5 30 14.0 31 25.0 32 31.0 33 36.5 34 50.5 35 61.5 36 79.0 37 110.0 38 142.0 39 166.0 40 184.5 41 223.5 42 246.5 43 243.5 44 258.0 45 264.5 46 272.0 47 291.5 48 249.5 49 196.5 50 167.0 51 140.0 52 121.0 53 91.0 54 66.0 55 56.5 56 43.5 57 29.5 58 23.5 59 16.0 60 15.0 61 11.0 62 5.5 63 5.5 64 5.0 65 2.5 66 1.0 67 1.5 68 2.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.44887118193891 88.9 2 4.940239043824701 9.3 3 0.5312084993359893 1.5 4 0.0796812749003984 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.6000000000000001 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.7625000000000002 0.0 0.0 0.0 0.0 134-135 1.9625 0.0 0.0 0.0 0.0 136-137 2.0875 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTGG 10 0.006830828 145.0 4 >>END_MODULE Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452630 spots for SRR12161424.sra Written 452630 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra Read 452616 spots for SRR12161424.sra Written 452616 spots for SRR12161424.sra SRR ids: ['SRR12161424.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_khob8ft7 SRR12161424.sra spots: 9052334 blocks: [[1, 452616], [452617, 905232], [905233, 1357848], [1357849, 1810464], [1810465, 2263080], [2263081, 2715696], [2715697, 3168312], [3168313, 3620928], [3620929, 4073544], [4073545, 4526160], [4526161, 4978776], [4978777, 5431392], [5431393, 5884008], [5884009, 6336624], [6336625, 6789240], [6789241, 7241856], [7241857, 7694472], [7694473, 8147088], [8147089, 8599704], [8599705, 9052334]] SRR12161424 file size 3056529 SRR12161424 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161424 SRR12161424_1.fastq SRR12161424_2.fastq Input file: SRR12161424_1.fastq Paired file: SRR12161424_2.fastq trimmed: SRR12161424-trimmed-pair1.fastq, SRR12161424-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:53:37 2025 >> started Thu Feb 13 21:53:48 2025 >> done (10.873s) 9052334 read pairs processed; of these: 8 ( 0.00%) short read pairs filtered out after trimming by size control 600 ( 0.01%) empty read pairs filtered out after trimming by size control 9051726 (99.99%) read pairs available; of these: 445464 ( 4.92%) trimmed read pairs available after processing 8606262 (95.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 6 0.00% 27 6 0.00% 28 6 0.00% 29 2 0.00% 30 12 0.00% 31 7 0.00% 32 5 0.00% 33 3 0.00% 34 7 0.00% 35 6 0.00% 36 6 0.00% 37 2 0.00% 38 5 0.00% 39 7 0.00% 40 5 0.00% 41 5 0.00% 42 7 0.00% 43 12 0.00% 44 13 0.00% 45 14 0.00% 46 9 0.00% 47 5 0.00% 48 11 0.00% 49 12 0.00% 50 10 0.00% 51 20 0.00% 52 10 0.00% 53 15 0.00% 54 18 0.00% 55 13 0.00% 56 17 0.00% 57 25 0.00% 58 27 0.00% 59 30 0.00% 60 24 0.00% 61 26 0.00% 62 30 0.00% 63 32 0.00% 64 46 0.00% 65 42 0.00% 66 47 0.00% 67 60 0.00% 68 51 0.00% 69 71 0.00% 70 85 0.00% 71 74 0.00% 72 90 0.00% 73 116 0.00% 74 116 0.00% 75 117 0.00% 76 146 0.00% 77 156 0.00% 78 165 0.00% 79 184 0.00% 80 223 0.00% 81 265 0.00% 82 315 0.00% 83 319 0.00% 84 349 0.00% 85 374 0.00% 86 429 0.00% 87 514 0.01% 88 555 0.01% 89 676 0.01% 90 688 0.01% 91 762 0.01% 92 861 0.01% 93 1016 0.01% 94 1063 0.01% 95 1191 0.01% 96 1234 0.01% 97 1389 0.02% 98 1536 0.02% 99 1641 0.02% 100 1788 0.02% 101 1834 0.02% 102 2038 0.02% 103 2388 0.03% 104 2393 0.03% 105 2575 0.03% 106 2714 0.03% 107 2896 0.03% 108 3058 0.03% 109 3342 0.04% 110 3658 0.04% 111 3816 0.04% 112 3975 0.04% 113 4234 0.05% 114 4537 0.05% 115 4874 0.05% 116 5131 0.06% 117 5282 0.06% 118 5666 0.06% 119 5736 0.06% 120 6067 0.07% 121 6429 0.07% 122 6552 0.07% 123 7019 0.08% 124 7431 0.08% 125 7668 0.08% 126 7963 0.09% 127 8529 0.09% 128 8855 0.10% 129 8859 0.10% 130 9522 0.11% 131 9447 0.10% 132 9966 0.11% 133 10405 0.11% 134 10844 0.12% 135 11363 0.13% 136 11527 0.13% 137 12051 0.13% 138 12104 0.13% 139 13092 0.14% 140 13294 0.15% 141 13493 0.15% 142 14344 0.16% 143 14691 0.16% 144 15020 0.17% 145 15551 0.17% 146 16015 0.18% 147 16150 0.18% 148 16926 0.19% 149 17256 0.19% 150 17648 0.19% 151 8606262 95.08% 9051726 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.73 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=13.59 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.7 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=19 prefix-density=0.85 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=59.51 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.0 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12161424 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:54:36 Started mapping on | Feb 13 21:54:36 Finished on | Feb 13 21:55:50 Mapping speed, Million of reads per hour | 440.35 Number of input reads | 9051726 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 8517130 Uniquely mapped reads % | 94.09% Average mapped length | 298.91 Number of splices: Total | 9004078 Number of splices: Annotated (sjdb) | 8817569 Number of splices: GT/AG | 8824342 Number of splices: GC/AG | 147470 Number of splices: AT/AC | 5589 Number of splices: Non-canonical | 26677 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 221665 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 69794 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 312931 312931 312931 N_multimapping 221665 221665 221665 N_noFeature 301329 8407386 331093 N_ambiguous 137819 524 57658 UnstrandedReadsAssigned:8077982 PositiveStrandReadsAssigned:109220 NegativeStrandReadsAssigned:8128379 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161424 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161424-trimmed-pair1.fastq SRR12161424-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,051,726 reads, 8,150,827 reads pseudoaligned [quant] estimated average fragment length: 277.496 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 983 rounds 52401 SRR12161424.ke.tsv 34699 SRR12161424.se.tsv 87100 total ==> SRR12161424.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.5 434 26.4767 Potri.005G024800.1.v4.1 1035 758.504 212 29.6945 Potri.004G059700.1.v4.1 961 684.647 23 3.56911 Potri.007G009000.2.v4.1 1416 1139.5 0 0 Potri.003G141000.2.v4.1 2943 2666.5 325.81 12.9814 Potri.016G087400.1.v4.1 270 70.5354 406 611.529 Potri.015G069301.1.v4.1 564 301.839 0 0 Potri.010G195200.1.v4.1 1773 1496.5 19 1.34888 Potri.012G127500.1.v4.1 977 700.551 95 14.4073 ==> SRR12161424.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 91 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR12161424 completed mapping pipeline successfully