Starting /dee2/code/volunteer_pipeline.sh SRR12161425 current disk space = 3088612487168 free memory = 1459682432 SRR12161425 SRAfilesize ecb8d4ea4732744b89a6407fc5c4b2ae SRR12161425.sra SRR12161425.sra file validated SRR12161425 is paired end SRR12161425 is conventional basespace SRR12161425 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161425_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4465 37.0 37.0 37.0 37.0 37.0 2 36.3975 37.0 37.0 37.0 37.0 37.0 3 36.4385 37.0 37.0 37.0 37.0 37.0 4 36.559 37.0 37.0 37.0 37.0 37.0 5 36.568 37.0 37.0 37.0 37.0 37.0 6 36.534 37.0 37.0 37.0 37.0 37.0 7 36.5085 37.0 37.0 37.0 37.0 37.0 8 36.5105 37.0 37.0 37.0 37.0 37.0 9 36.5295 37.0 37.0 37.0 37.0 37.0 10-14 36.576100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.507 37.0 37.0 37.0 37.0 37.0 20-24 36.503600000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.4636 37.0 37.0 37.0 37.0 37.0 30-34 36.4251 37.0 37.0 37.0 37.0 37.0 35-39 36.4165 37.0 37.0 37.0 37.0 37.0 40-44 36.3848 37.0 37.0 37.0 37.0 37.0 45-49 36.3685 37.0 37.0 37.0 37.0 37.0 50-54 36.3032 37.0 37.0 37.0 37.0 37.0 55-59 36.307900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.288 37.0 37.0 37.0 37.0 37.0 65-69 36.2909 37.0 37.0 37.0 37.0 37.0 70-74 36.282300000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.20799999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.231300000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2196 37.0 37.0 37.0 37.0 37.0 90-94 36.160399999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.125 37.0 37.0 37.0 37.0 37.0 100-104 36.140100000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0966 37.0 37.0 37.0 37.0 37.0 110-114 36.0795 37.0 37.0 37.0 37.0 37.0 115-119 36.1183 37.0 37.0 37.0 37.0 37.0 120-124 36.0386 37.0 37.0 37.0 37.0 37.0 125-129 35.937799999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.0511 37.0 37.0 37.0 37.0 37.0 135-139 35.9337 37.0 37.0 37.0 37.0 37.0 140-144 35.829899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.8158 37.0 37.0 37.0 37.0 37.0 150-151 35.704499999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 6.0 25 4.0 26 7.0 27 4.0 28 14.0 29 22.0 30 19.0 31 28.0 32 47.0 33 90.0 34 126.0 35 331.0 36 2880.0 37 421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.925000000000004 11.65 7.2749999999999995 38.15 2 18.8 13.775 33.775 33.650000000000006 3 16.85 15.825 27.975 39.35 4 20.175 24.525 25.174999999999997 30.125 5 22.175 30.925000000000004 24.05 22.85 6 19.75 35.449999999999996 22.525000000000002 22.275 7 16.475 26.400000000000002 40.875 16.25 8 16.900000000000002 26.575 31.924999999999997 24.6 9 16.525000000000002 24.8 35.3 23.375 10-14 19.205 29.925 27.43 23.44 15-19 19.895 27.965 28.26 23.880000000000003 20-24 19.66 28.935 27.49 23.915 25-29 19.875 27.855 28.105000000000004 24.165 30-34 19.16 28.285 28.389999999999997 24.165 35-39 19.545 28.18 27.425 24.85 40-44 20.165 28.810000000000002 27.455000000000002 23.57 45-49 19.445 28.749999999999996 27.689999999999998 24.115000000000002 50-54 19.655 28.37 27.54 24.435000000000002 55-59 19.34 28.505000000000003 28.48 23.674999999999997 60-64 19.91 28.205000000000002 27.96 23.925 65-69 20.355 27.845 27.639999999999997 24.16 70-74 19.74 28.46 27.889999999999997 23.91 75-79 19.98 28.48 27.6 23.94 80-84 20.5 28.499999999999996 27.105 23.895 85-89 20.125 28.27 27.765 23.84 90-94 19.845 28.37 27.650000000000002 24.135 95-99 19.375 29.21 27.534999999999997 23.880000000000003 100-104 20.025000000000002 27.889999999999997 27.675 24.41 105-109 20.46 28.044999999999998 27.755000000000003 23.74 110-114 20.605 28.12 27.375 23.9 115-119 20.395 28.395 27.185 24.025 120-124 20.810000000000002 28.060000000000002 27.455000000000002 23.674999999999997 125-129 20.205000000000002 28.07 28.17 23.555 130-134 20.84 28.15 27.235 23.775 135-139 20.905 28.175 27.405 23.515 140-144 21.575 27.744999999999997 27.41 23.27 145-149 20.51 29.015 26.825 23.65 150-151 21.762500000000003 28.0875 27.325 22.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 2.0 22 0.5 23 0.5 24 4.0 25 4.5 26 5.0 27 7.5 28 11.5 29 17.0 30 17.5 31 24.0 32 32.0 33 39.0 34 55.5 35 68.0 36 75.0 37 97.0 38 132.5 39 161.0 40 180.5 41 196.0 42 233.0 43 264.0 44 264.0 45 274.0 46 276.5 47 260.5 48 236.0 49 199.0 50 173.5 51 155.5 52 122.0 53 90.0 54 78.0 55 65.5 56 47.5 57 35.5 58 22.0 59 13.5 60 13.0 61 12.0 62 6.5 63 4.0 64 3.5 65 1.5 66 0.5 67 1.5 68 2.0 69 0.5 70 0.0 71 0.5 72 1.0 73 2.0 74 2.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.3441317047265 88.825 2 5.124800849707913 9.65 3 0.5045140732873075 1.425 4 0.02655337227827934 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0750000000000002 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 2.7750000000000004 0.0 0.0 0.0 0.0 130-131 3.025 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.7375 0.0 0.0 0.0 0.0 136-137 4.0625 0.0 0.0 0.0 0.0 138-139 4.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161425 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161425_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1895 37.0 37.0 37.0 37.0 37.0 2 35.958 37.0 37.0 37.0 37.0 37.0 3 35.983 37.0 37.0 37.0 37.0 37.0 4 35.988 37.0 37.0 37.0 37.0 37.0 5 36.273 37.0 37.0 37.0 37.0 37.0 6 36.0915 37.0 37.0 37.0 37.0 37.0 7 36.042 37.0 37.0 37.0 37.0 37.0 8 36.1795 37.0 37.0 37.0 37.0 37.0 9 36.1695 37.0 37.0 37.0 37.0 37.0 10-14 36.1211 37.0 37.0 37.0 37.0 37.0 15-19 36.144999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.057900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.056599999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.9778 37.0 37.0 37.0 37.0 37.0 35-39 35.99399999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.0177 37.0 37.0 37.0 37.0 37.0 45-49 35.902699999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.998000000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.9324 37.0 37.0 37.0 37.0 37.0 60-64 35.9268 37.0 37.0 37.0 37.0 37.0 65-69 35.8922 37.0 37.0 37.0 37.0 37.0 70-74 35.8036 37.0 37.0 37.0 37.0 37.0 75-79 35.743500000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.7758 37.0 37.0 37.0 37.0 37.0 85-89 35.745400000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.6781 37.0 37.0 37.0 37.0 37.0 95-99 35.7426 37.0 37.0 37.0 37.0 37.0 100-104 35.729 37.0 37.0 37.0 37.0 37.0 105-109 35.6696 37.0 37.0 37.0 37.0 37.0 110-114 35.644 37.0 37.0 37.0 37.0 37.0 115-119 35.6408 37.0 37.0 37.0 37.0 37.0 120-124 35.6108 37.0 37.0 37.0 37.0 37.0 125-129 35.5013 37.0 37.0 37.0 37.0 37.0 130-134 35.3638 37.0 37.0 37.0 34.6 37.0 135-139 35.4415 37.0 37.0 37.0 37.0 37.0 140-144 35.386399999999995 37.0 37.0 37.0 34.6 37.0 145-149 35.3522 37.0 37.0 37.0 34.6 37.0 150-151 34.841499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 5.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 3.0 21 3.0 22 7.0 23 1.0 24 7.0 25 5.0 26 8.0 27 9.0 28 14.0 29 22.0 30 44.0 31 55.0 32 64.0 33 135.0 34 227.0 35 586.0 36 2555.0 37 245.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.725 24.675 10.424999999999999 24.175 2 27.525 27.900000000000002 28.799999999999997 15.775 3 20.625 27.750000000000004 32.05 19.575 4 23.599999999999998 33.125 24.7 18.575 5 25.85 35.6 21.925 16.625 6 19.525000000000002 39.5 22.175 18.8 7 20.125 22.2 38.2 19.475 8 21.375 26.05 27.825 24.75 9 21.7 24.875 30.049999999999997 23.375 10-14 23.14 29.515 26.365 20.979999999999997 15-19 22.86 28.67 26.955000000000002 21.515 20-24 22.795 28.384999999999998 27.68 21.14 25-29 23.01 28.48 27.41 21.099999999999998 30-34 22.7 28.139999999999997 28.17 20.990000000000002 35-39 23.09 28.000000000000004 28.115000000000002 20.794999999999998 40-44 22.88 27.82 28.53 20.77 45-49 22.875 28.43 27.865000000000002 20.830000000000002 50-54 23.11 27.889999999999997 28.275 20.724999999999998 55-59 22.919999999999998 28.535 27.3 21.245 60-64 23.47 27.71 27.395000000000003 21.425 65-69 22.81 28.025 27.98 21.185000000000002 70-74 23.24 27.935 27.72 21.105 75-79 22.884999999999998 28.705000000000002 27.339999999999996 21.07 80-84 23.115 27.889999999999997 27.67 21.325 85-89 23.195 28.255000000000003 27.229999999999997 21.32 90-94 23.064999999999998 27.625 27.82 21.490000000000002 95-99 23.455000000000002 27.994999999999997 27.725 20.825 100-104 23.080000000000002 28.02 27.765 21.135 105-109 23.369999999999997 27.994999999999997 27.389999999999997 21.245 110-114 24.29 28.315 27.095000000000002 20.3 115-119 24.07 28.71 26.61 20.61 120-124 24.610000000000003 27.77 27.485 20.135 125-129 23.915 28.849999999999998 26.47 20.765 130-134 24.310000000000002 27.439999999999998 27.655 20.595 135-139 24.5 27.62 27.68 20.200000000000003 140-144 24.975 27.560000000000002 27.435 20.03 145-149 25.705 27.534999999999997 26.96 19.8 150-151 25.474999999999998 28.3875 26.637499999999996 19.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.0 8 1.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 3.5 22 3.0 23 2.5 24 3.0 25 3.0 26 5.5 27 8.0 28 10.5 29 12.5 30 16.0 31 21.5 32 29.0 33 40.5 34 50.0 35 64.0 36 92.0 37 107.0 38 121.0 39 158.0 40 186.5 41 218.0 42 260.5 43 275.0 44 280.5 45 289.0 46 271.5 47 234.5 48 206.5 49 186.5 50 163.0 51 137.5 52 110.5 53 85.5 54 69.5 55 55.5 56 47.0 57 39.5 58 30.5 59 26.5 60 17.0 61 9.5 62 7.0 63 5.5 64 4.5 65 3.0 66 0.5 67 2.0 68 3.0 69 2.5 70 2.0 71 0.5 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.60470085470085 88.55 2 4.647435897435898 8.7 3 0.5341880341880342 1.5 4 0.05341880341880342 0.2 5 0.05341880341880342 0.25 6 0.02670940170940171 0.15 7 0.0 0.0 8 0.05341880341880342 0.4 9 0.0 0.0 >10 0.02670940170940171 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 10 0.25 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 8 0.2 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.9625000000000001 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.375 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 3.0375 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.7625 0.0 0.0 0.0 0.0 136-137 4.0875 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTTA 10 0.006830828 145.0 4 TTTTTTT 65 0.0076375785 13.384615 55-59 >>END_MODULE Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744253 spots for SRR12161425.sra Written 744253 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra Read 744246 spots for SRR12161425.sra Written 744246 spots for SRR12161425.sra SRR ids: ['SRR12161425.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0_cayyb2 SRR12161425.sra spots: 14884927 blocks: [[1, 744246], [744247, 1488492], [1488493, 2232738], [2232739, 2976984], [2976985, 3721230], [3721231, 4465476], [4465477, 5209722], [5209723, 5953968], [5953969, 6698214], [6698215, 7442460], [7442461, 8186706], [8186707, 8930952], [8930953, 9675198], [9675199, 10419444], [10419445, 11163690], [11163691, 11907936], [11907937, 12652182], [12652183, 13396428], [13396429, 14140674], [14140675, 14884927]] SRR12161425 file size 5036849 SRR12161425 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161425 SRR12161425_1.fastq SRR12161425_2.fastq Input file: SRR12161425_1.fastq Paired file: SRR12161425_2.fastq trimmed: SRR12161425-trimmed-pair1.fastq, SRR12161425-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:16:23 2025 >> started Thu Feb 13 22:16:41 2025 >> done (18.354s) 14884927 read pairs processed; of these: 41 ( 0.00%) short read pairs filtered out after trimming by size control 4209 ( 0.03%) empty read pairs filtered out after trimming by size control 14880677 (99.97%) read pairs available; of these: 1114574 ( 7.49%) trimmed read pairs available after processing 13766103 (92.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 4 0.00% 21 5 0.00% 22 11 0.00% 23 13 0.00% 24 17 0.00% 25 20 0.00% 26 19 0.00% 27 23 0.00% 28 25 0.00% 29 21 0.00% 30 15 0.00% 31 27 0.00% 32 26 0.00% 33 19 0.00% 34 35 0.00% 35 33 0.00% 36 27 0.00% 37 32 0.00% 38 27 0.00% 39 26 0.00% 40 31 0.00% 41 38 0.00% 42 36 0.00% 43 44 0.00% 44 31 0.00% 45 34 0.00% 46 37 0.00% 47 33 0.00% 48 40 0.00% 49 45 0.00% 50 56 0.00% 51 61 0.00% 52 72 0.00% 53 73 0.00% 54 78 0.00% 55 70 0.00% 56 79 0.00% 57 93 0.00% 58 105 0.00% 59 103 0.00% 60 140 0.00% 61 151 0.00% 62 148 0.00% 63 205 0.00% 64 203 0.00% 65 224 0.00% 66 226 0.00% 67 279 0.00% 68 298 0.00% 69 332 0.00% 70 372 0.00% 71 464 0.00% 72 527 0.00% 73 546 0.00% 74 588 0.00% 75 671 0.00% 76 738 0.00% 77 843 0.01% 78 1003 0.01% 79 1104 0.01% 80 1265 0.01% 81 1390 0.01% 82 1543 0.01% 83 1716 0.01% 84 1980 0.01% 85 2079 0.01% 86 2342 0.02% 87 2540 0.02% 88 2863 0.02% 89 2975 0.02% 90 3395 0.02% 91 3661 0.02% 92 4075 0.03% 93 4490 0.03% 94 4738 0.03% 95 5263 0.04% 96 5552 0.04% 97 5896 0.04% 98 6182 0.04% 99 6733 0.05% 100 7274 0.05% 101 7624 0.05% 102 8127 0.05% 103 8755 0.06% 104 9249 0.06% 105 9843 0.07% 106 9986 0.07% 107 10610 0.07% 108 10767 0.07% 109 11245 0.08% 110 11723 0.08% 111 12331 0.08% 112 12963 0.09% 113 13595 0.09% 114 14166 0.10% 115 14643 0.10% 116 15278 0.10% 117 15816 0.11% 118 16336 0.11% 119 16540 0.11% 120 17221 0.12% 121 17611 0.12% 122 18364 0.12% 123 18917 0.13% 124 19809 0.13% 125 20039 0.13% 126 20896 0.14% 127 21023 0.14% 128 21722 0.15% 129 22196 0.15% 130 22634 0.15% 131 23001 0.15% 132 23649 0.16% 133 24272 0.16% 134 24858 0.17% 135 25996 0.17% 136 26460 0.18% 137 26651 0.18% 138 27004 0.18% 139 27659 0.19% 140 28042 0.19% 141 28767 0.19% 142 29306 0.20% 143 30480 0.20% 144 31071 0.21% 145 31695 0.21% 146 32268 0.22% 147 32704 0.22% 148 33788 0.23% 149 33685 0.23% 150 34579 0.23% 151 13766103 92.51% 14880677 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=26 prefix-density=0.91 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=13.32 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=2.7 sequence=TGCTTGCTTCTTC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=19 prefix-density=0.58 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=44.68 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.8 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12161425 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:17:30 Started mapping on | Feb 13 22:17:31 Finished on | Feb 13 22:19:50 Mapping speed, Million of reads per hour | 385.40 Number of input reads | 14880677 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13869066 Uniquely mapped reads % | 93.20% Average mapped length | 297.07 Number of splices: Total | 14440645 Number of splices: Annotated (sjdb) | 14063158 Number of splices: GT/AG | 14160878 Number of splices: GC/AG | 213872 Number of splices: AT/AC | 11344 Number of splices: Non-canonical | 54551 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364459 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 109164 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 647152 647152 647152 N_multimapping 364459 364459 364459 N_noFeature 504923 13606094 566092 N_ambiguous 312839 1147 110301 UnstrandedReadsAssigned:13051304 PositiveStrandReadsAssigned:261825 NegativeStrandReadsAssigned:13192673 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161425 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161425-trimmed-pair1.fastq SRR12161425-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,880,677 reads, 13,143,216 reads pseudoaligned [quant] estimated average fragment length: 279.953 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR12161425.ke.tsv 34699 SRR12161425.se.tsv 87100 total ==> SRR12161425.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.05 456 15.4285 Potri.005G024800.1.v4.1 1035 756.047 292 22.7251 Potri.004G059700.1.v4.1 961 682.287 26 2.24221 Potri.007G009000.2.v4.1 1416 1137.05 0 0 Potri.003G141000.2.v4.1 2943 2664.05 750.526 16.5766 Potri.016G087400.1.v4.1 270 78.6904 726.258 543.05 Potri.015G069301.1.v4.1 564 304.761 0 0 Potri.010G195200.1.v4.1 1773 1494.05 45 1.77223 Potri.012G127500.1.v4.1 977 698.147 151 12.7263 ==> SRR12161425.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 124 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12161425 completed mapping pipeline successfully