Starting /dee2/code/volunteer_pipeline.sh SRR12161426 current disk space = 3088764424192 free memory = 1422403900 SRR12161426 SRAfilesize 886e37a2ebe968a8ad37c266f5d616d7 SRR12161426.sra SRR12161426.sra file validated SRR12161426 is paired end SRR12161426 is conventional basespace SRR12161426 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161426_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5465 37.0 37.0 37.0 37.0 37.0 2 36.477 37.0 37.0 37.0 37.0 37.0 3 36.5395 37.0 37.0 37.0 37.0 37.0 4 36.566 37.0 37.0 37.0 37.0 37.0 5 36.616 37.0 37.0 37.0 37.0 37.0 6 36.649 37.0 37.0 37.0 37.0 37.0 7 36.503 37.0 37.0 37.0 37.0 37.0 8 36.565 37.0 37.0 37.0 37.0 37.0 9 36.5855 37.0 37.0 37.0 37.0 37.0 10-14 36.5866 37.0 37.0 37.0 37.0 37.0 15-19 36.5108 37.0 37.0 37.0 37.0 37.0 20-24 36.466300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4759 37.0 37.0 37.0 37.0 37.0 30-34 36.408699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.460899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3936 37.0 37.0 37.0 37.0 37.0 45-49 36.3884 37.0 37.0 37.0 37.0 37.0 50-54 36.3358 37.0 37.0 37.0 37.0 37.0 55-59 36.3348 37.0 37.0 37.0 37.0 37.0 60-64 36.332100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2868 37.0 37.0 37.0 37.0 37.0 70-74 36.2958 37.0 37.0 37.0 37.0 37.0 75-79 36.282399999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.28490000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2199 37.0 37.0 37.0 37.0 37.0 90-94 36.246700000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.155899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.21509999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1498 37.0 37.0 37.0 37.0 37.0 110-114 36.1528 37.0 37.0 37.0 37.0 37.0 115-119 36.0949 37.0 37.0 37.0 37.0 37.0 120-124 36.0957 37.0 37.0 37.0 37.0 37.0 125-129 36.0901 37.0 37.0 37.0 37.0 37.0 130-134 36.0327 37.0 37.0 37.0 37.0 37.0 135-139 35.992000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.9045 37.0 37.0 37.0 37.0 37.0 145-149 35.9176 37.0 37.0 37.0 37.0 37.0 150-151 35.823750000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 2.0 24 3.0 25 3.0 26 4.0 27 9.0 28 11.0 29 17.0 30 29.0 31 21.0 32 48.0 33 85.0 34 129.0 35 282.0 36 2917.0 37 437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.525 12.45 6.225 38.800000000000004 2 20.474999999999998 12.475 34.050000000000004 33.0 3 18.05 15.675 27.525 38.75 4 21.05 24.3 24.474999999999998 30.175 5 22.575 30.7 24.025 22.7 6 21.525 35.075 22.125 21.275 7 15.2 26.674999999999997 40.275 17.849999999999998 8 17.8 27.150000000000002 29.75 25.3 9 16.725 23.400000000000002 35.55 24.325 10-14 19.46 29.56 27.62 23.36 15-19 19.855 27.775 28.315 24.055 20-24 20.325 27.91 27.650000000000002 24.115000000000002 25-29 19.945 28.9 27.515 23.64 30-34 19.16 28.915000000000003 27.155 24.77 35-39 19.765 28.27 27.38 24.585 40-44 20.375 28.945 26.6 24.08 45-49 20.45 28.475 27.125 23.95 50-54 20.54 28.315 27.345000000000002 23.799999999999997 55-59 19.955000000000002 28.82 27.33 23.895 60-64 20.28 28.185 27.165 24.37 65-69 19.830000000000002 28.32 28.055000000000003 23.794999999999998 70-74 20.62 27.894999999999996 27.33 24.154999999999998 75-79 20.810000000000002 27.755000000000003 27.435 24.0 80-84 20.495 28.405 27.485 23.615 85-89 20.635 28.27 27.52 23.575 90-94 20.9 27.515 27.46 24.125 95-99 20.46 28.335 27.18 24.025 100-104 20.84 28.925 26.36 23.875 105-109 20.86 28.38 27.095000000000002 23.665 110-114 21.025 27.98 27.045 23.95 115-119 21.245 27.810000000000002 27.495000000000005 23.45 120-124 20.74 27.665 27.51 24.085 125-129 20.455000000000002 27.065 27.58 24.9 130-134 20.73 27.279999999999998 27.935 24.055 135-139 21.13 27.63 27.555000000000003 23.685000000000002 140-144 21.654999999999998 27.615000000000002 26.840000000000003 23.89 145-149 20.77 27.744999999999997 27.185 24.3 150-151 20.5875 26.8375 28.025 24.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 0.0 25 2.0 26 6.5 27 7.0 28 8.0 29 16.5 30 22.5 31 23.0 32 30.0 33 38.5 34 50.5 35 70.5 36 86.5 37 99.5 38 120.0 39 145.0 40 157.0 41 175.5 42 197.0 43 214.5 44 244.0 45 272.0 46 273.0 47 257.0 48 249.5 49 230.5 50 187.0 51 156.0 52 148.0 53 123.0 54 91.0 55 71.5 56 69.0 57 55.0 58 28.5 59 19.0 60 12.5 61 8.5 62 6.0 63 6.0 64 4.5 65 1.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.17204301075269 86.65 2 6.263440860215054 11.65 3 0.43010752688172044 1.2 4 0.13440860215053765 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.8625 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.425 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161426 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161426_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3205 37.0 37.0 37.0 37.0 37.0 2 36.032 37.0 37.0 37.0 37.0 37.0 3 36.1575 37.0 37.0 37.0 37.0 37.0 4 36.1135 37.0 37.0 37.0 37.0 37.0 5 36.1845 37.0 37.0 37.0 37.0 37.0 6 36.085 37.0 37.0 37.0 37.0 37.0 7 36.145 37.0 37.0 37.0 37.0 37.0 8 36.262 37.0 37.0 37.0 37.0 37.0 9 36.1895 37.0 37.0 37.0 37.0 37.0 10-14 36.2197 37.0 37.0 37.0 37.0 37.0 15-19 36.19109999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.1554 37.0 37.0 37.0 37.0 37.0 25-29 36.1173 37.0 37.0 37.0 37.0 37.0 30-34 36.091499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.128600000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.0218 37.0 37.0 37.0 37.0 37.0 45-49 36.0493 37.0 37.0 37.0 37.0 37.0 50-54 36.0971 37.0 37.0 37.0 37.0 37.0 55-59 35.998900000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.96 37.0 37.0 37.0 37.0 37.0 65-69 35.9778 37.0 37.0 37.0 37.0 37.0 70-74 35.833000000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.871599999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.9364 37.0 37.0 37.0 37.0 37.0 85-89 35.9304 37.0 37.0 37.0 37.0 37.0 90-94 35.8273 37.0 37.0 37.0 37.0 37.0 95-99 35.805699999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.8203 37.0 37.0 37.0 37.0 37.0 105-109 35.8356 37.0 37.0 37.0 37.0 37.0 110-114 35.8119 37.0 37.0 37.0 37.0 37.0 115-119 35.74830000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.6979 37.0 37.0 37.0 37.0 37.0 125-129 35.6287 37.0 37.0 37.0 37.0 37.0 130-134 35.53789999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.6777 37.0 37.0 37.0 37.0 37.0 140-144 35.572500000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.571600000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.0475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 2.0 15 2.0 16 2.0 17 2.0 18 0.0 19 0.0 20 3.0 21 1.0 22 2.0 23 5.0 24 8.0 25 9.0 26 12.0 27 9.0 28 12.0 29 23.0 30 25.0 31 36.0 32 56.0 33 96.0 34 184.0 35 518.0 36 2703.0 37 283.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.725 25.05 9.4 23.825 2 29.325000000000003 26.224999999999998 27.3 17.150000000000002 3 22.45 28.799999999999997 28.9 19.85 4 23.175 36.25 22.2 18.375 5 24.875 37.125 19.875 18.125 6 21.85 39.45 21.15 17.549999999999997 7 20.875 23.075000000000003 36.199999999999996 19.85 8 20.225 26.075 28.000000000000004 25.7 9 22.5 23.075000000000003 30.25 24.175 10-14 23.65 29.354999999999997 25.679999999999996 21.315 15-19 22.725 27.755000000000003 27.405 22.115000000000002 20-24 23.05 27.715 27.08 22.155 25-29 22.805 28.144999999999996 27.47 21.58 30-34 23.105 28.285 27.425 21.185000000000002 35-39 23.115 27.85 27.375 21.66 40-44 22.705000000000002 28.175 27.88 21.240000000000002 45-49 23.3 27.52 27.894999999999996 21.285 50-54 23.064999999999998 27.58 27.584999999999997 21.77 55-59 23.345 27.529999999999998 27.875 21.25 60-64 23.655 27.339999999999996 27.169999999999998 21.834999999999997 65-69 23.369999999999997 27.435 27.205000000000002 21.990000000000002 70-74 23.16 27.97 27.18 21.69 75-79 23.5 27.27 27.439999999999998 21.790000000000003 80-84 23.044999999999998 28.000000000000004 26.695 22.259999999999998 85-89 23.215 27.445000000000004 27.229999999999997 22.11 90-94 23.525 27.565 26.985 21.925 95-99 23.64 27.79 27.24 21.33 100-104 23.799999999999997 27.834999999999997 26.784999999999997 21.58 105-109 24.125 26.895000000000003 27.79 21.19 110-114 24.36 27.565 27.26 20.815 115-119 23.815 28.349999999999998 26.950000000000003 20.885 120-124 24.59 27.794999999999998 26.784999999999997 20.830000000000002 125-129 24.295 27.595 27.169999999999998 20.94 130-134 23.745 27.77 27.245 21.240000000000002 135-139 23.95 27.365000000000002 27.334999999999997 21.349999999999998 140-144 23.87 28.015 27.634999999999998 20.48 145-149 24.095 27.665 27.279999999999998 20.96 150-151 24.462500000000002 28.199999999999996 26.224999999999998 21.1125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.5 7 1.0 8 0.5 9 1.0 10 1.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 2.5 24 1.0 25 2.0 26 4.0 27 4.0 28 6.0 29 8.0 30 11.0 31 16.5 32 21.0 33 25.5 34 33.0 35 53.0 36 79.0 37 95.5 38 121.5 39 150.0 40 160.0 41 191.0 42 240.0 43 260.5 44 265.0 45 273.5 46 264.0 47 236.0 48 232.5 49 228.0 50 189.5 51 156.0 52 134.5 53 105.0 54 91.0 55 82.0 56 61.5 57 45.5 58 34.5 59 31.5 60 22.0 61 12.0 62 8.5 63 8.0 64 6.5 65 2.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.33333333333333 86.1 2 5.853658536585367 10.8 3 0.4607046070460705 1.275 4 0.13550135501355012 0.5 5 0.10840108401084012 0.5 6 0.0 0.0 7 0.02710027100271003 0.17500000000000002 8 0.02710027100271003 0.2 9 0.05420054200542006 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCC 8 0.2 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit GGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.425 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGAGG 10 0.006830828 145.0 145 GTAACAA 10 0.006830828 145.0 1 >>END_MODULE Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667633 spots for SRR12161426.sra Written 667633 spots for SRR12161426.sra Read 667640 spots for SRR12161426.sra Written 667640 spots for SRR12161426.sra SRR ids: ['SRR12161426.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tqfz0htm SRR12161426.sra spots: 13352667 blocks: [[1, 667633], [667634, 1335266], [1335267, 2002899], [2002900, 2670532], [2670533, 3338165], [3338166, 4005798], [4005799, 4673431], [4673432, 5341064], [5341065, 6008697], [6008698, 6676330], [6676331, 7343963], [7343964, 8011596], [8011597, 8679229], [8679230, 9346862], [9346863, 10014495], [10014496, 10682128], [10682129, 11349761], [11349762, 12017394], [12017395, 12685027], [12685028, 13352667]] SRR12161426 file size 4516120 SRR12161426 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161426 SRR12161426_1.fastq SRR12161426_2.fastq Input file: SRR12161426_1.fastq Paired file: SRR12161426_2.fastq trimmed: SRR12161426-trimmed-pair1.fastq, SRR12161426-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:30:19 2025 >> started Thu Feb 13 16:30:34 2025 >> done (14.731s) 13352667 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 2181 ( 0.02%) empty read pairs filtered out after trimming by size control 13350475 (99.98%) read pairs available; of these: 563660 ( 4.22%) trimmed read pairs available after processing 12786815 (95.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 4 0.00% 21 2 0.00% 22 1 0.00% 23 5 0.00% 24 7 0.00% 25 7 0.00% 26 4 0.00% 27 7 0.00% 28 6 0.00% 29 8 0.00% 30 7 0.00% 31 6 0.00% 32 11 0.00% 33 9 0.00% 34 16 0.00% 35 10 0.00% 36 9 0.00% 37 11 0.00% 38 12 0.00% 39 12 0.00% 40 7 0.00% 41 11 0.00% 42 7 0.00% 43 12 0.00% 44 11 0.00% 45 13 0.00% 46 4 0.00% 47 13 0.00% 48 21 0.00% 49 19 0.00% 50 24 0.00% 51 27 0.00% 52 20 0.00% 53 16 0.00% 54 13 0.00% 55 34 0.00% 56 23 0.00% 57 33 0.00% 58 35 0.00% 59 37 0.00% 60 43 0.00% 61 46 0.00% 62 48 0.00% 63 38 0.00% 64 66 0.00% 65 72 0.00% 66 67 0.00% 67 78 0.00% 68 116 0.00% 69 100 0.00% 70 115 0.00% 71 126 0.00% 72 140 0.00% 73 176 0.00% 74 194 0.00% 75 211 0.00% 76 229 0.00% 77 243 0.00% 78 319 0.00% 79 320 0.00% 80 382 0.00% 81 388 0.00% 82 485 0.00% 83 525 0.00% 84 586 0.00% 85 631 0.00% 86 677 0.01% 87 767 0.01% 88 777 0.01% 89 945 0.01% 90 1075 0.01% 91 1152 0.01% 92 1276 0.01% 93 1387 0.01% 94 1568 0.01% 95 1587 0.01% 96 1754 0.01% 97 2033 0.02% 98 2003 0.02% 99 2267 0.02% 100 2438 0.02% 101 2492 0.02% 102 2825 0.02% 103 2978 0.02% 104 3326 0.02% 105 3460 0.03% 106 3648 0.03% 107 3852 0.03% 108 3915 0.03% 109 4312 0.03% 110 4381 0.03% 111 4695 0.04% 112 5081 0.04% 113 5155 0.04% 114 5651 0.04% 115 5857 0.04% 116 6057 0.05% 117 6438 0.05% 118 6785 0.05% 119 7197 0.05% 120 7584 0.06% 121 7757 0.06% 122 8280 0.06% 123 8622 0.06% 124 8980 0.07% 125 9448 0.07% 126 10051 0.08% 127 10134 0.08% 128 10657 0.08% 129 11009 0.08% 130 11479 0.09% 131 11473 0.09% 132 12580 0.09% 133 13007 0.10% 134 13488 0.10% 135 13979 0.10% 136 14499 0.11% 137 14857 0.11% 138 15121 0.11% 139 16126 0.12% 140 16215 0.12% 141 16934 0.13% 142 17911 0.13% 143 18312 0.14% 144 19596 0.15% 145 19842 0.15% 146 20663 0.15% 147 21247 0.16% 148 22053 0.17% 149 22218 0.17% 150 23443 0.18% 151 12786815 95.78% 13350475 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=22 prefix-density=1.03 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=9.18 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=2.4 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.15 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=21 prefix-density=1.17 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=52.14 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR12161426 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:31:17 Started mapping on | Feb 13 16:31:17 Finished on | Feb 13 16:32:58 Mapping speed, Million of reads per hour | 475.86 Number of input reads | 13350475 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12441387 Uniquely mapped reads % | 93.19% Average mapped length | 299.21 Number of splices: Total | 12990945 Number of splices: Annotated (sjdb) | 12762775 Number of splices: GT/AG | 12733697 Number of splices: GC/AG | 216396 Number of splices: AT/AC | 7212 Number of splices: Non-canonical | 33640 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330320 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 138900 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 578768 578768 578768 N_multimapping 330320 330320 330320 N_noFeature 383698 12227033 429040 N_ambiguous 254650 866 85087 UnstrandedReadsAssigned:11803039 PositiveStrandReadsAssigned:213488 NegativeStrandReadsAssigned:11927260 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161426 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161426-trimmed-pair1.fastq SRR12161426-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,350,475 reads, 11,977,004 reads pseudoaligned [quant] estimated average fragment length: 274.319 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52401 SRR12161426.ke.tsv 34699 SRR12161426.se.tsv 87100 total ==> SRR12161426.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.68 272 9.07996 Potri.005G024800.1.v4.1 1035 761.681 212 16.2104 Potri.004G059700.1.v4.1 961 687.826 50 4.23373 Potri.007G009000.2.v4.1 1416 1142.68 0 0 Potri.003G141000.2.v4.1 2943 2669.68 342 7.46102 Potri.016G087400.1.v4.1 270 67.0157 544 472.774 Potri.015G069301.1.v4.1 564 303.84 0 0 Potri.010G195200.1.v4.1 1773 1499.68 10 0.388358 Potri.012G127500.1.v4.1 977 703.765 252 20.8547 ==> SRR12161426.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 231 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 160 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR12161426 completed mapping pipeline successfully